VIROLOGICA SINICA, February 2008, 23 (1):68-72 DOI 10.1007/s12250-008-2901-7 CLC number: S852.65

Document code: A

Article ID: 1674-0769 (2008) 01-0068-05

A Pair of Novel Primers for Universal Detection of the NS1 Gene from Various Bluetongue Virus Serotypes* Hui-qiong YIN 1, Gai-ping ZHANG 2, Hong ZHANG 2 and Jin-gang ZHANG 1** ( 1. Viral Safety Laboratory of National Center of Biomedical Analysis, Institute of Transfusion Medicine, The Academy of Military Medical Sciences, Beijing 100850, China; 2. Henan Key Laboratory of Animal Immunology, Henan 450002, China )

Abstract: Twenty five serotypes of Bluetongue virus (BTV) have been identified worldwide. Rapid and reliable methods of virus universal detection are essential for fighting against bluetongue (BT). We have therefore developed and evaluated a pair of primers which can detect various serotypes of BTV by RT-PCR. Analysis of the viral protein 7 (VP7) and the non-structural protein (NS1) gene from different serotypes of BTV by DNAstar showed that the 5' end of the NS1 gene is the most conserved region. The primer pairs (P1 and P2) were designed based on the highly conserved region of NS1. The novel primers were evaluated by detecting BTV serotypes 1, 3, 5, 8, 10, 11, 21 and 22. The specificity of the primers was estimated by comparing to gene sequences of viruses published in GenBank, and further assessed by detecting BTV serotype 1-12 and Epizootic hemorrhagic disease virus (EHDV) serotype 1-4. The sensitivity and repeatability of PCR with the novel primers were evaluated by successfully detecting the recombinant plasmid pGEM-T121 containing the diagnosed nucleotide sequence. Our results suggest that these unique primers can be used in high throughout and universal detection of the NS1 gene from various BTV serotypes. Key words: RT-PCR; Bluetongue virus (BTV); NS1; Universal detection

Bluetongue (BT) is infectious and non-contagious,

restrictions likely to be put into place in a country

which is transmitted by haematophagous insects of the

once the infection is discovered (14). Nations which

genus Culicoides, family Ceratopogonidae (4). BT

are free from BT attempt to prevent the introduction

has been included in the Office International des

and potential establishment of BT by imposing

Epizooties (OIE) List of notifiable diseases (formerly

restrictions on the importation of hoofstock, including

List A) (12), and is a vector-borne animal disease of

wild ruminants, from nations that either have the

economical importance due to the international trade

disease or share a common border with a country that

Received: 2007-08-29, Accepted: 2007-11-14 * Foundation item: Hi-Tech Research and Development Program of China (2006AA10Z446) ** Corresponding author. Tel: +86-10-68151876, E-mail: [email protected]

has BT. BT occurred in South Africa in the late nineteeth century. At present, it has been distributed widely in over 50 nations of tropical, subtropical and temperate regions of the world. The disease is

Virol. Sin. (2008) 23: 68-72

69

prevalent in 29 provincial areas of China (18). In July

To determine the conserved region, the VP7 genes

2006 a sixth serotype, BTV serotype 8 was detected in

(segment 7) of BTV 1, 2, 12, 16, 18 and 23, and the

Northern Europe (a new European serotype), with

NS1 genes (segment 6) of BTV 10, 13, 17, 20 and 21

disease outbreaks in Belgium, Holland, Germany and

published on GenBank were aligned using the DNA-

France (5, 10), suggesting that the whole Europe is at

Star Software package. Results revealed that the

risk from this and possibly other arbovirus diseases. In

percent identities of VP7 genes ranged from 73.1% to

July and August 2007 bluetongue broke out again in

97.3%, while the percent identities of NS1 genes

Belgium, Spain, France and Netherlands (http:// www.

ranged from 79.0% to 98.7%, and the percent identity

oie.int/).

of the 5' end of NS1 gene containing a highly

Bluetongue virus (BTV), a member of genus Orbivirus, a family Reoviridae, and infects both domestic,

conserved region in the different serotypes was 93.8% (not shown).

captive and free-ranging ruminants. Twenty-five sero-

According to the above results, the unique

types of BTV are distributed throughout the world (3).

oligonucleotide primers were designed based on the 5'

The virus is non-enveloped with a double shelled

end of NS1 gene of BTVs (GenBank accession nos.

structure and an RNA genome consisting of 10

AY462225, M97762, NC_006025, X15891, X56735

variously sized double-stranded (ds) RNA segments

and Y00422). Primer 1 extended from position 10

(8). The genome segments code for viral proteins (VP).

through 30. Primer 2 was located from positions 110

Three nonstructural and seven structural proteins are

through 130 of the complementary strand. These

incorporated into the double layer protein coat. The

primers produced a 121bp PCR amplified fragments.

nonstructural proteins NSl, NS2 and NS3 are coded by

The oligonucleotide sequences of the primers were as

genome segments 6, 8 and 10, respectively. VP7,

follows:

which was reported to be a conserved protein, is

Primer 1: 5' to 3' GTTCTCTAGTTGGCAACCACC

coded by genome segment 7 (15). The NS1 gene of

Primer 2: 5' to 3' GTGACTGCAAGTCCATTGAGG

BTV is highly conserved among the 10 dsRNA of

The sequences of the primers were searched for

BTV serogroup (9).

homologs in genes of other viruses published on

Some improved methods based on PCR have been

GenBank (NCBI, http://www.ncbi.nlm.nih.gov/) using

introduced which are important for BTV detection (1,

the Blast algorithm. The result revealed that the

7, 11, 13, 17). However, these methods are incon-

primers have homology to the BTV gene only (not

venient and are unable to rapidly characteristize or

shown).

detect the virus in a universal manner. Therefore,

To evaluate the practicability of the primers, BTV

development of a single set of novel primers for

serotypes 1, 3, 5, 8, 10, 11, 21 and 22 reference strains

convenient and rapid detection of various BTV

(obtained from China Animal Health and Epide-

serotypes using conventional RT-PCR will facilitate

miology Center) were assayed by RT-PCR using the

the monitoring and prevention of the disease both

above primers. PCR products were electrophoresed on

effectively and rapidly.

a 2.5% agarose gel and observed by ethidium

70

Virol. Sin. (2008) 23: 68-72

Fig. 1 Ethidium bromide-stained agarose gel electrophoresis showing the 121 bp PCR product from eight BTV serotypes,

Fig.2. Sensitivity detection for pGEM-T121. M, DL2000

respectively. M, DL2000 marker; N, Negative control; 1-8,

marker; 1-5, 1×108 to 1×104 copies of pGEM-T121.

BTV 1, BTV 3, BTV 5, BTV 8, BTV 10, BTV 11, BTV 21 and BTV 22.

pGEM-T121 (equivalent to 3.4 × 10-4 μg/mL) (Fig. 2).

bromide-staining. The result as shown in Fig. 1

To determine repeatability of the assay with the

indicated that eight different serotypes of BTV were

primers, the pGEM-T121 test was repeated three

detected successfully.

times, and five identical samples were tested each

To confirm the specificity of the primers, BTV serotypes 1 to 12 and the closely related orbivirus

time. The results showed that all of the samples containing pGEM-T121 were positive.

Epizootic hemorrhagic disease virus (EHDV) sero-

To evaluate the actual value of the method with the

types 1 to 4 reference strains (obtained from Yunnan

primers, mimic specimens, which contained different

Entry-Exit Inspection and Quarantine Bureau) were

concentrations of the re-suspended viral fluids and

detected with the above primers. The result showed

calf serum, were assayed using the primers. The

that BTV serotypes 1 to 12 were detected by the

mimic specimens were prepared by mixing 50μL,

primers as positive, whereas EHDV serotypes 1 to 4

100μL, 150μL and 200μL viral fluids of BTV 5 with

were detected as negative (not shown). This indicated

150μL, 100μL, 50μL and 0μL of BTV antibodies

that the above primers are specific to BTV, and no

freed calf serum (GibcoTM, New York, USA) res-

cross reaction occurred with EHDV.

pectively. The mimic specimens were centrifuged at 8

To prepare a standard sample pGEM-T121, the

000 r/min for 3 min, and the supernatants were

amplified products of BTV5 were cloned into

subjected to viral RNA extraction and RT-PCR

pGEM-T Easy Vector (Promega, Madison, USA) and

analysis using the above primers. The result con

transformed into E. coli cells. The positive clones

firmed that these samples could be detected as

selected by blue-white screening and colony PCR

positive (Fig. 3).

were sequenced. Sequence analysis revealed that there was

a

perfect nucleotide

match

between

the

pGEM-T121 and detected fragment (not shown).

Monitoring and controlling of BTV infection in cattle, sheep and goats remain a top priority in BTVendemic and epidemic countries that are concerned

To estimate the sensitivity of RT-PCR with the

with exporting livestock free of this disease or those

primers, serially diluted pGEM-T121 were used as

restricting the introduction of new serotypes into already

template and PCR were conducted using above

existing endemic populations. While serological assays

primers. Result showed that the sensitivity of the

(16) are sensitive and easy to use they only provide

assay with the primers was 105 copies/μL of the

evidence of earlier animal exposure to BTV but not

Virol. Sin. (2008) 23: 68-72

71

good. Results also revealed that the mimic specimens could be detected successfully. Moreover, completion of the assay required approximately only 3 h. In this study, each experiment was performed in triplicate with identical results. Fig. 3. Detection of the mimic specimens with the assay. M, DL2000 Marker; 1, 50μL BTV5 + 150μL calf serum; 2, 100μL BTV5 + 100μL calf serum; 3, 150μL BTV5 + 50μL calf serum;

As a summary, the distinct primer set is suitable for detecting the NS1 gene of different BTV serotypes using RT-PCR, and has the potential to be a useful tool

4, 200μL BTV5.

for high throughout screening and monitoring of BTV. necessarily an ongoing infection. Earlier work on cattle

and

sheep

has

provided

evidence

that

seropositivity does not correlate with circulating BTV RNA or the presence of infectious virus in the blood of the seropositive animals. PCR is the best-known

References 1. Anthony S, Jones H, Darpel K E, et al. 2007. A duplex RT-PCR assay for detection of genome segment 7 (VP7 gene) from 24 BTV serotypes. J Virol Methods, 141: 188-197.

and most successfully implemented diagnostic mole-

2. Charalambos B, Maria K, Vassiliki S, et al. 2001.

cular technology to the date, and it can monitor the

Bluetongue virus diagnosis of clinical cases by a duplex

existence of virus particles (2, 6). Moreover, the

reverse transcription-PCR: a comparison with conventional methods. J Virol Methods, 98: 77-89.

technique is far simpler and much faster than a regular

3. Davies F G, Mungai J N, Pini A. 1992. A new bluetongue

serological test and a viral isolation identification

virus serotype isolated in Kenya. Vet Microbial, 31: 25-32.

method. However, current RT-PCR methods with one

4. Fauquet C M, Mayo M A. 2001. The 7th ICTV report.

pair of primers do not provide universal detection of different serotypes of BTV. This study analyzed the conserved genes VP7 and NS1 of BTV. The highly conserved region 5' end of the NS1 gene was taken as the detected fragment and unique primers were designed based on this region.

Arch Virol, 146: 189-194. 5. Gloste J, Mellor P S, Burgin L, et al. 2007. Will bluetongue come on the wind to the United Kingdom in 2007?. Vet Red, 160: 422-426. 6. Johnson D J, Wilson W C, Paul P S, et al. 2000. Validation of a reverse transcriptase multiplex PCR test for the serotype determination of U.S. isolates of bluetongue virus. Vet Microbial, 76: 105-115.

The results indicated that the novel primers could be

7. Kato C Y, Mayer R T. 2007. An improved, high-

used in RT-PCR to detect successfully and specifi-

throughput method for detection of bluetongue virus RNA

cally for 14 different randomly selected serotypes of BTV, and no cross-reactivity with the closely related

in Cullicoides midges utilizing infrared-dye-labeled primers for reverse transcriptase PCR. J Virol Methods, 140: 140-147.

orbivirus EHDV was observed. The sensitivity of the

8. Kovi R C, Dahiya S, Prasad G, et al. 2006. Nucleotide

specific RT-PCR was 105 copies/μL of the pGEM-

sequence analysis of VP7 gene of Indian isolates of

T121 in preliminary test, and this should be improved

bluetongue virus vis-à-vis other serotypes from different parts of the world. DNA Seq, 17: 187-198.

through optimization of reaction conditions. The repea-

9. Mecham J O. 2006. Detection and titration of bluetongue

tability of the method with the novel primers was

virus in Culicoides insect cell culture by an antigen-capture

72

Virol. Sin. (2008) 23: 68-72 enzyme-linked immunosorbent assay. J Virol Methods,

a Molecular Beacon fluorescent probe assay. J Virol

135: 269-271.

Methods, 137: 34-42.

10. Mehlhorn H, Walldorf V, Klimpel S, et al. 2007. First

14. Racloz V, Straver R, Kuhn M, et al. 2006. Establishment

occurrence of Culicoides obsoletus-transmitted Bluetongue

of an early warning system against bluetongue virus in

virus epidemic in Central Europe. Parasitol Res, 101:

Switzerland. Schweiz Arch Tierheilkd, 148: 593-598.

219-228.

15. Roy P. 1989. Bluetongue virus genetics and genome

11. Miguel A J, Montserrat A, Elena S M, et al. 2006. High throughput detection of bluetongue virus by a new

structure. Virus Research, 13:179-206. 16. Stuart D I, Grimes J M. 2006. Structural studies on

real-time fluorogenic reverse transcription-polmerase chain

Orbivirus proteins and particles. CTMI, 309: 221-244.

reaction: Application on clinical samples from current

17. Toussaint J F, Sailleau C, Breard E, et al. 2007.

Mediterranean outbreaks. J Vet Diagn Invest, 18: 7-17. th

12. OIE Terrestrial animal health code, 13

ed. 2004.

Terrestrial Animal Health Code. Thirteenth Edition, Office International des Epizooties, Paris. 13. Orru G, Ferrando M L, Meloni M, et al. 2006. Rapid detection and quantitation of Bluetongue virus (BTV) using

Bluetongue virus detection by two real-time RT-qPCRs targeting two different genomic segments. J Virol Methods, 140: 115-123.

18. Yan G F. 2000. Research progress of bluetongue disease. Gansu Animal and Veterinary Sciences, 153: 32-34. (in Chinese)