Neotrop Entomol DOI 10.1007/s13744-016-0466-y

SYSTEMATICS, MORPHOLOGY AND PHYSIOLOGY

A Potentially Endangered New Species of Euptychia Hübner, 1818 (Lepidoptera: Nymphalidae: Satyrinae) from the Atlantic Coastal Forest of Brazil S NAKAHARA1, EP BARBOSA2, AVL FREITAS2 1

McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Univ of Florida, Gainesville, FL , USA Depto de Biologia Animal and Museu de Zoologia, Instituto de Biologia Animal, Univ Estadual de Campinas, Campinas, São Paulo, Brasil

2

Keywords Atlantic forest, conservation, Euptychiina, taxonomy Correspondence S Nakahara, McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Univ of Florida, Gainesville, FL 32611, USA; [email protected] Edited by Analia A Lanteri – Univ Nacional de La Plata

Abstract A new satyrine species in the subtribe Euptychiina, Euptychia atlantica Nakahara & Freitas sp. nov., is described from the Atlantic coastal forest of Brazil. Based on the existing museum specimens, E. atlantica sp. nov. is known from the coastal montane forests of Rio de Janeiro to south Bahia, a unique biogeographical region which is undergoing rapid degradation. Illustrations of adults and their genitalia, as well as a distribution map, are provided herein, in addition to a discussion of the relationships and conservation status of the new species.

Received 25 August 2016 and accepted 3 November 2016 * Sociedade Entomológica do Brasil 2017

Introduction The Atlantic coastal forest of Brazil is world-renowned for its high species richness and endemism, being thus regarded as one of the most unique biogeographical regions in the Neotropical realm. This forest is home to more than 22,000 species in surveyed groups, including plants, mammals, birds, reptiles and amphibians, with a remarkable more than 8000 endemic species (Myers et al 2000, Mittermeier et al 2005, Tabarelli et al 2005). The original extent of the Atlantic forest covered 1.5 million km2, predominantly along the Brazilian Atlantic coast, but also extending into Paraguay and Argentina (Morellato & Haddad 2000, Tabarelli et al 2010). However, only approximately 10% of the original forest remains today, due to human disturbance, and the forest is still suffering from extensive habitat alteration (e.g. Ribeiro et al 2009, Huang et al 2009). Concerning butterflies, the level of endemism in the Atlantic Forest is as high as 45% of all Atlantic forest butterfly taxa (Brown 1991, 1992, Brown & Freitas 2000b), with 31 out of 55 threatened Brazilian taxa endemic

to this biome (e.g. Parides ascanius (Cramer, 1775) (Papilionidae); Charonias theano (Boisduval, 1836) (Pieridae); Paulogramma hydarnis (Godart, [1824]) (Nymphalidae); Tyler et al 1994, Freitas et al 2011, 2014), with some of these taxa possibly extinct (such as the nymphalids Hyalyris fiammetta (Hewitson, 1852) and Dasyophthalma vertebralis (Butler, 1869); Freitas & Marini-Filho 2011). With over 400 described species, the subtribe Euptychiina (Nymphalidae: Satyrinae) has seen an explosion of interest over the past few years in terms of research into its genericand/or species-level classification (e.g. Peña et al 2010, Matos-Maraví et al 2013, Freitas et al 2013, Cong & Grishin 2014, Nakahara et al 2015a, Costa et al 2016). Although the genus Euptychia Hübner, 1818 is probably monophyletic (Nakahara, unpub. data), the relationships between Euptychia and the remainder of the subtribe remain unresolved (Peña et al 2010), and a recent study by SN illustrated discrepancies between the perceived and true species richness of this genus (Nakahara et al 2015a). Relatively distinct Euptychia species have been recently described (e.g.

Nakahara et al

Euptychia neblina A. Warren & Nakahara, 2015; E. lacandona A. Warren & Nakahara, 2015; Nakahara et al 2015c) and still over a dozen undescribed taxa remain to be described in a forthcoming revision of the genus, after which it will be one of the most species-rich genera within the subtribe Euptychiina (Nakahara, in prep). The purpose of this paper is to describe and name a new species of Euptychia from the Atlantic coastal forest of Brazil in order to bring attention to yet another element of the rich fauna of this distinctive biogeographic region. Along with E. boulleti (Le Cerf, 1919) (Freitas et al 2012) and another undescribed species, this new Euptychia species appears to be endemic to this region and we discuss its systematic placement and conservation status. This new species is described prior to the revision of the genus to fulfil requirements of the relevant research permit obtained by AVLF via “Instituto Chico Mendes de Conservação da Biodiversidade” (ICMBio).

Material and Methods Morphological Study External morphology and dissections were studied using standard techniques. Abdomens were soaked in hot 10% KOH solution for 10 min before dissection, and dissected parts were stored in glycerol. Photographs of the male genitalia were taken using a Zeiss SteREO Discovery. V20 Stereomicroscope (Zeiss, Germany). The terminology for wing venation, wing pattern elements, genital and abdominal structures follows that in Nakahara et al (2015a). The acronyms for the examined collections are the following: DZUP

MNRJ

MZSP MZUEFS

OM VOB ZMHU ZUEC

Entomological Collection Padre Jesus Santiago Moure, Universidade Federal do Paraná, Curitiba, Paraná, Brazil Museu Nacional do Rio de Janeiro, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil Museu de Zoologia, Universidade de São Paulo, São Paulo, São Paulo, Brazil Entomological Colletion Prof. Johann Becker, Museu de Zoologia da Universidade Estadual de Feira de Santana, Bahia, Brazil Olaf H. H. Mielke collection, Curitiba, Paraná, Brazil Vitor O. Becker collection, Reserva Serra Bonita, Camacan, Bahia, Brazil Zoologisches Museum, Humboldt Universität, Berlin, Germany Museu de Zoologia da Universidade Estadual de Campinas, Unicamp, Campinas, São Paulo, Brazil

DNA Sequencing Genomic DNA was extracted from two legs of one adult of the new species (MGCL-LOAN 216) using the OmniPrep™ (Biosciences, St. Louis, MO USA) extraction kit following the standard protocol. Genomic DNA was stored in TE buffer at −20°C. A partial fragment of the mitochondrial gene cytochrome c oxidase I (COI) was amplified using the primer pairs Ron (forward, GGATCACCTGATATAGCATTCCC) and Nancy (reverse, CCTGGTAAAATTAAAATATAAACTTC) (e.g. Elias et al 2007), purified and sequenced using the standard techniques (e.g. Nakahara et al 2015b). The sequence was uploaded to the GenBank (accession number KX833117).

Results Euptychia atlantica Nakahara & Freitas, sp. nov. http://zoobank.org/urn:lsid:zoobank.org:act:3017716E1594-4470-818F-47C99F82550D (Figs 1–2). Euptychia cf. hannemanni; Brown & Freitas 2000a: 104. Diagnosis The male of E. atlantica sp. nov. is distinguished from male E. audacia Brévignon, Fratello & Nakahara, 2015 by its rather brownish ground colour on the ventral surface (rather greyish in E. audacia), in addition to its rather broad and rounded forewing shape and presence of a prominent

Fig 1 Euptychia atlantica sp. nov., dorsal on the left, ventral on the right. Above—male paratype from Serra Bonita, Camacan, Bahia, Brazil (VOB); below—female paratype, same locality (ZUEC LEP 9869).

A new Euptychia from the Atlantic forest

Fig 2 Genitalia images of Euptychia atlantica sp. nov.: A—male genitalia in dorsal view; B—male genitalia in lateral view; C—male genitalia in ventral view; D—serrated inner margin of valve; E—aedeagus in dorsal view; F—aedeagus in lateral view (ZUEC LEP 9866); G—female genitalia in lateral view; H—lamella antevaginalis in ventral view; I—female genitalia in posterior view (ZUEC LEP 9869); abbreviations: te tegumen, un uncus, aa appendices angulares, ju juxta, va valva, sa saccus, ae aedeagus, la lamella antevaginalis, ob ostium bursae, db ductus bursae, cp corpus bursae, sg signa.

ocellus in ventral hindwing cell M3 (forewing shape triangular and an ocellus in ventral hindwing cell M3 absent or present as a hint in E. audacia); it is distinguished from male Euptychia pillaca Nakahara & Willmott, 2015 by possesing an ocellus in ventral hindwing cell M3 (ocellus in ventral hindwing cell M3 absent in E. pillaca); it is distinguished from E. truncata Nakahara & Hall, 2015 by possessing an ocellus in

ventral hindwing cell M3, in addition to the forewing apex not being truncated (ocellus in ventral hindwing cell M3 absent and forewing apex truncated in E. truncata). The female of E. atlantica sp. nov. is easily distinguished from females of E. audacia, E. pillaca and E. truncata by its whitish dorsal surface. The possession of an ocellus in ventral hindwing cell M3 can also be used to distinguish female E. atlantica sp. nov.

Nakahara et al

from E. pillaca and E. truncata. The female genitalia of E. atlantica sp. nov. is distinguished from E. audacia, E. pillaca and E. truncata by its curved and rounded ventral margin of the lamella antevaginalis in posterior view, whereas this margin appears more angular in those three species. Furthermore, E. atlantica sp. nov. is known only from the Atlantic coastal region, where none of these similar and/or closely related species occurs.

Description Male: Forewing length 16.5–18.0 mm (n = 5), hindwing length 12.5–13.0 mm (n = 3). Head: Eyes with many sparse dark brown hairs, with white scales at base; first segment of labial palpus brown, second segment length almost twice as great as eye depth, covered with short white hair-like scales and white scales laterally, as well as white scales on dorsal surface, ventrally adorned with brown hair-like scales similar in length to segment width, third segment slightly shorter than one-fifth of second segment and covered with creamy-white scales; antennae approximately half of forewing length, with ca. 35–36 segments (n = 2), distal 10–11 segments composing club. Thorax: Dorsally and ventrally covered with dark brown scales and with additional long, sparse multi-coloured hairlike scales near the forewing insertion; ventrally scattered with greyish scales. Legs: Foreleg brown with long greyish hairs, tibia and femur almost same length, tarsus slightly shorter; midleg and hindleg brown, all segments covered with creamy scales, tarsus and tibia adorned with spines ventrally, tibial spurs absent at distal end of tibia. Abdomen: Eighth tergite fully developed, similar to seventh tergite. Wing venation: Most of forewing subcostal vein swollen; base of cubitus not swollen; forewing recurrent vein present in discal cell; hindwing humeral vein not developed. Wing shape: Forewing subtriangular, apex somewhat rounded, costal margin convex, outer margin very slightly convex, tornus angular, inner margin straight but curved at base towards thorax; hindwing slightly elongate, costal margin slightly convex, strongly curved at base towards thorax, apex angular, outer margin convex, very slightly undulating, tornus angular, inner margin slightly lobed near base and curved inward near tornus, anal lobe convex, slightly round. Dorsal forewing: Ground colour light brown, apex darker, black area extending down to Cu1, semi-translucent and thus subtly revealing ventral dark bands and ocelli (ocelli and anterior portion of submarginal and marginal bands indistiunct due to dark apex). Dorsal hindwing: Similar to dorsal forewing except for apex not being darker.

Ventral forewing: Ground colour greyish; reddish-brown band extends posteriorly of swollen subcostal vein from radius to wing base; reddish-brown, straight discal band, slightly broader than previous band, extends from radial vein to 2A; concolourous postdiscal band, similar to discal in width, extending from radial vein towards inner margin, crossing origin of M3, until reaching vein 2A, crossing wing in slightly outward direction, slightly narrowing towards posterior end and slightly bent outwards in cell Cu2; broad, faint, indistinct dark shading present distal to post discal band, from near costa towards Cu1 (around submarginal ocelli); reddishbrown sinuate submarginal band extending from apex towards tornus, broadening and undulating towards cell Cu1, slightly narrowing after posteior half of cell Cu2, bent inwards below 2A; undulating dark brown marginal band, significantly narrower than previous four bands, extending from apex towards tornus, somewhat straight below Cu1; fringe brownish; ocellus in cell M1, spilling over veins M1 and M2, black with one white pupil in center, ring yellowish, similar, but smaller ocellus, central black coloration and pupil occasionally indistinct, in cell M3. Ventral hindwing: Ground colour similar to forewing; reddish-brown band near wing base, extending from costal margin to inner margin; discal band, equally wide as forewing discal band, extending from near costa to inner margin, passing just basal of origin of Rs, slighlty bent inwards below 2A; concolorous postdiscal band, parallel to discal band, similar in width, extending from near costa to inner margin, passing just basal of origin of Cu1, anterior end occasionally extends distally along Rs; broad, faint, indistinct dark shading present distal of postdiscal band (around submarginal ocelli); submarginal band extending from apex towards tornus, anterior end occasionally fused with postdiscal band in cell Rs, undulating in cells M2 and M3 as basal margin projecting inwards in each cell, distal margin slighltly concave in each cell, posterior end occasionally fused to postdiscal band in cell 2A; dark brown marginal line, slightly undulating, similar to forewing marginal band in width; fringe brownish; submarginal ocelli in cells Rs, M1 and Cu1, identical in appearance to forewing ocellus in cell M1, ocellus in cell Rs smaller compared to those in M1 and Cu1, ocellus in Cu1 appear larger than ocellus in M1, ocellus in cell M3 small, black spot and pupil occasionally indistinct. Genitalia (Fig 2A–F): Tegumen somewhat rectangular in lateral view, dorsal margin almost flattened but slightly sinuate, anterior margin almost straight, ventral margin elongated posteriorly forming somewhat finger-like projection, conspicuous posterior projection above uncus present, projecting from dorsal margin of tegumen and extending posteriorly; uncus narrow, curved, without setae, slightly hooked, tapering posteriorly, length similar to tegumen in lateral view; gnathos and brachium absent; combination of ventral arms from tegumen and dorsal arms from saccus

A new Euptychia from the Atlantic forest

straight; appendices angulares present; saccus length similar to uncus; juxta present; valva distally setose, dorsal margin basal to costa slightly concave, ventral margin convex, apical process appearing as narrrow projection with apex slightly angular, inner margin of apical process serrated (Fig 2D); costa projecting dorsally towards appendices angulares in lateral view; aedeagus roughly straight but posterior end slightly positioned higher, slightly longer than valva in length to valve, open anterodorsally, cornuti absent. Female. Forewing length 15.5–16.0 mm (n = 2), hindwing length 12.5–13.0 mm (n = 2). Similar to male except as follows: Foretarsus divided into five segments; forewing more rounded and broader; ground colour of dorsal wing surfaces whitish, brownish towards forewing apex, dark ventral bands appearing as darkly scaled rather than just visible through wing; ground colour of ventral surface paler, dorsal hindwing with dark marginal scaling stronger; ventral bands appearing more reddish, as in garnet, ocellus in ventral hindwing cell M3 fused with ocellus in cell Cu1, satellite ocellus (of ocellus in cell M1) present in one female (ZUEC LEP 9867). Female Genitalia (Fig 2G–I): Lamella antevaginalis sclerotized, ventral surface of ostium bursae extends posteriorly to posterior margin of lamella antevaginalis in ventral view, ventral margin of lamella antevaginalis curved and rounded; basal side of 8th abdominal segment forming sclerotized ring extending from lamella antevaginalis; ductus bursae membranous, origin of ductus seminalis close to ostium bursae; corpus bursae roughly oval in dorsal view, with two short signa. Type Material

21″S, 39°33′54″W], 750–800 m, Aug 2009, 1 female, F.L. Santos leg., 1 female, V. O Becker leg., Mar 2012, 1 male, V. O Becker leg., (VOB), 18–20 Jul 2014, 1 male (DNA voucher MGCL-LOAN 215), 1 female (DNA voucher MGCL-LOAN 216), A.V.L. Freitas & J. Y. O. Carreira, leg., ZUEC LEP 9866, ZUEC LEP 9867, 15 Mar 2016, 1 female, A.V.L. Freitas, leg., ZUEC LEP 9869 (ZUEC). Additional data. Espírito Santo: 3 Mar 1970, 1 male, Santa Teresa, Estação Biológica Santa Lucia, [19°58′19″S,40°31′47″ W] 700–800 m (from K. S. Brown Jr. censuses) (ZUEC); Rio de Janeiro: no specific locality, ex col. v[on] L[an]gsd[or]f[f], 1 female, 3402 (ZMHU); No data: 3 males, [no label attached] (ZMHU). Etymology. The specific epithet atlantica alludes to the Atlantic coastal region of Brazil, the area to which this species is restricted. The specific epithet is treated as a Latinised feminine adjective in accordance with the female generic name. Distribution. (Fig 3) Euptychia atlantica sp. nov. is known to date from south Bahia state to Rio de Janeiro state. The locality for the female previously in the collection of Georg Heinrich von Langsdorff (1774–1852) from “Rio [de Janeiro]” (no specific locality) cannot be precisely georeferenced, since Langsdorff and his collaborators collected in several different places in the state of Rio de Janeiro, including the montane forests of Nova Friburgo (Papavero 1971; da Silva 1997). Habitat and adult behaviour. (Fig 4) Euptychia atlantica sp. nov. occurs in montane and submontane ombrophilous

Holotype. Male from Reserva Particular do Patrimônio Natural Serra Bonita, 750–800 m, Camacan, Bahia, Brazil (15°23′31″S 39°33′54″W). Deposited in the Museu de Zoologia da Universidade Estadual de Campinas (ZUEC), Unicamp, Campinas, São Paulo, Brazil. Labels on the holotype (four labels separated by transverse bars): / HOLOTYPUS/ Res[erva] Part[icular do] Patr[imônio] Nat[ural] Serra Bonita, Camacan, Bahia: Brazil, 15°23′31″S 39°33′54″W, 750– 800 m, 15-III-2015, A.V.L. Freitas col. / Holotypus—Euptychia atlantica Nakahara & Freitas det. 2016/ZUEC LEP 9868 /. Paratypes. Brazil: Bahia: no specific locality, 1 male, 3101 (ZMHU); Santa Terezinha [sic], Serra da Jiboia, 600–700 m, [12°51′0.89″S, 39°28′49.47″W], 1 male, 16 Aug 2007, T. Zacca leg., MZUEFS #51687 (MZUEFS); Elisio Meldrado, Reserva Jequitibá, Serra da Jiboia, 600–700 m, [12°52′26.70″S, 39°28′26.54″W], 1 female, 17 Apr 2010, R.S. Oliveira & M. Paluch, leg. (ZUEC); Amargosa, Fazenda Timbó [13°6′S, 39°39′W], 700 m, 10–11 Dec 1997, 1 male, O.H.H. Mielke & M. M. Casagrande, leg., OM 48.007, (DNA voucher BC-DZ Willmott 72) (OM); Camacan, Reserva Serra Bonita, [15°23′

Fig 3 Map showing the six known localities for Euptychia atlantica sp. nov. based on all studied material. The dark grey area in coastal region corresponds to the domains of dense atlantic ombrophilic forest. 1. Elísio Meldrado, Bahia; 2. Santa Teresinha, Bahia; 3. Amargosa, Bahia; 4. Camacan, Bahia; 5. Santa Teresa, Espírito Santo; 6. Rio de Janeiro, Rio de Janeiro.

Nakahara et al

Fig 4 Habitat of Euptychia atlantica sp. nov. in the type locality at Serra Bonita, Camacan, Bahia, Brazil. A, B Two general views of the area; C a close view of the forest; D precise locality where the holotype was collected.

forests from 600 to 800 m, always in sites where the forest is well preserved. This species is apparently rare and very localised, based on the fact that usually no more than one or two individuals were encountered during a week of field work. In the region of Santa Teresa, Espírito Santo, only a single male was recorded in more than 50 censuses carried out by K. S. Brown Jr. (1965 to 1994) and AVLF (1992 to 1998). Males exhibited territorial perching behaviour, and were observed perching on leaves from 3 to 5 m above the ground at the edge of sunny patches in small clearings inside the forest from 10:00 to 12:00 h, disappearing during the afternoon. Females were observed flying in the understory (1 to 2 m above the ground) of the forest. Courtship and ovipositing behaviour have not been observed, and the host-plants and immature stages are also unknown. Systematic placement. This species is clearly a member of the Euptychia ‘audacia clade’ characterised by at least the following potential morphological synapomorphies: 1) ventral margin of tegumen elongated posteriorly forming somewhat finger-like projection, 2) apical process of valva subtriangular and tapered towards apex; 3) inner margin of apical process of valva serrated and bent inwards in right angle in dorsal/ventral view; 4) ventral surface of ostium bursae extends posteriorly to the posterior margin of lamella antevaginalis in ventral view. The ‘audacia clade’ also includes E. aquila Fratello,

Nakahara & Brévignon, 2015, E. roraima Nakahara, Fratello & Harvey, 2014, E. pillaca, E. audacia, E. truncata, and E. atlantica sp. nov., in addition to at least three undescribed species which will be described in the revision of the genus (Nakahara, in prep.). Barcoding data suggested that E. atlantica sp. nov. is sister to an undescribed species known from Rondonia (Brazil), with their COI sequences exhibiting 4.5% divergence. (Nakahara, unpub. data). Conservation status. Only 16 specimens from six localities, which are scattered across an area spanning 1100 km, were located in all examined collections. Despite the last 40 years of extensive field work in the region, no specimens were located at the DZUP, MZSP and MNRJ, even though these are among the largest repositories of Brazilian butterflies. This suggests low population densities and a restricted geographic distribution for this new taxon—two important criteria to categorise species as threatened according to the IUCN (2012). Based on the available information, we suggest E. atlantica sp. nov. should be regarded as “Vulnerable” (VU B1ab(iii)) (IUCN 2012). It is worth noting that this species was never recorded in the large and well-preserved lowland forests in the region of Linhares (north Espirito Santo) (Freitas et al 2016) and Una (South Bahia) (G. M. Accacio pers. comm.), supporting the hypothesis that this species is restricted to montane forest. Moreover, the forests from

A new Euptychia from the Atlantic forest

central Espírito Santo to south Bahia have been intensively deforested in the last decades, reducing opportunities for maintaining viable populations of E. atlantica sp. nov. This entire region, especially the northern sector from south Bahia to Espírito Santo, harbours also the last populations of several endangered butterfly species or subspecies, including Heliconius nattereri C. Felder & R. Felder, 1865, Melinaea mnasias thera C. Felder & R. Felder, 1865, Eresia erysice erysice (Geyer, 1832), Napeogenes rhezia rhezia (Geyer, 1834) (Nymphalidae) and Moschoneura methymna (Godart, 1819) (Pieridae) (Freitas & Marini-Filho 2011), as well as other endangered species of animals and plants (Machado et al 2008, Martinelli & Moraes 2013), and indeed is considered as an area of conservation priority in the Atlantic Forest (MMA 2000). Possible areas with extensive montane forests where this species could occur include the region of Jussari (RPPN Serra do Teimoso) and in the forested mountains between Una and Arataca (Serra das Lontras National Park), both in south Bahia. Also, confirming the presence of E. atlantica sp. nov. in the state of Rio de Janeiro is a priority, given that the record for this heavily sampled state is represented by a single female collected more than 150 years ago. Candidate areas to be searched include the large, wellpreserved montane forests in the region of the Serra dos Órgãos massif, in the region of Nova Friburgo and Petrópolis and in the large, isolated forests of Serra do Desengano State Park. Clearly, any additional locality records and information regarding the biology of this species would be extremely valuable towards assessing the conservation status of E. atlantica sp. nov. We hope this study will help continue to focus attention on the rich, distinctive, but fragile fauna of the Atlantic coastal forest of Brazil and remind us about the importance of preserving this unique biodiversity in perpetuity. Acknowledgements The authors are extremely grateful to Vitor O. Becker, Freddy Bravo, Wolfran Mey, Marcelo Duarte, Olaf Mielke, Andrew Neild, David Plotkin, Maryzender Rodríguez, Alexandre Soares, Keith Willmott and Thamara Zacca for their generous help in diverse phases during the course of preparing this manuscript. Vitor O. Becker helped during the field work in the RPPN Serra Bonita, in south Bahia. Gustavo M. Accacio shared information and specimens from Una reserve in South Bahia. Marlon Paluch kindly donated a female specimen from Elísio Meldrado, Bahia, to be a paratype at ZUEC. SN acknowledges the National Science Foundation (Grant No. DEB-1256742), in addition to the Florida Museum of Natural History and FLMNH Museum Associates. AVLF thanks the ICMBio for providing a research permit (SISBIO n° 10802-5), the Brazilian Research Council—CNPq (fellowships 302585/ 2011-7 and 303834/2015-3) and the NSF (DEB-1256742); EPB was supported by FAPESP (2012/03750-8). This publication is part of the RedeLep “Rede Nacional de Pesquisa e Conservação de Lepidópteros” SISBIOTA-Brasil/CNPq (563332/2010-7) and of the BIOTA-FAPESP Program (grants 2011/50225-3 and 2013/50297-0). Nomenclature ZooBank registration can be found at: http://zoobank. org/urn:lsid:zoobank.org:pub:45CD12D1-D984-43F9-ABDA-E6C5 BD08784D.

References Brown KS Jr (1991) Conservation of neotropical environments: insects as indicators. In: Collins, NM and Thomas JA (eds.) The conservation of insects and their habitats. Royal Entomological Society Symposium XV. Academic Press, London, pp 349–404 Brown KS Jr (1992) Borboletas da Serra do Japi: diversidade, habitats, recursos alimentares e variação temporal. In História Natural da Serra do Japi: ecologia e preservação de uma área florestal no Sudeste do Brasil (L.P.C. Morellato, org.). Editora Unicamp, Campinas, p 142–186 Brown KS Jr, Freitas AVL (2000a) Diversidade de Lepidoptera em Santa Teresa, Espírito Santo. Bol Mus Biol Mello Leitão (N Sér) 11/12:71–118 Brown KS Jr, Freitas AVL (2000b) Atlantic Forest butterflies: indicators for landscape conservation. Biotropica 32(4b):934–956 Cong Q, Grishin NV (2014) A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species—not hermes—inhabits South Texas and Northeast Mexico. ZooKeys 91:43–91. doi:10.3897/zookeys.379.6394 Costa M, Viloria AL, Attal S, Neild AFE, Fratello SA, Nakahara S (2016) Lepidoptera del Pantepui. Parte III. Nuevos Nymphalidae Cyrestinae y Satyrinae. Bull Soc Entomol Fr 121(2):179–206 da Silva, DGB (Org). (1997) Os Diários de Langsdorff. Volume I. Rio de Janeiro e Minas Gerais. 8 de maio de 1824 a 17 de fevereiro de 1825. Associação Internacional de Estudos Langsdorff; Rio de Janeiro: Fiocruz. lii + 400 pp Elias M, Hill R, Dasmahapatra K, Willmott KR, Brower A, Mallet J, Jiggins C (2007) Limited performance of DNA barcoding in a diverse community of tropical butterflies. Proc R Soc Lond B 274(1627):2881–2889 Freitas AVL F, Marini-Filho OJ (2011) Plano de Ação Nacional para a Conservação dos Lepidópteros Ameaçados de Extinção. Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio), Brasília 124 pp Freitas AVL, Kaminski LA, Iserhard CA, Barbosa EP, Marini Filho OJ (2011) The endangered butterfly Charonias theano (Boisduval) (Lepidoptera: Pieridae): current status, threats and its rediscovery in the state of São Paulo, southeastern Brazil. Neotrop Entomol 40(6):669–676 Freitas AVL, Wahlberg N, Matos-Maravi PF, Marín MA, Mielke OHH (2012) Euptychia boulleti (Le Cerf) new combination (Nymphalidae: Satyrinae), a rare and endangered butterfly from southeastern Brazil. Neotrop Entomol 41(6):461–467. doi:10.1590/S1519-566 X2011000600006 Freitas AVL, Barbosa EP, Santos JP, Mielke OHH (2013) A new genus, Atlanteuptychia gen. nov., for Euptychia ernestina (Lepidoptera: Nymphalidae: Satyrinae). Zoologia 30(6):661–668 Freitas AVL, Kaminski LA, Iserhard CA, Magaldi LM, Wahlberg N, SilvaBrandao KL, Marini-Filho OJ (2014) Paulogramma hydarnis (n. comb.) (Nymphalidae: Biblidinae): Distribution, systematic position, and conservation status of a rare and endangered butterfly. Neotrop Entomol, 43(3): 218–226 Freitas AVL, Brown KS, Mielke OHH, Santos JP, Vasconcellos-Neto J (2016) Borboletas da Reserva Natural Vale, Linhares/ES. Capítulo 19. In: Rolim SG, Menezes LFT, Srbek-Araujo AC (eds). Floresta Atlântica de Tabuleiro: Diversidade e Endemismos na Reserva Natural Vale. Editora Rupestre, pp 317–328 Huang CQ, Kim S, Song K, Townshend JRG, Davis P, Altstatt A, Rodas O, Yanosky A, Clay R, Tucker CJ, Musinsky J (2009) Assessment of Paraguay’s Forest cover change using landsat observations. Glob Planet Chang 67(1–2):1–12 IUCN (2012) IUCN red list categories and criteria: version 3.1, 2nd edn. IUCN, Gland, Switzerland Machado, ABM, Drummond GM, Paglia AP (2008) Livro vermelho da fauna brasileira ameaçada de extinção. MMA e Fundação Biodiversitas, Brasília e Belo Horizonte, Brasil, 2v, 1420 pp

Nakahara et al Martinelli G, Moraes MA (orgs.). (2013) Livro vermelho da flora do Brasil. 1ed. Rio de Janeiro: Andrea Jakobsson: Instituto de Pesquisas Jardim Botânico do Rio de Janeiro, 1100 pp Matos-Maraví PF, Peña C, Willmott KR, Freitas AVL, Wahlberg N (2013) Systematicsandevolutionary historyofbutterfliesin the“Taygetisclade” (Nymphalidae: Satyrinae: Euptychiina): towards a better understanding of neotropical biogeography. Mol Phylogenet Evol 66(1):54–68 Mittermeier RA, Gil PR, Hoffmann M, Pilgrim J, Brooks T, Mittermeier CG, Lamoreux J, GAB F (2005) Hotspots revisited: earth’s biologically richest and most endangered terrestrial ecoregions. CEMEX, Mexico MMA – Ministério do Meio Ambiente, dos Recursos Hídricos e da Amazônia Legal. 2000. Avaliação e ações prioritárias para a conservação da biodiversidade da Mata Atlântica e Campos Sulinos. Conservation International do Brasil, Fundação SOS Mata Atlântica e Fundação Biodiversitas, Brasília. iii + 41 pp Morellato LPC, Haddad CFB (2000) Introduvtion: the Brazilian Atlantic Forest. Biotropica 32(4b):786–792 Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J (2000) Biodiversity hotspots for conservation priorities. Nature 403: 853–858 Nakahara S, Hall JPW, Lamas G, Willmott KR (2015a) Seven new species and one new subspecies of Euptychia Hübner, 1818 (Lepidoptera: Nymphalidae: Satyrinae) from the tropical Andes. Trop Lepid Res 25(2):63–79

Nakahara S, Janzen DH, Hallwachs W, Espeland M (2015b) Description of a new genus for Euptychia hilara (C. Felder & R. Felder, 1867) (Lepidoptera: Nymphalidae: Satyrinae). Zootaxa 4012(3):525–541 Nakahara S, Llorente-Bousquets JE, Luis-Martínez A, Miller JY, Warren AD (2015c) Two new species of Euptychia Hübner, 1818 (Lepidoptera: Nymphalidae: Satyrinae) from Mexico and Guatemala. J Res Lepid 48: 51–57 Papavero N (1971) Essays on the history of neotropical dipterology, with special reference to collectors (1750–1905). Volume I. Museu de Zoologia, Universidade de São Paulo. Viii +216 pp Peña C, Nylin S, Freitas AVL, Wahlberg N (2010) Biogeographic history of the butterfly subtribe Euptychiina (Lepidoptera, Nymphalidae, Satyrinae). Zool Scr 39(3):243–258 Ribeiro MC, Metzger JP, Martensen AC, Ponzoni F, Hirota MM (2009) Brazilian Atlantic forest: how much is left and how is the remaining forest distributed? Implications for conservation. Biol Conserv 142(6): 1141–1153 Tabarelli M, Pinto LP, Silva JMC, Hirota M, Bede L (2005) Challenges and opportunities for biodiversity conservation in the Brazilian Atlantic Forest. Conserv Biol 19(3):695–700 Tabarelli M, Aguiar AV, Ribeiro MC, Metzger JP, Peres CP (2010) Prospects for biodiversity conservation in the Atlantic forest: lessons from aging human-modified landscapes. Biol Conserv 143(10):2328–2340 Tyler H, Brown KS Jr, Wilson K (1994) Swallowtail butterflies of the Americas. Study in biological dynamics, ecological diversity, biosystematics and conservation. Scientific Publishers, Gainesville, FL, USA