DEOXYCYTIDINE AND 2',3'-DIDEOXYCYTIDINE METABOLISM IN HUMAN MACROPHAGES Elias
Abstracts of Poster Presentations
S.I
Arn~r
Staffan
Eriksson
The metabolism of denxyribonucleosides and deoxyribonucleoside analogs in resting and terminally differentiated human macrophages carries many special characteristics, among them a lack of ribonuclcoude reductase, small deoxyribonucleotide pools and a high catabolism of natural nucleosides. Human immunode ficicncy virus (HIV) replicates in macrophages, and a thorough understanding of the macrophage-specific nucleoside metabolism is needed in order to unfold the mechanisms underlying anti-HIV effects of deoxyribonucleoside analogs in these cells. We have observed a pronounced catabolism of dCyd to dUrd, Ura and dihydrouracil (DHU) in cultured human monocyte-derived macrophages. This catabolism was very high in mature macrophages (>95 % of the added 0.5 I,tM, I nmole dCyd catabolized during 60 rain incubation with 2 million 3or 5-week old macropbages). To incubate cells with tritiated dCyd and thereupon meassure relase of tritiated water upon removal of nucleosides utilizing their binding to active charcoal is a traditional technique to determine in situ t h y m l d y l a t e synthase activity. We found that the high levels of tritiated DHU formed in macrophages during incubation with [5-3HI-labeled deoxycytldine interfered with this assay. Like water, DHU does not bind to active charcoal, and its presence in the cell medium can result in an over-estimation of the in situ thymidylate synthase activity. We detemined the in situ thymidylate synthase activity to be higbln stimulated lymphocytes, but the activity fiad falsely been determined to be even higher in macrophages, if the interference of dihydrouracil had not been considered. Concomitant with an increase of catabolism during macrophage maturation a pronounced increase of the macrophage cell volume was observed, resulting in higher intracellular nucleotide levels per cell despite the higher catabolism. This increase in intracelluIar nucleotides during M/M maturation was more pronounced for 2",3'-dideoxycytidine (ddC) metabolites than for those of dCyd. In in v i t r o assays, tetrahydrouridine completely inhibited the dCyd catabolism, utilizing macrophage extracts as protein source, but did only partially inhibit the dCyd catabolism in macrophage cultures. In contrast to that observed for dCyd, we found that ddC was resistant to catabolism. This implies that the anabolic phosphorylation of ddC by deoxycytidine kinase in macrophages is un-opposed by depletion of ddC due to nucleoside catabolism, and this may be one reason how ddC can display such potent anti-HIV activity in macrophages. Medical Nobel Institute, Department S-104 01 Stockholm, Sweden
5'-NUCLEOTIDASE ACTD/TI'Y IN PBL FROM NORMAL AND PATIENTS AFFECTED BY B-CLL
und
of Biochemistry
I, Karolinska
Iostitutet,
PURINE METABOLISM IN LACTOGENIC HORMONE ACTIVATED MAMMARY EPITHELIAL CELLS OF MICE.
A.B. Agostinho, F. Rosi, A. Tabocchi, F. Carlucci and M. Pizzichi~.
J. Barankiewicz', H. Trembacz, and L. Zwierzchowski 5'-nucleotidase catalyses tim depbospborylatinn of purine end pyrinnMine ribo- and deoxyribouneleoside monopbosphates to the corresponding riboand dsoxyribonucleosides. Dependino0, on the cellular location end molecular and kinetic properties, four enzymatic forms have been identified: the first one is membrane-bound (ecto-5'nuelsoticla~, e-N) end tbe other three are soluble. One of the soluble forms (soluble ecto-5'-nueleotidase, e-Ns) appes~ to be derived from the GPI-enehored ecto-5'uncleotidam end has presumably an extracallular location. The two cytosolic forms ha,0e similar characteristics, but can be differentiated on the basis of their preferential affinities for AMP (cytoplasmie-5'-uucleotidase I, c-N-I) and IMP (cytoplasmie-5'-uucteotidase II, c-N-I0 t~spactively (1-2). W e studied the activity of three isoenzymes: the membrane-bound and two
cytoph~mie
foams from normal donors and patients affected by B-Cell Chronic
Lymphocyte Lauk~aia (S-CL~). Peripheral blood mononuclear cells were isolated from hepariaized blood by Ficoll-Hypaque densitygradientcenla'ifugation(3).For the determinationof the activities we used a radiochemical method associated with High-Performance Liquid Cromatography. In our study we determined the increase of adenosine, inosine and hypoxenthine at differenttimes of incubation. Patients affectedby B-CLL showed a significantdecrease of ecto-5Unuclsotidase activitywith respectto normal subjects,The specificactivitiesof two cytoplasmic forms did not showed significantvariationsbetween normal subjectsand B-CLL patients.
1. H. Zizm~m'mennBiochem. J., 285 (1992) 345. 2. L.F. Thompson J. Imrmmol., 134 (1985) 3794. 3. A. Boyum Seend. J. Clin. Lab. Invest. Suppl. 97 (1968) 31.
Istituto di Biochimica e di Enza~ologia, UniversiUlDe81i Studi di Siena, Pien dei Mantellini,44,53100 Siena, Italia.
Purine metabolism was compared in epithelial mammary gland cells isolated from virgin, pregnant and lactating mice. Also the effect of lactogenic hormones: insulin, protactin and hydrocortisone on adenine and adenosine metabolism were studied in mammary gland explants from pregnant mice. It was found that purine nucleotides can be synthesized by both purine biosynthesis de novo pathway and by purine salvage pathway in isolated mammary gland cells from virgin, pregnant and lactating mice. The capacity of purine nucleotide synthesis by the salvage pathway was about 10 times higher than the rate of de novo biosynthesis in all three physiological stages of mammary gland. Adenine (0.1 mM) was salvaged mainly to AMP and subsequently phosphorylated to ATP (59%), although deamination of AMP was also significant (26%). Adenosine (1.5 mM) was more efficiently deaminated (93%) than phosphorylated (7%) and large accumulation of hypexanthine outside cells was observed. Inosine (70%) was the major conversion of metabolized hypoxanthine (0.1 mM) though significant amount of hypoxanthine was also incorporated into adenine (10%) and guanine (9%) nucleotides. Guanine (0.1 mM) was mainly deaminated to xanthine (77%), but a significant amount of GMP was also phospho~jlated via GDP (16%) to GTP (14%) as well interconverted to IMP (6%). During physiological activation of the mammary cells, which occur during pregnancy and lactation, the rate of adenine, hypoxanthine and guanine salvage, AMP, ADP, GMP, GDP phosphorylations, interconversion of IMP to AMP and to GMP and IMP dephosphorylation increased considerably in comparison with that in cells from virgin mice. Insulin, prolactin, hydrocortisone (1 p.g/ml) enhanced (127, 62, 25% respectively) adenine and adenosine salvage. The highest rate of enhancement of adenine and adenosine salvage was observed when insulin was used in combination with prolactin and hydrocortisone. Institute of Biochemistry and Biophysics, and Institute of Genetic and Animal Breeding, Polish Academy of Sciences, 02-532 Warsaw, Rakowiecka 36, Poland. *Current address Gensia Pharmaceuticals, Inc. San Diego, CA 92121, USA.
I~/,,rm,~,I' 11"~,rhl L* S,'w,t,, ~,. . . . . . . s . . . . .
,,3
F15
PURINE NUCLEOSIDE PHOSPHORYLASE: INHIBITION BY PUR.INE N(7)- AND N(9)-ACYCLONUCLEOSIDES, AND SUBS'IRATE PROPERTIES OF 7q3-DRIBOFURANOSYL GUANINE AND HYPOXANTHINE.
CROSS RESISTANCE TO 2',2'-DIFLUORO-DEOXYCY'I'IDINE (DFDC) AND CIS-DIAMINEDICHLOROPLATINUM (CDDP) IN OVARIAN CANCER CELL LINES
A. Bzowska a. A.V. Ananievh. N. Ramzaeva-q-. E. Alksinsg-L)'.A. Maurlnsf-, 1~ Kulikowska a and D. Shunar~
A.M. Bergman, V.W.T. Ruiz van Haperen, G. Veerman, J.B. Vermorken, G.J. Peters dFdC (Gemcitabine) is a new antimetabolite with an established anti tumour effect against ovarian cancer. CDDP (Cisplatin) is one of the most effective agents against ovarian cancer and acts on the cells by forming DNA adducts. Both agents were tested saperately on A2780 a human ovarian cell line, and on a dFdC resistant (AG6000, 150,000 fold resistant), and a CDDP resistant (ADIgP, 20 fold resistant) variant of A2780. A2780 was the most sensitive cell line for both cytostatics, with IC50s for dFdC varying from 31 nM at lh exposure to 0.6 nM at 72h exposure. For CDDP the IC50s of ,%2780 varied from 8 I~M at l h exposure to 2.3 I~M at 72h exposure. The dFdC resistant cell line AG6000, was 4 fold less sensitive to CDDP than the wild type (A2780) The CDDP resistant cell line ADDP, appeared to be 1,600 fold less sensitive to dFdC, than A2780, The activity of the deoxycytidine kinase (dCK), which catalyses the initial phosphorylation of dFdC to the monophosphate dFdCMP, was measured in the three cell lines, using deoxycytidine (CdR) as a substrate. The phosphorylation of CdR by thymidine kinase (FK) was blocked by adding an excess of thymidine. The total phosphorylating activity in A2780 was 1.9 and 1.4 nrnol/hr/10 s in the absence and presence of thymidine, respectively. The phosphorylating activity in AG6000 is approximately 5 times lower, both with and without thymidine than in A2780. The phosphorylating activity in ADDP cells in the presence of thymidine is 2 times lower than in A2780. In conclusion: both AG6000 and ADDP seem to be cross resistant to both dFdC and CDDP. The resistance of AG6000 for dFdC is probably related to the lower dCK activity. The cross resistance to CDDP and dFdC in ADDP cells has not yet been elucidated. Department of Oncology, Free University Hospital, PO Box 7057, 1007 MB, Amsterdam, The Netherlands.
Purine nueleoside phosphorylase (PNP) is of interest as a drug target because of its role in some immunological diseases I . lnhihitors of this enzyme may also be useful to limit the intracellular degradation of nucleosidr analogues with antitumor and antiviral activities 2. A series of ten N(7)- and N(9)-anycloaneleosides of guanine and 8-substituted guaninas was tested for ability to inhibit PNP from haman erythrocyres and rabbit kidney. The acyclic chains contained a nitrogen atom in place of a carbon at the 3', 4' or 5' position; and, in one ease. an ether oxygen at the 2' position. 7-[(l,3-Dihydroxypropyl-2)amino]ethylguanine was a 2-fold more effective inhibitor of the human enzyme than its N(9) counterpart. K i = 5 gtM vs 11 ttM. This difference was further accentuated witl* the rabbit enzyme, Ki = 0.7 stM vx 2.3 KM. The foregoing led to the finding that the 7-1~-D-ribosldes of guanine and hypoxanthine (N7Guo and NTIno) are substrates of PNP from human erythrucytes, calf spleen and E. coll. With the human enzyme, the pseudo firat-order rate constants (Vmax/Km) for phasphorolyals of N7Guo and N71no are 0.08% and 0.02% that for Inn. The Michaelis constants (K m) for N 7 G u o were 27 ttM (calf PNP), 108 IxM (human PNP) and 450 IxM (E. coli PNP). For N7Ino, K m was 1.52 mM for the calf. 1.26 rnM for the human and 0.64 mM for the E. coli, enzyme. Several aeyclonucleosidr PNP inhlbitors were found to more effectively inhibit phosphornlysis of N71no than the parent Inn. The overall results, together with those previously reported for the excellent substrate properties of 7-alkyl- Gun and Inn 3, point to the need for modification of present concepts regarding the active site(s) of these enzymes. (Supported 1. 2. 3.
by Ministry of National Education. BST-411).
E.R. Gibleu et al. Lancet, 1 (1975) 1010. J.D. Stoeckler et al. Fed. Proc., 45 (1986) 2773. A. Bzowska at al. J. Biol. Chem.. 263 (1988) 9212.
aDepartment of Biophysics. Institute of Experimental Physics. University of Warsaw, 93 Zwirki i Wigury, 02-089 Warsaw. Poland blnatitute of Experimental Biology, Armenian Academy of Sciences, Erevan, 375044, Armenia Clnstltum of Organic Synthesis. Latvian Academy of Sciences, Riga, 226006, Latvia
CAPILLARY ELECTROPHORESIS FOR DIAGNOSIS AND STUDIES OF PURINE METABOLIC DISORDERS C.Berv.
C.Chantln.
J.L.Rocea
Capillary electrophoresis (CE) is a new potentiel analytical tool in clinical laboratories that we have evaluated for the separation and quantitation of all purine ribonucleotides and deoxyrihenucleotides. Based on erythrocyte sample analysis we have developed a method for the diagnosis and monitoring of purine metabolic disorders. The method was applied to A D A deficiency. Until now the approach of monitoring nucleotidas was carried out by high performance liquid chromatography but the procedures are time consuming and lacke the ability to separate simultaneously all purine ribo and deoxyribonucleotides. T h e capillary electrophoretic method described here permits the rapid and selective analysis of all the compounds in a single run. C E was performed on a PACE (Beckman InstrumentS). A fused silica capillary (40 cm to detector, 50/~m i.d.) and a 40 m M phosphate/2 m M borate buffer pH I0 were used.The conditions were the following: pression injection for 3s, capillary temperature 25 *C, detector set at 254 nm, applied voltage 22 KV.The current obtained was approximately of 85/~A. For the sample preparation 500/zl o f erythrocytes were deproteinised with 60 .ul 35% PCA, and the acid supernatantS were diluted 4 times to avoid tailing peak. Using this method 19 nucleotides and deoxyribonucleotides cfm be separated with high resolution in 24 rain.The calibration curve is linear up to 500 ,umol/I .The reproducibility studies were performed at concentrations ranging from 9.25/~mol/I to 250 ~mol/l ; the coefficientS of variation were less than 5% for the concentrations and less than 2 % for the migration times.The minimum detectable concentration based on a 3:1 signal to noise ratio was about 10/~mol/l. This CE method was applied to the analysis of nucleotides in A D A deficiency but represents also an accurate analytical tool for the determination o f purine nucleotides in other purine metabolic abnormalities. Laboratoire de biochimie, Hopital Debrousse 29 rue soeur Bouvier 69322 Lyon Codex 05, France and Laboratoire des sciences analytiques, C N R S , 43 Boulevard du 11 novembre 1918, 69100, Villeurbanne, France.
ARE URINARY URACIL LEVELS A RELIABLE INDICATOR OF ORNITHINE CARBAMOYLTRANSFERASE (OCT) CARRIER STATUS? r'~- Davies, L.D. Fairbanks, H.A. Simmonds. OCT deficiency is a potentially lethal X-linked disorder of urea synthesis. The increased flux through the pyrimidine pathway consequent upon the defect results in oroticaciduria which has been used to detect affected hemizygotes. The increment in erotic acid excretion following a protein-loading test, used previously to detect carriers, sometimes failed to detect obligate heterozygotes. An improved carrier-detection method involving the increment in orotidine over 24h following a single 300 mg allopurinol dose was recently proposed. We evaluated this test in a healthy UK population compared with women at risk for c a r r i e r status and found the increment in erotic acid to be the more reliable indicator. Recent reports ~'2 have noted that asymptomatic hemizygotes and OCT carriers normally excrete increased levels of uracil, whilst erotic acid excretion is not elevated. We thus investigated the baseline urine samples obtained prior to allopurinol in our UK series, using a specially adapted chromatographic method with in-line diode-array detection. Significantly increased levels of uracil were found in the carriers for OCT deficiency (2-3 x normal range; 19-40 ~mol/mmol creatinine) with positive allopurinol load tests, compared with controls (3-12 ~mol uracil /mmol creatinine). However, the similar retention time of methylayted uracil in normal subjects not on a caffeine-free diet made the use of a method capable of separating pseudouridine, uracil and the methylated uracils obligatory. Measurement of uracil levels in random urines in subjects at risk for OCT deficiency on a caffeine-free diet thus requires further evaluation. I Ohba S, Kidouchi K, Nakamura C,Katoh T, Kobayashi M, Wada Y.Reference values of erotic acid, uracil and pseudouridine in urine. Adv Exp Med Biol. 1991;309b:27-29. 2 Rabier D,Guillois B, Bardet J, Deprun C, Parvy P, Kamoun P. Ornithine carbomyltransferase deficiency with subnormal enzyme activity. J Inher Metab Dis. 1991;14:842-843. Purine Research Laboratories, UMDS, Guy's Hospital, London Bridge SEI 9RT, UK.
F] 6
P/mrm,i,y II',./d ~. St)*'.,c
EFFECTS OF ANT[METABOLITES ON THE MALIGNANT POTENTIAL OF MURINE LEUKAEMIA L1210 CELLS.
LOW ERYTHROCYTE PHOSPHORIBOSYLPYROPHOSPHATE SYNTHETASE (PRPS) ACTIVITY IN CHILDREN WITH SEVERE NEUROLOGICAL DEFICITS
T.W. De Graaf, G.J. Peters, and W. Van Dijk. In previous studies we have observed changes in cell surface glycosylation of the murine leukaemia cells which induced non-lethal concentrations of arabinofuranosylcytosine (Ara-C), methotrexate (M'D0, 5-fluorouracil, 6thioguanine, and 6-mercaptopurine. Cell surface glycosylation is of crucial importance for processes such as ceil-cell, ceil-matrix interactions and metastasis formation. Pretreatment of L1210 cells with these antimetabolites increased the in vitro invasive capacity into monoiayers of rat embryo fibroblasts. The effect was most pronounced for Ara-C at 0.1 ~M (2.4-fold). The increase in invasiveness was partly correlated with the induced cell-cycle arrest. Generally S-phase cells had a stronger invasive capacity than Gl-phase cells, but GJMphase cells had the strongest invasive capacity. Concomitant increase in cell surface fucosylation 1 and inhibition of invasion with sulphate suggest an important role for glycoproteins in this process. Ara-C and MTX pretreated L1210 cells were found to be equally tumorigenic in vivo as untreated (control) cells, but Ara-C pretreatment appeared to increase the metastatic capacity of the L1210 cells. All 6 mice from the Ara-C group developed macroscopically visible metastases, whereas only 1 mouse from the control group and 2 from the MFX group did. Our results suggest that treatment with antimetabolites may contribute to metastasus formation by altering cell surface properties. De Graaf TW, Slot SS, Peters GJ, Van Dijk W: Changes in glycosylation of L1210 cells after exposure to various antimetabo[ites. Eur J Cancer 1993, in press. Dept. of Medical Chemistry, Dept. of Oncology. Vrije Universiteit, Van der Boechorststraat 7, 1081 BT Amsterdam, the Netherlands.
J. A. Duley*, H. A. Simmonds* and F Hanefeldw The product of the PRPS reaction, PP-ribose-P, ts essentlal for de novo purine synthesis and for the conversion of purines, pyrimidmes and pyridines to their active nucleotide forms. PRPS is highly regulated by ADP, GDP and other nuc[eotides. Inherited PRPS superactivity is an X-linked disorder associated with gross uric acid overproduction in adults. Children also present with severe neurological deficits, including inherited nerve deafness. A variety of mutants have been found in over 25 kindreds world-wide with altered kinetic, regulatory, or other properties resulting in superactivity m nucleated cells. Low activity has been noted in pyrimidine 5'-nucleotidase deficiency. This study reports on a combination of tests to identify the spectrum of PRPS mutants: (a) erythrocyte nucleotide analysis; (b) intact erythrocyte incubations with radlolabelled adenine or hypoxanthine using varying levels of Pi and substrate; (c) direct assay of erythrocyte lysate PRPS activity by a novel rapid one-step assay employing HPLC; (d) confirmation of uric acid and hypoxanthine overproduction by analysis of 24-hour urinary excretion, this being an additional hallmark of PRPS deregulation. Affected male children with neurological deficits have exhibited gross purine overexcretion, characteristically low erythrocyte NAD and GTP levels, as well as abnormal patterns of purine base incorporation using intact erythrocytes. Curiously, 3 young severely affected cases showed no detectable PRPS activity in erythrocyte lysates, indicating lability of the mutant enzyme in erythrocytes. Carrier females showed intermediate symptoms and parameters. Although PRPS mutants are rare there is reason to believe that the defect is underdiagnosed, and should be suspected in retarded children with the appropriate combination Of symptoms. Correct diagnosis will require the spectrum of tests above. *Purine Research Laboratory, UMDS Guy's Hospital, London SE1 9RT, UK and w of Paediatrics, University Hospital, D-3400 GSttingen, Germany.
COMPLETE ADENINE PHOSPHORIBOSYLTRANSFERASE ( APRT ) DEFICIENCY AND 2,8-DIHYDROXYADENINE ( 2,8-DHA ) STONE FORMATION AFTER RENAL TRANSPLANTATION.
T H E E F F E C T OF 2'3'-DLDEOXYADENOSENE AND RIBAVIRIN ON HUMAN LIVER S-ADENOSYLHOMOCYSTEINE H Y D R O L A S E
K. Fablanowska- Maj ewska*,H .A.Slmmonds ~A.J.Duley.J .Greger". T.Waslak~
Jonq D. de, Huysmans F., De Abreu R., Monnens L. Diikman H.. I ieberqen F. van, Assmann K.
S-adenosylhomocysteine (SAH} hydrolase, as a frequent target for chemotherapeutic agents, is an enzyme which also plays an important role for novel antivlral and
A 56 year old man with urolithiasis of unknown origin was treated with allopurinol sincer 1977 and after t h a t treatment stone formation stopped. He underwent a renal transplantation in November 1991 and all previous medication, including allopudnol, was discontinued. Due to episodes of histologically proven acute interstitial rejections, haemodialysis had to be started from day 80 after transplantation. Renal biopsies were taken on day 10, 31 and 51 after transplantation. The transplant kidney had to be removed nine months later due to severe chronic vascular rejection. In all biopsies including the renal graft brownish crystals were present in the tubuli and in the interstitium. The urinary sediments obtained before and after removal of the graft also contained similar crystals. Biopsies of the contralateral kidney of the same donor did not contain these crystals. X-ray diffraction microanalysis of the crystals showed that the crystals were composed of 2,8-DHA. The APRT activity measured in the patients lymphocytas was very low ( 0.65 + 0.58 nmol/10 s calls/hr, compared to 13.6 _+ 4.2 in healthy controls ), suggesting a homozygosity for APRT deficiency in this patient. His siblings were studied for the APRT activity in lymfocytes. One brother had a normal APRT level ( 11.90 _+ 0.93 ). Two sisters and his two children showed intermediate values for APRT activity suggesting heterozygosity. This is accordant with the autosomal recessive heredity of APRT deficiency. In conclusion, 2,8DHA urolithiasis due to APRT deficiency should also be considered in cases of crystal formation after renal transplantation. It is important to recognize this diagnosis, since 2,8-DHA crystal formation can be inhibited wIth aUopurinol.
antltumor drugs, analogues of adenosine. Biological mechanism of molecular toxicity of 2'3' - dideoxyadenoslne (ddAdo} and rlbavirin is multifunctJonal and is related to metabolism v/a their nucleotides derivatives [1,2]. Our studies suggest that toxicity mechanisms of these drugs involve also SAH-hydrolase [3). This presumption is confirmed by our results, which demonstrate that ddAdo and ribavirin inactivate isolated human liver SAH-hydrolase to 18% and 33% of control activity, respectively. Inhibitory ability of these agents compared with other adenosine analogues is following
(percentage of inhibition is given in bra(:kets): neplanocin A (100%),
2'-deoxyadenoslne
(96%), Ara A (95%), 2'3'-dldeoxyadenoslne (82%), 5'-deox'y,
5'-methylthloadenoslne (80%), 3'-deoxyadenoslne (700/0}. ribavlrln (67%), slnefungln (66%), S-adenosylmethionine (58%), tubercldln (56%). 5'-Iodo,5'-deoxyadenoslne (43%), AICA riboside (40%), 5'-deoxyadenosine (20%). These results indicate that the toxic effect of these drugs causing/n vitro inactivation of SAH-hydrolase, will probably inhibit it also /n vivo, with consequent perturbation of S-adenosylmethionine dependent transmethylation reactions and it would be significant for the antlviral action of these drugs,
l.T.Page et al. I n t . J . B l o c h e m . , 2 2 11990) 379. 2.N.R.Hartman et al. Molec,Pharmacol., 40 (1991) 118. 3.R.T,Smoleflskl etl.Blochem.Pharmacol., 43 (1992) 2053.
Purine Res.Lab.of UMDS, Guy's Hospital, London SE I 9RT, UK Dept,General Chemistry, Medical Untv.of L6d2:, Poland Dept.Blochcmistry, Medlcal Univ.of L6d~:, Poland
Dpts. of Nephrology, Pediatrics and Pathology, University Hospital Nijmegen and Bosch Medicentrum, the Netherlands. Ph,m,,z,y Ill,d,l L, ";,~',,c Volume 15 N r 4 ]Qg]
F17
TWO NEW MUTATIONS AT THE APRT GENE B.S. Gathof. T. Ried, K, Zwieauer*. U. Gresser
In patients and heterozygotes at least 18 different mutations of the adenine phosphoribosyltransferase(APRT) gene have been reported so far (Sahota et at. 1993). We examined the molecular nature of the APRT deficiency in a healthy heterozygote (J.M.F., APRT activity 25% of the normal value), his family and an unrelated male patient (J.Sch., APRT activity 2%, Chiba et al. 1988). Genomic DNA was purified from peripheral blood lymphocytes. Fragments containing every individual exon of the APRT gene were amplified by a symmetric and a subsequently asymmetric PCR. PCR conditions were 1.5 mM MgCI2,, 10 mM Tris-HCL, 0.2 mM dNTP, 2.5 U Taq, 100 ng each primer (in asymmetric PCR one only 50 rig). Primer sequences were 5 "CTG I-rI-ICTGCGGGAGGCTG3" and 5"TGGGGATGGGAGGGTGAGGT3" (exon 4) and 5"GCCTrCCCCTCCCCA ACCCA3" and 5"GCCTTCCCCTCCCCAACCCA3" (exon 5). PCR products were purified (Geneclean, BIO 101, La Jolla) and sequenced (USB, Bad Homburg) using one of the primer. We detected an A to T substitution in exon 5 in the heterozygote (J.M.F.), which leads to exchange of valt3 t for glu. This mutation destroys the recognition site GTAC of the restriction enzyme Rsa I, so that we could confirm the heterozygosity of the propositus, his mother and aunt using this PCR-RFLP. In the other patient (J.Sch.) we found a C to A substitution in exon 4, which exchanges alal71 for asp. This mutation alters the recognition site GGCC of the restriction enzyme Nae 111, which facilitates the future family study. To our knowledge these mutations have not been described before. The effect of these mutations on the function of the APRT protein remains subject of future research.
FREQUENCY OF THE C34-T MUTATION IN THE AMPD1 GENE (MYOADENYLATE DEAMINASE) IN ASYMPTOMATIC SUBJECTS. M. Gross. W. Emol. U. Gresser
1. A. Sahota et at. In: Gresser U. (ed) Molecular genetics, biochemisty and clinical aspects of inherited disorders of purine and pyrimidine metabolism. Springer Verlag, Heidelberg, 1993, in press 2. P. Chiba, K. Zwieauer, M.M. M/iller. Clin. Chim. Act. 172: 141-148, 1988
Recently, the nonsense mutation C34--T in the AMPD1 gene was revealed as cause of inherited myoadenylate deaminase deficiency in all patients studied so far (I). This mutation destroys a Mae II restriction site in genomic DNA and therefore can be diagnosed by digestion of DNA with this restriction endonuclease. We screened 256 outpatients of our hospital in Munich, Germany. Only patients were included that were considered to be free of any muscular disorder by a physician after taking history and physical examination. Genomic DNA prepared from a blood sample was analyzed for the C34T mutation by Mae II restriction analysis. 46 subjects were heterozygous and 3 subjects were homozygous for the mutation C34-T. The allele frequency was 0.102. Homozygous subject 1 was a 83 years old former miner with arthritis urica, subject 2 a 82 years old housewife living by herself, and subject 3 a 36 years old farmer suffering from a chorioretinitis. All subjects denied any muscular complaints. An ischemic forearm test was performed with subjects 2 and 3 showing a normal increase in serum lactate but lacking ammonia and hypoxanthine production confirming lack of MAD activity in working muscle. Obviously, even in high age, MAD deficiency may be asymptomatic. Either MAD is not important for normal functioning of skeletal muscle which is not likely, or there are factors that can save MAD deficient subjects from developing symptoms. Alternativ splicing of exon 2 harboring the mutation might be such a protective mechanism.
Medizinische Poliklinik der Universit~t M~nchen, Pettcnkoferstr. 8a, 80336 M~inchen, Germany. *Allgem. Offentl. Krankenhaus St. Prlten, Austria.
1 T. Morisaki, M. Gross, H. Morisaki et al. Proc Natl Acad Sci USA 89 (1992) 6457. Medizinische Polildinik, University of Munich, Pettenkoferstr. 8a, 8000 M~nchen 2, Germany
H202 MODULATES THE PURtNE METABOLISM IN HUVECs A. Griesmacher, G. Wei,qel, M. M. Metier Reactive oxygen species (ROS), generated during reperfusion following oxygen deficiency and inflammatory situations, damage the vascular endothelium. Up to millimolar concentrations of hydrogen peroxide (H202) can be found in the immediate vicinity of stimulated leukocytes. It is suggested, that ROS, such as H202, alter the cellutar purine metabolism. For this reason, the effects of H202, as model substance, on purine metabolism of human endothelial cells (HUVECs) were investigated. Incubating confluent HUVECs for 60 min, 10 i.r H202 increased the intracellular ATP and CP levels by 51,3% and 18,2%, whereas 100 p.mol/I HzO2 had no effects. Since elevated ATP levels indicate a metabolic disturbance by the contact with 10 i~mol/I H202. the uptake and salvage of purines and some key enzymes of purine metabolism were investioated. CONTROL 10 p.molll H202 100 }amol/l:t202 14C-AD 1.70 __0.27 2.06 • 0.9* 1.57 + 0,20 14C_HX 1.78 • 0.25 2.43 + 0.49 1.96 • 0.28 14C-AI30 6.80_+0.42 7.68 • 0.55" - 8.40_+061" PRPP-S 20 • 8 12• 4" 8 • 4* ADA 177 • 22 159 • 24 155 • 22 PNP (Ino -> Hx) 228 4- 29 283 • 44" 231 • 30 PNP (Hx -> Ino) 1861 • 2043 4- 326 1930 + 258 AK 23• 13• 10• APRT 31 • 42 • 8" 40+9* HGPRT 16+4 14• 13+6 pmolltO 6 Cells/h: 1, ~,-AD = 14C-ad nine, 14C-HX = 14C-hypoxanthine, 14C-ADO = 14C-adenosine; nmolll06 Cells/h: PRPP-S = 5-phosphorbosyl-1pyrophosphate synthetase, AD = adenosine deaminase, PNP = purine nucleoside phosphorylase, AK = adenosine kinase, APRT = adenine phosphoribosyltransferase, HGPRT = hypoxanthine guanine phosphodbosyltransferase *=Significant (p<0.005) compared to controls; mean values • S.D. (n=9) Vanous enzymes are reported to be modulated by oxidative processe,' Therefore the higher salvage could be the result of partial changes in enzyme actwities. The enhanced incorporation of 14C-AD and 14C-ADO can explained-by the AK inhibition and by the increased activity of APRT concomitant with the nearly unchanged activity of ADA. In conclusion, ~L might be postulated, that the observed increase in cellular ATP and CP levels ts partially caused by an increase ~n purine salvage as a resu!t of changes in punne enzyme activities.
URATE-KETONE BODIES EXCHANGE IN BRUSH-BORDER MEMBRANES OF HUMAN KIDNEY. B. Guisan, F. Roch-Ramel.
Renal human brush border membranes (BBM) possess a urate/anion e x c h a n g e r which is involved in urate reabsorption I. In the present study we investigated if ~hydroxybutyrate and acetoacetate were substrates for this anion exchanger. Plasma concentrations of these ketone bodies are increased in diabetic patients, in which they induce urate retention. In laboratory animals made diabetic, ketone bodies were shown to be increased in renal proximal cells 2. A stimulation of the exchange of itmdnaluratewithcellular~hydroxybutyrate or acetoacetate might be the first step involved in urate retention. 14C-urate uptake by human BBM vesicles was measured in pH and voltage clamp conditions, vesicles being preloaded with either 10 mM ~-hydroxybutyrate, 10 mM acetoacetate or, in control conditions, i0 mM gluconate, a non transported anion. 15 sec 14C-urate uptake was 119• 125• and 52• % of equilibrium uptake, in vesicles loaded with ~-hydroxybutyrate, acetoacetate, or gluconate, respectively. These data demonstrate that ~hydroxybutyrate and acetoacetate can stimulate urate uptake, as substrates for the urate/anion exchanger. The physiological relevance of these data is that in diabetic patients, ~-hydroxybutyrate and acetoacetate, might s t i m u l a t e urate reabsorption, by increasing luminal urate uptake in proximal cells, t i D.Werner, et al. In Ellen et al.(eds), Purine and Pyrimidine Metabolism in Man VII, Part A, Plenum Press, NY, 1991, 177. 2 G.Lemieux, et al. In Dzurik et al.(eds), Kidney Metabolism and Function, M a r t i n u s Nijhoff Publ., Dordrecht, 1985, 118. Institut de Pharmacologie et Toxicologie, Universit4 de Lausanne, Bugnon 27, CH 1005 Lausanne, Switzerland.
I1. Dept. of Surgery, Clin. Biochemistry., 9, Spitalg. 23, Vienna, Austna
F] ~
I'h,m.,J,y l | b , h l
~.- S , . ' . . '
CONDITIONS
AFFECTING PUBZNE UPTAKE AND iNCORPORATYON IN MAMMALIAN FIBROBLAST CULTURES B.H.Harley,
SEQUENCING AND EXPRESSION OF MOUSE AND MONKEY DEOXYCYTIDINE KINASE
I.Baumgarten
Incorporation of labelled purine substrates into acid precipitabie material in cultured cells has long been a usefull means of measuring metabolic flux, and is freqently used as a diagnostic prooeedure i. Analysis o~ variance was used to define the amount of variation between replicates, between experiments, between individuals, and, using cell lines prepared from humans, buffalos and black rhinoceroses, between species, in uptake of labelled hypoxanthine and adenine. Despite strict criteria to keep experimental conditions constant, res in small replicate errors, the major component of the variation was between experiments, with no significant between individual variation. The degree of between experiment variation was such as to compromise the effectiveness of such proceedures in diagnosis of purine enzyme defects. Between species differences were significant unless cell lines were transformed. Variation between experiments, the cause of which is not known, became significant over time-spans of a few hours to a few days. 1 R.Rozen et al. Clinica Chimica Acta 77 (1977) Dept. of Chemical Pathology, University Observatory 7925, Cape, South Africa.
379-386.
of Cape Town,
A n n a Karlsson a n d Staffan El-iksson Partially purified deoxycytidine kinase (dCK) f r o m m o u s e s h o w d i f f e r e n c e s in s u b s t r a t e specificity c o m p a r e d with the h u m a n a n d m o n k e y e n z y m e . We are interested in d e t e r m i n i n g these d i f f e r e n c e s in s u b s t r a t e specificity between t h e species at t h e m o l e c u l a r level as well as cloning t h e s e p r o t e i n s for f u r t h e r characterization. We h a v e cloned the m o u s e dCK cDNA from a m o u s e T-cell cDNA l i b r a r y using a S00 bp p r o b e derived f r o m PCR amplification of m o u s e spleen eDNA using p r i m e r s f r o m the h u m a n riCK sequence. The m o n k e y dCK h a s b e e n cloned by PCR amplification of the m o n k e y dCK eDNA using p r i m e r s of the 3" a n d S "- e n d s of the h u m a n sequence. From t h e s e q u e n c e s o b t a i n e d so far we h a v e f o u n d 6 a m i n o a c i d s to be different in t h e m o n k e y dCK c o m p a r e d with the h u m a n e n z y m e . Of these 6, o n l y l a m i n o a c i d is u n i q u e for the m o n k e y dCK, t h e o t h e r S differences a r e s h a r e d with the m o u s e dCK. W h e n 80% of the m o u s e dCK eDNA is s e q u e n c e d the e n z y m e h a s 13 a m i n o a c i d differences c o m p a r e d with the h u m a n e n z y m e a n d 7 c o m p a r e d with t h e m o n k e y e n z y m e . D e p a r t m e n t of Biochemistry 1, Medical Nobel Institute, Karolinska Institute, Box 60 400, S-I04 01 Stockholm, Sweden
A M P - D E A M I N A S E FROM HUMAN UTERINE SMOOTH MUSCLE - THE EFFECT OF D T N B T R E A T M E N T ON KINETIC AND REGULATORY PROPERTIES OF THE ENXYME. K a l e t h a K. and N a g e l - S t a r c z y n o w s k a G. D e p a r t m e n t of Biochemistry, Academic Medical School, Gdafisk, Poland
R e a c t i v i t y of sulfhydryl m u s c l e A M P - d e a m i n a s e (EC e f f e c t of t h e i r chemical r e g u l a t o r y p r o p e r t i e s of
groups of human uterine smooth 3.5.4.6) with DTNB, and the m o d i f i c a t i o n on kinetic and the enzyme, were investigated.
A p p r o x i m a t e l y seven and five sulfhydryl groups per mol of enzyme h a v e been shown to be accessible for DTNB (5,5'-dithiobis(2-nitrobenzoic acid)) titration in d e n a t u r e d and native AMP-deaminase, respectively. T i t r a t e d g r o u p s were not homogenous - some of t h e m r e a c t e d with DTNB much quicker than the others. M o d i f i e d enzyme was poorly active, and m a n i f e s t e d unusual, h y p e r b o l i c saturation kinetics with substrate. E x h a u s t i v e d i a l y s i s against a buffer containing i0 mM thioethanol, r e a c t i v a t e d modified enzyme, and restored its original r e g u l a t o r y properties. E x p e r i m e n t a l results obtained indicate that sulfhydryl g r o u p s modified, play a significant role in m a i n t e n a n c e of c a t a l y t i c a l l y - e f f i c i e n t conformation of the enzyme.
LOW LEVELS OF PURINE ENZYMES AS A CAUSE OF AZATHIOPRINE INDUCED BONE MARROW TOXICITY IN RHEUMATOID ARTHRITIS P Kerstens, L Lambooy*, A Boerbooms, R De Abreu*~ L van de Putte. Background. Severe bone marrow depression (BMD) is a rare but potentially lifethreatening side effect of low dose (<3 mg/kg) azathioprine (AZA) therapy. Deficiency of TPMT, one of the enzymes catabolizing AZA, has occasionally been reported as a cause of AZA-induced BMD (A-BMD). Aim of the study. Evaluate the association of AZA-induced BMD with levels of purine enzymes. Patients and methods. Lymphocyte levels of HGPRTt. APRT, 5NT and PNP, and erythrocyte levels of TPMT were measured in 3 patients (pts) with rheumatoid arthritis (R.A) who developed A-BMD, and 16 pts with RA without signs of ABMD after at least 6 months of treatment with AZA. Results. Of 3 pts with A-BMD 2 had very low TPMT levels, the 3rd had the lowest 5NT measured. Table 1. AZA-inducedBMD. (*: number of treatment days before A-BMD occurred) pt
AZA
before AZA
at BMD (nadir)
dose days* Hb lib WBC mg/kg mmol/l mmolfl .109fl 1
2 3
I.5 2.0 1.5
28 30 <90
7.4 6.4 7.5
4.9 4.5 7.2
1.4 1.4 0.8
Table 2.t TPMTand 5NT activitiesin t6 pts without A-BMD (upper panel), and 3 pts with A-BMD (lower panel)
Platelets .10~/I 4
102 280
Conclusions. 1. We confirm the association of TPMT deficiency with A-BMD. 2. Low levels of 5NT may offer a novel explanation for A-BMD in pts with RA.
TPMT
5NT
median rain.
41.11 22.75 12.24
19.18 7.42 3.72
pt I pt 2 pt 3
0.00 7.43 28.15
5-52 9.55 2.49
max.
I: IqG-PRT= hypoxanthineguanine-phosphoribosyltransfcr~e: A-PRT= =denine-PRT; 5NT= 5'nucleolidase: pNP= purlnenucleosidcphospho~lase; TPMT= thiopurinr mcthyllransfcrase, t: activities in nmol.10-6cclls.hr-h upper panel pe~cnlilcs, pts 1-3 individualvalues. DepLs. of Rhcumatologyand Pediatrics(*). UniversityHospital Nijmegen, PO Box 9101, 6500 HB Nijmcgcn,the Netherkmds.
Iqhlrma~ ), ] l "odd ~; N~ u'm c .......
,s . . . . . .
~
F19
PURINE ENZYME LEVELS IN RHEUMATOID ARTHRITIS: A CLUE TO THE PREDICTION OF THE RESPONSE TO AZATHIOPRINE ? P Kerste,% J Stolk, L Lambooy', A Boerbooms, R De Abreu', L vd Putte. Background. Lower levels of some purine enzymes have been described in patients with rheumatoid arthritis (RA) than in healthy controls. Abnormal purine enzyme levels may influence the effects of azathioprine (AZA); e.g. patients with the Lesch-Nyhan syndrome, a HGPRTI deficiency, ate resistant to AZA. Aim of the study. 1. Detect differences in purine enzyme levels between patients with RA and healthy controls (HC). 2. Investigate whether levels of purine enzymes correlate with the response to AZA. Patients and methods. Lymphocyte levels of HGPRT, APRT, 5NT and PNP, and erythrocyte levels of TPMT were measured in healthy controls (n=14) and patients with RA (n=36). Eight patients had not previously been treated with AZA. Nine patients (group 1) had shown a good response to AZA ( >50% improvement of at least 3 of 4 parameters: Ritchin Articular Index, VAS pain, duration of morning stiffness and ESR), 7 ( group 2) had insufficient effect of AZA after at least 6 months of therapy ( <30% improvement of at least 3 of 4 parameters), and in 11 patients ( group 3) AZA had to be stopped within 3 months due to side effects. Results. No differences between groups for HGPRT, APRT and TPMT were found. Levels of 5NT were significantly lower in patients with RA than in healthy controls, median levels being 6.4 and 9.6 nmol/10*cells.hr, respectively ( p = 0.03). Levels of 5NT were significantly higher in group I than in group 3 ( p = 0.012; (z = 0.017), and almost significantly higher than in group 2 ( p = 0.03). (Table)
5NT in 3 groups of patients with RA with different responses to AZA good
insufficient
response
response
group I, n=9 5NT 75th percentile median
25th percentile
adverse
p-value
reactions
group 2, n=7
group 3, n= I I
9.7'
8.6
7.5
7.6
5.1
5.5
7.4
4.0
4.8
0.02"
A
NEW POTENT INHIBITOR OF URIDINE PHOSPHORYLASE SA-423 BLOCKS ANTITUMOR ACTIVITY OF 5-FLUOROUKACIL A. A, Komissarov r A. M. Kozlov #, V. B.Sokolov*, A. Y. Aksinenko*, V. I~ Fetisov*, V- G. DebabQv.
Uridine phosphorylase (UPase) (EC 2.4.2.3) catalyses reversible phosphorolysis of uridine I . Conversion of 5fluorouracil 15-FU) to 5-fluorourldine (FUR) by UPase is essential for the antitumor activity of the former 2. Specific inhibitors of UPase are of interest as agents for modulating the metabolism of these analogs. A new powerful inhibitor of UPase - SA-423 was synthesised and studied both in vitro and in vivo. It inhibited purified UPase from E. coli by covalent modification of the active site with K i and k 2 values of 0.05 mM and 1.8 min -I respectively. For this reason SA-423 can be considered as an inhibitor of a new type that, unlike other such +compounds (for example 2,2'-anhydro-5-ethylurldine), inactivates UPase irreversibly. Thus after the SA-423 is degradated in tissues, UPase activity can be recovered only by biosynthesis de novo. Under simultaneous treatment with 5-FU (50 mg/kg) and S A - 4 2 3 . ( 5 ~ f k g i a pronounced about threefold decrease in entitumor activity of 5-FU was demonstrated in BDF 1 mice with experimental Leukemia P-388. In spite of existence of two putative mechanisms which can explain these results 2, data obtained confirm the assumption that SA-423 effectively inhibits UPase both in vitro and in vivo. 1 J.C. Leer et el. Eur. J. Blochem., 75 (1977) 217. 2 M. Iigo et al. Biochem. Pharmacology, 39 (1990) 1247.
*: I
Depls of Rhcumatology and Pediatrics(*), University Hospital Nijmegen, PO Box 9101, 6500 HB Nijmcgen, the Netherlands.
AFFINITY LABELING OF THE ESSENTIAL CARBOXYL GROUP IN URIDINE PHOSPHORYLASE FROM E. COLI WITH WOODWARD REAGENT K A. A. Komissarov,
D. V. Romanova r V. G. Debabov
Uridine phosphorylase (UPase) (EC 2.4.2.3) catalyzes the phosphorolysis of uridine with the formltion of riboso-l-phosphate and uracil I . Selective chemical modification of the essential residues and their further localization in the amino acid sequence are the traditional methods that create a foundation for carrying out site-directed mutagenesis and interpreting the X-ray data. Up to now there is only report that describes the modification of the essential histidine residue in the UPase active site 2 . The selective modification of the dicarbonic amino acid in the E. coli UPase active site with the Woodward reagent K (WRK) was studied. It was shown that the inactlvation reaction is characterized by a high affinity of the WRK to the active site (K i ~ 0.i mM) which can be compared with Km for uridine and uracil. Neither phosphate, uridine, uracil or deoxyriboso-l-phosphate do not protect the enzyme from inactivation. The binding of uridine and uracil strongly deteriorate the affinity of the WRK (K~ = 2.5 raM), and is accompanied by a significant increase of the rate constant of the UPase inactivation Inaction (from i.i to 5.1 min-l). ]hn almost complete protection is observed only upon simultaneous addition of uracil and phosphate or uridine and phosphate. Thus the enzyme can be protected from inactivation by simultaneous filling at least of uracil and phosphate bindlng subsites in the active site of UPase. i J.C. Leer et al. Eur. J. Biocb~em., 75 (1977) 217. 2 A.K. Drabikowska, G. Wozniak, Biochem. J., 270 (1990) 319. Institute for Genetics Moscow, 113545, Russia
~20
of Microorganisms,
Ist Dorozhny
I,
Institute for Genetics of Microorganisms, ist Dorozhny i, Moscow, 113545, Russia # Cancer Research Center, Institute of Tumor Experimental Diagnostics and Therapy, Russian Academy of Medical Sciences, Kashirskoe st. 24, Moscow, Russia *Institute of Physiologically Active Compounds, Russian Academy of Sciences, Chernogolovka, Russia.
HYPOURICEMIC EFFECT O F ALLOPURINOL AND THE NOVEL XANZ~INE OXIDASE {XOD) INHIBITOR T E I - 6 7 2 0 IN RODENTS AND CHIMPANZEES Keiji Komoriya. Yoshio Osada. Masalchi H a s e ~ a w a . Shiro Kondo. Ronald C. Couch*. Trawls B. Griffin* Allopurinol is the only c o m m e r c i a l l y available d r u g of t h e x a n t h i n e oxidase ( X O D } / x a n t h i n e d e h y d r o g e n a s e (XDH) inhibitors, a n d w a s i n t r o d u c e d a b o u t 30 y e a r s ago z. We i n v e s t i g a t e d the X O D / X D H i n h i b i t o r y activity a n d h y p o u r i c e m i c effect of a. newly s y n t h e s i z e d XOD/XDH inhibitor TEI-6720. 2-(3-cyano-4-1sobutoxyphenyl]-4m e t h y l - 5 - t h i a z o l e c a r b o x y l l c acid, a n d c o m p a r e d its effects w i t h t h o s e of s/lopurinol in vitro a n d in wlvo. T E I - 6 7 2 0 i n h i b i t e d b o v i n e m i l k XOD, m o u s e liver a n d r a t liver X O D / X D H s with ICs0 v a l u e s of 1.4. 1.8 a n d 2.2 nM. respectively. On bovine milk XOD. inhibition type of T E I - 6 7 2 0 is m i x e d - t y p e a n d the Ki v a l u e is 0.7 nM. T E I - 6 7 2 0 s h o w e d p r o l o n g e d u r a t e lowering activity in n o r m s / m i c e a n d r a t s . In addition, the h y p o u r i c e m i c effect of T E I - 6 7 2 0 w a s o b s e r v e d in h y p e r u r i c e m i c rats i n d u c e d b y a u r i c a s e inhibitor p o t a s s i u m oxonate. O r s / T E I - 6 7 2 0 a n d allopurinol s h o w e d h y p o u r i c e m i c effect with ED50 v a l u e s of 1.5 and 5.0 m g / k g , r e s p e c t i v e l y . 2 h r a f t e r t h e d o s a g e in o x o n a t e - t r e a t e d r a t s . Moreover. b o t h . c o m p o u n d s r e d u c e d t h e tots/ molality of uric acid a n d allantoin in r a t s t r e a t e d w i t h test d r u g s . T h e EDs0 v a l u e s of T E I - 6 7 2 0 a n d allopurinol were 2.1 a n d 6.9 m g / k g , p.o., respectively. F u r t h e r . T E I - 6 7 2 0 c a u s e d a striking r e d u c t i o n of s e r u m a n d u r i n a r y uric acid levels, a c c o m p a n i e d by a n i n c r e a s e in u r i n a r y x a n t h i n e levels in m a l e c h i m p a n z e e s w h i c h w a s a d m i n i s t e r e d orally once a d a y for t h r e e c o n s e c u t i v e d a y s . T h e s e effects of T E I - 6 7 2 0 w e r e m o r e p o t e n t t h a n t h a t of allopurinol. At a daily dose of 5 m g / k g . T E I - 6 7 2 0 r e d u c e d s e r u m u r a t e levels by 55.9, 69.6 a n d 73.6%. respectively. 24. 48 a n d 72 h r after the first dosage; allopurinol did 26.1. 41.6 a n d 45.1%. respectively. T h e s e r e s u l t s s u g g e s t t h a t the h y p o u r i c e m i c effect of T E I - 6 7 2 0 m a y be m o r e p o t e n t t h a n t h a t of allopurinol, a n d T E I - 6 7 2 0 m i g h t be useful for the t r e a t m e n t of p a t i e n t s with h y p e r u r i c e m i a . l R.W. Rund]es et aL T r a n s . Assoc. Am. Physicians. 76 (1963) 126. Teijin I n s t i t u t e for Bio-medical R e s e a r c h . A s a h i g a o k a 4-3-2. Hino. Tokyo 191. J a p a n . *White S a n d s R e s e a r c h Center, 1300 La Velle Road. A l a m o g o r d o . NM 8 8 3 1 0 .
I'h,..i,j O. I1'odd & .%w..'
ANTIBODIES TO MAMMALIAN DIHYDROOROTATE DEHYDROGENASE AS ATOOL FOR ENZYME CHARACTERIZATION AND INSITLI LOCALIZATION G.Lakaschus. H.G. L6ffier. M. L6ffier
The objective of this study was the production of antibodies specific to m a m m a l i a n dihydroorotate dehydrogenase (DHO DH) antigen purified from rat liver mitochondria. Thus polyclonal antibodies were raised tn parallel in canine and chicken as the production of antibodies in hens may faeflitate the s t u d y of highly conserved antigens that are poorly lmmunogemle in m a m m a l i a n hosts. In addition to possibly increased immunogeniclty, immunoglobulins from ehieken ean be extracted very easily in large amounts from the egg yolk. The antibodies were raised either against the native enzyme or the denatured protein in both animal hosts. (For purification procedure of rat liver DHO DH see 1). The gained lmmunoglobulins were isolated from canine sera by chromatographic methods and egg yolks by polyethylene glykol procedure, respectively, and affinity purified. The purified antibody was proven to be directed against enzyme by removal of enzyme aetivity after precipitation of the immuncomplex. Beyond this, the antibody recognized DHO DH transferred o n nitrocellulose membrane after sodium-dodecylsulfate gel-electrophoresis. Thus the antibody makes it feasible to prepare DHO DH from small amounts of tissue extracts when used as immunoaffinity matrix. Furthermore the application of the specific antibody was tested for immunohistochemical and cytochemical evaluation of enzyme distribution in different rat tissues, using PAP staining procedure and indirect immunofluorescent techniques. The present work will provide a tool for the demonstration of DHO DH distribution under pathophysiological conditions in h u m a n cells and biopsy specimen.
INCORPORATION OF ADENINE AND ADENOSINE IN THE ERYTHROCYTES OF PATIENTS WITH URAEMIA M~ Marlew~ki, R.T. Smolenski, J. Swierczynski, B_~.Rutkowski, H A . Simmonds, M.M. Zydow0 Adenine nucleotide pool in the erythrocytes of patients with uraemia is 2-3 fold greater than in the normal erythrocytes. The mechanism of this phenomenon is still unclear. In the present study the rate o f adenine nucleotide synthesis from adenine and adenosine in the normal and uraemie erythrocytes was investigated under conditions of varying inorganic p h o s p h a t e c o n c e n t r a t i o n (Pi) and pH in t h e i n c u b a t i o n medium. The rate of adenine incorporation under normal pH and P; concentration {mean+S.E.M.} was 0.81 _+0.11 nmol/min/ml erythrocytes in patients with uraemia which was significantly h i g h e r t h a n t h e r a t e in h e a l t h y s u b j e c t e r y t l l r o c y t e s (0.35 • 0.06 nmol/min/ml}. The rate of adenosine incorporation was 12.1 • nmol/min/ml in renal failure which was s i m i l a r t o t h e rate in n o r m a l e r y t h r o c y t e s (10.1 • nmol/min/mt). The increase in Pi in the incubation medium from 1.2 to 2.4 mM caused a t w o fold acceleration of adenine incorporation in normal erythrocytes but it was w i t h o u t effect in renal failure erythrocytes. Adenosine incorporation was not affected by the changes in P.. The influence of pH decrease from 7.4 to 7.1 was withou~ marked influence on adenine or adenosine incorporation in both renal failure and normal erythrooytes. Data presented here are in agreement w i t h the hypothesis suggesting that n u c l e o t i d e p o o l e l e v a tion in the erythrocytes of patients with uraemia may be a consequence of an increased rate of purine bases salvage. The mechanism of this acceleration may be associated with the e l e v a t e d P~ c o n c e n t r a t i o n in uraemic b l o o d , p o s s i b l y causing a c c u m u l a t i o n of p h o s p h o r i b o s y l - p y r o p h o s p h a t e (PRPP) a co-substrate of punne reutilisation enzymes. Department of Biochemistry, University Medical School of Gdansk, Poland and Purine Research L a b o r a t o r y , G u y ' s Hospital, London, U.K.
1 G. Lakaschus and M. L6ffier. Biochem. Phannacol. 43 (1992), 1025. Financial support by the Sander-Stlftung and the Kempkes-Stlftung is gratefully acknowledged.
Institut ffir Physiologische Chemie, Klinikum der Phillpps-Universit~t Marburg, Karl-von-Frisch-Str., D-35011 Marburg, Germany.
URIC ACID METABOLISM IN MEGALOBLASTIC ANEMIAS M. L6pez Jim~nez, M.A. Salinero, J. S~nchez Guilarte, J. Perianes Matesanz. L. Viail Medina, J. Ruiz Galiana. H y p o u r i c e m i a I and hyperuricemia 2 have both been d e s c r i b e d in p a t i e n t s with pernicious anemia. However, it is not known either the mechanisms of these disorders of uric acid metabolism in pernicious anemia or whether these alterations occur in other types of megaloblastic anemia. We have studied sixteen patients with megaloblastic anemia: 9 with p e r n i c i o u s anemia, 5 with folate deficiency and 2 with v i t a m i n B 94 deficiency. Six patients (37.5%) showed a level of uricemla lower than 2.5 mg/dl (3 with p e r n i c i o u s anemia, 2 with folic acid deficiency and 1 with vitamin BI2 deficiency). Five patients (31.2%) presented a level of serum urate higher than 7.0 mg/dl (3 with pernicious anemia and 2 with folate deficiency). Treatment with vitamin BI2 and folic acid produced an increase of serum urate in every patient except in those with hyperuricemia, in whom serum uric acid c o n c e n t r a t i o n decreased during therapy. Thus after having been corrected the megaloblastic anemia, the serum urate level was normal in every patient. In three patients with hypouricemia the urinary excretion of uric acid was normal (437• mg/24 h), whereas the fractional excretion of urate increased (29.2• being reduced during therapy (i0.2~3.1%). In summary, hypouricemia and hyperuricemia are both frequent in m e g a l o b l a s t i c anemias and were corrected by a treatment with vitamin B12 and folic acid. The m e c h a n i s m of hypouricemia consists of an increase of fractional excretion of uric acid (renal hypouricemia). i. M.C. Riddle. J. Clin. Invest. 8 (1929) 69-88. 2. R.B. Gibson. Arch. Intern. Med. 32 (1923) 1-16. Dept. of Internal Medicine, Dept. of Hematology, M 6 s t o l e s Hospital. Rio Jucar s/n. 28935 Mdstoles. Madrid. Spain.
PURINE AND P Y R I D I N E M E T A B O L I S M IN SOME NEUROLOGICAL DISORDERS: NUCLEOTIDE C O N C E N T R A T I O N AND P R O D U C T I O N R A T E BY INTACT ERYTHROCYTES .V..:.Micheli, M.Rocchigiani, M. Pescaglini, S.Sestirfi, G.Jacomelli, C. Magagnoli, G.Pompucci, G. Havek* Backgrotmd - Altered purine and pyridine nucleotide concentration have been demonstrated in erythrocytes in different neurological diseases, associated with inherited enzyme alterations. The significance of such NAD(P) alterations and the involvement of pyridine precursors in different neurological disorders have not been clarified. Ahn of the study is to identify possible alterations in pyridine metabolism and connections with purines in neurological disorders, particularly in Rett syndrome, a recently identified syndrome affecting females, with characteristic behavioral features and unknown etiology. Patients and Methods - The following patients were examined together with 10 healthy controls of comparable age: 11 autistic, 9 Rett and 5 mentally retarded patients. RP-HPLC (Beckman System Gold) linked methods, coupled or not with radioactivity, were tzsed for all assays in intact erythrocytes: determination of nucleofde content ,and nucleotide production ti-om [I4C]- adenme,-hypoxanthine and -nicotinic acid plus glutamine. Results - Low ATP level (36-77% of controls) was found in four Rett patients (RP), three of which also showed low concentration of NAD or NADP or both; half normal NADP level was also found in two more RP. NAD formation was lower and adenyl nucleotide formation higher than control in four RP. Low NADP levels (40-70% of controls) were found in four autistic patients (AP), one of which also showed decreased NAD; m one case NAD was higher than control: pyridine nucleotide production rate was increased in one case. NAD level was twice normal in one mentally retarded patient, and half of normal in another one, also showing low ATP and NADP levels.. These findings provide indications for possible metabolic abnormalities in these subjects.
Dpt. Biologia Molecolare, Umversit5 di Siena, Italia *Rip. Neuropsicbiairia Infantile, USL 30, Siena. Italia I ~har.r,Jt y l T,'~dd ~5 S~a'.~ ,"
........ 5. . . . 9~
F21
MECHANISM OF ACTION OF RAT LIVER ADENOSINE KINASE
URIC ACID METABOLISM IN WOMENWITH PRIMARY GOUT.
M. Mimouni. F. Bontemss. G. Van den Berahe
ME Miranda. FA Mateos. JG Puio.
Adenosine kinase (AK) catalyses the phosphorylation of adenosine (Ado) into AMP, using ATP as the phosphate donor. Recently, we have found that rat liver AK can also catalyse the formation of labelled AMP from labelled adenosine and unlabelled AMP, in the absence of ATP, by an exchange reaction (1). The existence of this exchange reaction suggested that AK acts by way of BiBi ping-pong, rather than by an ordered sequential mechanism as usually stated in the literature. For AK, a BiBi ping-pong mechanism implies binding of ATP, followed by release of the first product, ADP, before binding of the second substrate, Ado, followed by release of AMP; it also implies formation of a phosphoryl enzyme intermediate, which would explain an exchange between Ado and AMP. However, we have not succeeded in labelling AK with 32p by incubating the enzyme, purified to homogeneity, with [-f.32p]ATP.
Gout is uncommon in women, who account for approximately 5% of all patients with gout. About 70 to 80% of women with gout have their first attack after the menopause. To our knowledge, the metabolism of uric acid, hypoxanthine and xanthine has not been studied in women with gout. We have compared the metabolism of uric acid and its precursors in 41 male (age, 59+_13 years; body mass index [BMI], 27.6+3.4 kg/m 2) versus 10 female subjects (age, 63+12 years, BMI 28.1_+5.1 kg/m 2) with primary gout. The results are shown in the table.
Lineweaver-Burk plots, constructed with the first substrate at different fixed concentrations of the second substrate, give as a rule a family of converging curves for a sequential mechanism, and a parallel-line pattern for a pingpong mechanism. Measurements of the initial velocities of liver AK in function of the concentration of ATP or Ado, at various fixed concentrations of Ado or ATP, generated parallel-line patterns, in accordance with a ping-pong mechanism, In the latter ATP should be competitive with AMP, and ADP competitive with Ado. Unexpectedly, competitive inhibition was only observed between ATP and ADP, indicating a sequential mechanism in which ATP binds first to the enzyme and ADP is released last. We have also observed that the Ado - AMP exchange reaction is potently stimulated by ADP (more than 100-fold in the presence of 10 I~M ADP) and that the AMP we used was slightly contaminated by ADP (- 0.001%). Accordingly, the velocity of the exchange reaction decreased by 90 % when purified AMP was used. Traces (0.015 %) of ADP might also explain the stimulation of the exchange reaction by 2,3-bisphosphogiycerate. These results suggest that the exchange reaction requires ADP. In turn, this requirement might explain the occurrence of an exchange reaction in a sequential mechanism. Why the Lineweaver-Burk plots yield parallel lines remains to be determined. 1 F. Bontemps, M. Mimouni, G. Van den Berghe, Biochem. J, 290 (1993) 679 Laboratory of .Physiological Chemistry, international Institute of Cellular and Molecular Pathology, UCL 75.39, Avenue Hippocrate 75, B-1200 Brussels, Belgium.
Men (n=41) Plasma Creatinine (mg/dL) 1.1+0.2 Urate (mg/dL) 7.6+1.5 Hypoxanthine (~mol/L) 4.1+-2.3 Xanthine (p.mol/L) 1.1+-0.6 24-hour urine Creatinine (mg/24h/1.73m 2) 1434+321 Urate (mg/24h/1.73m z) 418+t60 Hypoxanthine (F.mol/g Cr) 21+-11 Xanthine (p.mol/g Cr) 13_+9 Clearance (mL / min /1.73 m2) Creatinine 96+-26 Urate 3.86+1.45 Cur/Ccrt {%) 4.13+1.45 *P<0.01; tCur/Ccr, fractional excretion of urate.
Increased lead body stores have been reported in patients with gout and renal insufficiency. This finding led to the hypothesis that renal dysfunction in gout patients may be due to chronic lead intoxication. To evaluate the protagonism of lead in the pathogenesis of familial nephropathy associated with hyperuricemia or gout (McKusik, 162000), we performed the EDTA lead mobilization test in 10 patients of 3 families with this syndrome. Patient Age Ccr* Blood lead (Family) (yrs) (p.g/dL) IV-I(M) 34 40 10.5 IV-3(M) 33 43 15.0 IV-4(M) 28 104 10.5 11-2(T) 46 32 18.0 II1-1 (T) 15 43 3.0 111-2(T) 12 62 3.0 11-7(A) 53 57 20 11-9(A) 52 80 20 111-9(A) 22 51 20 II1-11(A) 20 85 24 ND denotes non detected; *mL/min/1.73m2.
Mobilizable lead (p.@/120 h) 439 622 11.19 2012 lq3 r,D i'43 166 N3 Fs
Three out of the ten patients showed an increased mobilizable lead. The amount of lead excreted after EDTA was not related to the age or the creatinine clearance. These results suggest that lead has no pathogenic role in the renal impairment of these families. Dpt. of Internal Medicine and Clinical Pharmacology. La Paz University Hospital. Paseo de la Castetlana, 261. 28046 Madrid, Spain.
1.0+0.2 7.0+1.4 4.6+-2.3 1.4+-0.6 1013+236" 361 +-113 17+-7 15+10 74_+16* 3.65+1.33 4.88+-1.39
The metabolism of uric acid, hypoxanthine and xanthine is similar in men and women with primary gout. Renal purine underexcretion may account for the increased plasma purines in women with gout. Dpt. of Internal Medicine and Clinical Pharmacology. La Paz University Hospital. Paseo de la Castellana, 261. 28046 Madrid, Spain.
LEAD BODY STORES IN PATIENTS WITH FAMILIAL NEPHROPATHY ASSOCIATED WITH HYPERURICEMIA OR GOUT. ME Miranda. FA Mateos. E Herrero. A Gonz~,lez. JG Pule.
Women (n=lO)
BOVINE SPERMATOZOA AND ATP DEGRADATION: THE LACK OF ADENOSINE PRODUCTION P. Miscetti,
A. Minelli, A. Proietti, and I . Mezzasoma
M.Moroni,
Bovine spermatozoa freshly ejaculated, and epididymal spermatozoa, when incubated in Ringer-phosphate solution containing 28 mM glucose, metabolize their ATP to keep the energy charge value in the physiological range up to 120 min. When 28 mM 2d-glucose is added to the Ringer-phosphate solution, intracellular ATP is quickly degraded and its concentration drops to 50% of the initial content in 4 min. The fall of ATP is concomitant with the increase of ADP and AMP. The latter represents nearly 70% of the degraded ATP and its concentration tends to stay rather constant indicating that AMP can be considered as the dead-land product of ATP catabolism. After 60 min of incubation in Ringer-phosphate solution plus 2d-glucose the production of adenosine accounts for less than 1% of the initial ATP content in bovine spermatozoa. Determinations of intracellular AMP-deaminase resulted in the absence of this enzyme in agreement with the experimental results showing the absence of IMP. On the other hand, determinations of the phosphohydrolases activities have shown the intracellular existence of enzymes potentially capable of hydrolysing the AMP produced during, ATP catabolism. Therefore the question why Ado is not intracellulary produced does still need an answer.
Dept. Experimental Medicine and Biochemical Science, University of Perugia, via del Giochetto, 06100 PERUGIA (Italy).
F22
Ph.Jr.,,1,). II'~,H,Ii- q.,r.~
MAPPING
THE GENE FOR FAMILIAL JUVENILE HYPERURICAEMIC NEPHROPATHY
J.F. Moro',l. Noam2, J.S. Cameron 3, H.A. Simmonds~ M.B. McBride', C.G.P. Mathew 2, C.S. 0qq 3, J.G. Puiq 4, M.E. Miranda 4 and F.A. Mateos 4. F a m i l i a l j u v e n i l e h y p e r u r i c a e m i c n e p h r o p a t h y (FJHN) i s an autosomal dominant d i s e a s e c h a r a c t e r i z e d by h y p e r u r z c a e m i a disproportionate t o t h e degree o f r e n a l d y s f u n c t i o n w i t h progress• renal failure and i n some cases gout, a p p e a r i n g i n young people o f e i t h e r sex ,,2. The l o c a t i o n of t h e gene(s) is unknown. E a r l y r e p o r t s suggested an u n u s u a l l y h i g h i n c i d e n c e o f g o u t , h y p e r u r i c a e m i a and p o l y c y s t i c k i d n e y d i s e a s e 3. The gene f o r autosomal dominant p o l y c y s t i c k i d n e y d i s e a s e t y p e I (ADPKDI) has been a s s i g n e d t o chromosome 16p. C o n s e q u e n t l y , a search f o p p o s s i b l e l i n k a g e between ADPKD[ and FJHN was c a r r i e d o u t . P o l y m o r p h i c DNA markers were t e s t e d f o r c o - s e g r e g a t i o n w i t h t h e FJHN phenotype i n 10 a f f e c t e d f a m i l i e s (83 i n d i v i d u a l s ) . R e s u l t s showed s t r o n g evidence against linkage between FJHN and b o t h t h e p r o x i m a l and d i s t a l flanking regions of the loci for ADPKDI. 1. H. Duncan, d. D i x o n . QJMed Gout, f a m l i a l h y p e r u r i c a e m i a and r e n a l d i s e a s e . QdMed 1 9 6 0 ; 2 9 : 1 2 7 - 1 3 6 2. J. S. Cameron, F. Moro, H.A. Simmonds. Gout, u r i c a c i d and p u r i n e metabolism i n p a e d i a t r i c n e p h r o l o g y . Review. Ped N e p h r o l 1 9 9 3 ; 7 : 1 0 5 - 1 1 6 . 3. E. M e j i a s , d Navas, R L l u b e r e s , M M a r t i n e z - M a l d o n a d o . Hyperuricaemia, g o u t and autosomal dominant p o l y c y s t i c k i d n e y d i s e a s e . Am J Med Sc 1 9 8 9 ; 2 9 7 : 1 4 5 . P u r i n e Research L a b o r a t o r y ( 1 ) , P a e d i a t r i c Research U n i t ( 2 ) , and Renal U n i t ( 3 ) , G u y ' s H o s p i t a l , London, England; and "La Paz" U n i v e r s i t y H o s p i t a l ( 4 ) , M a d r i d , Spain.
BIOCHEMICAL MODULATION OF CYTOSINE ARABINOSIDE WITH N-(PHOSPHON)-ACETYL-L-ASPARTATE P.Noordhuis, K. Kazemier',G.J.L. Kaspers ~ G.J. Peters. Cytosine arabinoside (Arm-C) has been an effective anticancer agent for several decades. Ara-C has to be activated by deoxycytidine kinase (dCK) to Ara-CMP and subsequently to its triphosphate Ara-CTP, which can be incorporated into DNA leading to chain termination. Resistance to Ara-C is related to the formation and retention of Ara-CTP, altered levels of UTP and of CTP, and increased levels of dCTP (feedback inhibitors of dCK). Combination with N-(phosphon)-acetyI-L-aspartate (PALA) may enhance the cytotoxicity of Arm-C, because inhibition of aspartate transcarbamylase by PALA will decrease the UTP, CTP and dCTP levels. Different schedules of Ara-C and PALA were tested on the promyeiocytic HL60 and the monoblastoid U937 leukemic cell lines. Preincubation nor coincubation with 50 I~M PALA showed any significant decrease in the ICso (50% growth inhibition) or TGI (total growth inhibition) of HL60. In U937, more sensitive to Ara-C, both pre- and coincubation with PALA potentiated growth inhibition (at least 10-fold decrease in ICso) of Ara-C but the TGI and LCs0 (50% lethal concentration) was not significantly different. The Ara-C cytotoxicity in blast cells from 11 untreated pediatric patients with leukemia (AML, ALL and CML) was not affected by PALA concentrations up to 1600 p.M and the LCso varied from 1.9 to 7.2 I~M. Accumulation of Ara-CTP in HL60 after 24 hr exposure to 1 and 10 #M Ara-C was 34 and 103 pmol/10 s cells and 89 and 552 pmol/10 s cells in U937, respectively. Addition of 50 I~M PALA did not change the Ara-CTP levels. |n blast cells from patients the Ara-CTP accumulation varied from not detectable to 32 pmol/10 s cells after exposure to 1 p.M Ara-C and from 5 to 246 pmol/10 s cells to 10 I~M Ara-C. 50 #M PALA did not alter the Ara-CTP levels. PALA up to 500 p.M had a similar effect on Ara-CTP although UTP and CTP were decreased more than 50%. Incorporation of Ara-C into DNA was determined by exposing the cells for 4 and 24 hr to tritiated Ara-C and was comparable in HL60 and U937, 0.45 after 4 hr and 2.5 pmol/106 cells after 24 hr exposure at 1 t~M Ara-C, respectively. At 10 p.M Ara-C HL60 incorporated 2.1 and 9.0 pmo[/10 s cells after 4 and 24 hr. U937 incorporated 11.3 and 95 pmol/10 s cells after 4 and 24 hr. Combination with 50 p.M PALA did not change the Ara-C incorporation. In conclusion; modulation of Ara-C cytotoxicity with PALA in leukemic cell lines and blast cells from untreated patients is limited. This is in contrast to what is found for solid tumor lines. Therefore, selective modulation of other antimetabolites with PALA in non-hematological cells has good perspectives. Free University Hospital, Dept. of Oncology and *Dept. of Pediatrics, P.O. BOX 7057, 1007 MB Amsterdam, The Netherlands.
ATP AND LOW K m 5' N U C L E O T I D A S E FROM HUMAN SEMINAL PLASMA M. Moroni,
A. Minelli,
L.Luzi
and I.Mezzasoma.
ATP exerts a different regulation of the activity of low K m 5' Nucelotidase. The enzyme, purified from human seminal plasma, in the presence of AMP as substrate, is activated by increasing concentrations of ATP up to 0.5 mM, with the m a x i m a l activation at O.i mM; the increase of ATP up to 1 mM has no e f f e c t on the enzyme activity while a further increase of ATP up to 2 mM causes a little inhibition (i). In the attempt to investigate this effect, rather unique for a soluble low K m 5' Nucleotidase, usually inhibited by ATP at any c o n c e n t r a t i o n ( 2,3 )" we checked the hypothesis that ATP binds to the enzyme and s o m e h o w affects its h y d r o l y s i n g activity towards AMP. The formation of M g - A T P complexes and their possible involvement in the effects exerted by ATP will be considered as well as the variations of energy charge and the inorganic Pi concentration. i A. Minelli, et al. Biochem. Biophys. Acta, 1080 (1991) 252. 2 J. Spychala, et al. AM. J. Physiol., 256 (1989) E386. 3 V. Madrid-Marina, et al. J. Biol. Chem., 261 (1986) 444.
THE EFFECT OF THE INTRACELLULAR PHOSPHATE CONCENTRATION ON THE TURNOVER OF THE ADEIEfN~ RIBONTJCLEOTIDE POOL INDUCED BY ADENOSINE
~ . Overgaard-Hansen, M. Marcussen, H. K]enow Adenosine has been shown to cause an expansion of the ATP pool in several cell types and simultaneously to trigger events that lead to a rapid catabolism of the adenine ribonucleetide pool via a de,mination of A_MP to IMP followed by a dephosphorylation of IMP to inosine. The two processes have been shown to be more or lees tightly
coupled
depending on the concentration of Pi in the medium. In the present experiment the coupling of the two processes has been studied in cells with different levels of intracellular Pi. T h e experiments w a s done with Ehrlich ascites cells where A T P w a s prelabeled with *4C-adenine. This allowed the determination of the catabolism of adenine ribonueleotides to labeled nucleosidea under conditions where added adenosine w a s phosphorylatod. In phosphate depleted cells in Hepes Ringer at p H 6.5 where the average intracellular concentration of Pi w a s below i m M adenosine w a s phosphorylated at a rate that w a s completely balanced by a concomitant catabolism of the adenine ribonucleotides. At increasing levels ofP ian increasing uncoupling between adenosine phosphorylation and adenine ribonucleetide catabolism w a s observed leading to a steadily expansion of the A T P pool and a decreasing rate of catabolism. Dept. of Medical Biochemistry Biochemistry B, T h e P a n u m Copenhagen N, D e . m ~ r k
and Genetics, Laboratory of Medical Institute, Blegdamsvej 3, D K - 2 2 0 0
Dept. Experimental Medicine and Biochemical Science, University of Perugia, via del Giochetto, 06100 PERUGIA (Italy).
v,,,. . . . . . . . . . . . ~
F23
SERUM URATE DISEASES
AND
URIC
ACID
EXCRETIC~
IN
PATIENTS
WITH
LIVER
A. Pelatti, C. P. Quaratino t C. D'Amario t R. Tentarelli and A. Giacemello
Hypouricemia has b e e n described in severe liver disease. This condition may be chiefly due to an increased clearance of uric acid, but reduced preductionmay also play a role. Serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), total bilirubin (TOT BIL), uric acid (SUA), total cholesterol (TOT CHOL), triglycerides (TRIGLYC), blood urea nitrogen (BUN), and fractional excretion of uric acid (FE) were determined in 479 males (age: 42.835 (Mean) i 22.107 (SD) years; body mass index (BMI): 24.622 (Mean) • 3.989 (SD) Kg/m^2) and in 510 females (age: 38.947 (Mean) i 18.649 (SD) years; ~MI: 23.835 (Mean) • 4.403 (SD) Kg/m^2). 124 males and 57 females had ALT value higher then 40 U/L ranging from 41 to 718 U/L . The variables considered were not normally distributed (Lilliefors test). TOT CHOL values were conparable in the two sexes. Mean values of all other variables but FE were higher in males. In both sexes SUA was positively correlated (Spearman coefficient) with TOT CHOL, TRIGLYC, BUN, AGE and BMI (p <0.01). A lower correlation coefficient (p <0.05) was obtained for BIL TOT. The correlation coefficient between SUA and ALT was higher in men (p <0.01) than in women (p <0.05). In both sexes FE was negatively correlated with SUA (p <0.01). A positive correlation (p <0.05) of FE with AST in females and with HMI in males was also obtained. In both sexes the mean value of SUA was higher in patients with ALT >40 U/L. Ospedale Civile di Pescara e Cattedra di Patologia Clinica dell' Universit~ di Chieti. Italy.
Oxonic acid effect on uric acid and allantoin of serum and rat liver. M J_ Pizzi~hini~ _~,L~ _Pan~o lli~__L,_ Ar_ezmini~ L .~e r~o.li ~_ A. ~ahuoehi ~_R. P~gani~ Uric acid is converted to allantoin by uricaae, an enzyme found predominantly in the liver, in most mammalian species, but not in the man. Several chemical compounds, with a structural affinity to the pyrimidine portion of uric acid, are competitive inhlbitors of uricase and are used to induce hyperuricemia in the rat (i). Oxonio acid has been described as a potent inhibitor of uricase activity in vitro and in vivo: an increase of uric acid plasma levels and a decrease of urinary allantoin were observed in the rat, two hours after oxonic acid administration (2). No data were reported concerning variations of uric acid and allantoin content in the liver. Male albino wistar rats were injected i.p. with a single dose of oxonic acid suspension (25 mg/100 g b.w.) and after 2 hours the rata were killed, blood samples were taken from jougular vein and serum was obtained by centrifugation. Serum uric acid was determined according to Praetorius and Poulsen (3), allantoin was analyzed after TCA treatment, according to Young and Conway (4). The assay of uric acid and allantoin was carried out in the liver after mercuric acetate precipitation, as previously reported (5;[ Oxonic acid causes a decrease of allantoin levels both in the serum and liver; uric acid concentration increases in the serum, but no significant variations are evident in the liver. Our results confirms the hyperurioemio effect of oxonic acid, due to a strong inhibition of hepatic uricase, but they show that there is no increase of uric acid in the liver, probablF because this catabolic compound is rapidly removed from the liver and released into the serum. i) M.Hropot e t a l . Adv. Exp. Med. Biol. 122 A (1980) 269. 2) W.J.Johnson et al Proc. Soo.Exptl. Biol.Med.131 (1969) 6 3) E.Praetorius & E.Polsen Stand. J. Clin. Lab. Invest. 5 (1953) 273. 4) E.G.Young et al. J. Biol. Chem. 152 (1944) 245. 5) A.Di Stefano et al. Biochim.Biophys.Acta 1117 (1992) i Institute of Siena, Pian
PURINE AND PYRID1NE METABOLISM IN SOME NEUROLOGICAL DISORDERS: ENZYME ACTIVITIES IN ERYTHROCYTE LYSATES. M. Pescaglini, M. Rocchigiani, S. Sestini, C. Magagnofi, G~ Iacome[li, V. Micheli, G. Pompueei, G. Havek* Background - Different neurological diseases have been demonstrated to be associated with inherited purine enzyme alterations and NAD abnormalities in the erythroeytes. The biochemical basis of the altered NAD levels have not been completely clarified. Aim of the present study is to identify possible alterations of purine and pyridine enzyme activities in mental disorders.. Methods and patients - The activity of some purine enzymes (ADA, PNP, HPRT, APRT) and of some pyridine enzymes: rticolinic acidphosphoribosyltransIeraxe (NAPRT). nicotinamide and r~cotir~c acid mononucleotide adearylyltransferase (NMN-AT, NAMN-AT) and PRPP synthctase have been te~teA using non radi0chemic~l HPLC m , ~ o d s in erytroeyte lysates. 11 patients affected by autism, 6 by Rett syndrome, 5 by mental retardation, 2 by psychosis and 14 healthy control-children of comparable age (3-22 years) were tested. Results - No significant alterations of purine enzyme activities have been observed in all the tested subjects. NAPRT and NA_MN-AT activities in 4 autistic patients were higher than the normal range; 4 out of 6 patients affected by Rett syndrome showed lower values of NMN-AT aelivity compared with controls. NAPRT activity was twice normal in 3 out of 5 patients with mental retardation, the other two being in the highest range. Discussion - The observed alteration of both NAPRT and NA.MN-AT activities in the autistic patients, and of the NMN-AT activity in Kett syndrome, a relatively new syndrome with unknown etiology, lead to hypothesize an alteration o f N A D syathesis in these diseases.
Biochemistry and Enzymology dei Mantellini 44, 53100,
University of Siena, Italy.
SOME ASPECI~ OF THE EPIDEMIOLOGY OF SERUM URIC ACID LEVELS
C. P. Quaratino, N. Di Sciascio, A. Colosimo and A. Giaccmello
An epidemiological study on 4320 patients (2186 males) has been carried out. 2140 subjects (1029 males) were outpatients. All considered variables were not normally distributed (Lilliefors test). The two sexes were cc~parable for age but serum urate (SUA), creatinine (SCR),triglycerides (STRIGLYC), were higher in man while serum cholesterol (SCHOL), serum glucose (SGLU) and fractional excretion of uric acid (FE) were higher in w~men. A rise in serum urate levels during the second decade was observed in men and after 40 years in women. In both sexes FE values were essentially stable and independent of ag~. Spearman correlation coefficients between variables were computed. In both sexes in the total population, in inpatients as well as in outpatients, a positive correlation (p <0.01) between SUA, SCR, STRIGLYC, and a negative correlation (p <0.01) between SUA and FE were obtained. SUA was positively correlated (p <0.01) with SGLU in females but not in males. A positive correlation of SUA with SCHOL was evident (p <0.01) in all males (total population, inpatients and outpatients) and in total and outpatient but not in inpatients females. The influence of age, 'normal' (25th-75th percentl) and 'pathological' (<25th percentl and >75th percentl) values of each variable on these correlations has been studied.
Ospedale Renzetti di Lanciano (CH), Dipartimento di Scienze Biochimichs dell'UniversitA di Rosa I and Cattedra di Patologia Clinica dell'UniversitA di Chieti, Italy.
Dipartimento di Biologia Molecolare, Urtiversi& di Siena, and * Rep. Neuropsichiatria, USL 30, Siena (Italy)
~2 4
I%,m.,t, ), 1|~.h1,5 S, w.,c
ID~.ITIFICATION OF A NON CATALYTIC DOMAIN IN SKELETAL ~/SCLE AMP DEAMINASE THAT I N F ~ Y ~ C E S ATP BINDING TO THE ENZYME
New case deficiency.
M_.k~4IERI-PAGGI,
I.Sebestal~d.Krijtl,K,Vondrak2,S.Kmochl,M.Hrebicekl, A.SimmondsJ,J.A.Duley ~.
F.BONCA,
P.E.BRO~q*,
A.J.G.MOIR*,
A.RAGGI
~P deaminase is a key regulatory enzyme of nucleotide metabolism and preservation of energy charge in eukariotic cells. Native skeletal muscle ~ P deaminase is a tetramer, the subunit molecular weight being around 80 kilodalton. We previously demonstrated that limited proteolysis of the rabbit enzyme with trypsin abolishes the sensitivity of skeletal muscle ,AMP deaminase towards ATP inhibition at optimal pH 6 . 5 1 , but not at pH 7.1 ~ . The proteolysis produces a 72 ks core that is resistant to further diqestion, demonstrating that limited proteolysis ~ast occur ~t either or both ends of the chain.
of
adenine
phosphoribosyltransferase
H.
1 M. ~aniari-Raqgi & A. Raggi FEBS Lett. 102 (1979) 59 2 M. Ranieri-Raggi & A. Raggi Biochem. J. 272 (1990) 755 3 R.L. Sabina et al. J. Biol. Chem. 265 (1990) 9423
2,8 d i h y d r o x y a d e n i n e (2,8DHA) lithiasis is a form of kidney stone p r e v i o u s l y m i s t a k e n for u r i c acid.The basis for the defect is a d e f i c i e n c y of the enzyme adenine p h o s p h o r i b o s y l t r a n s f e r a s e (APRT). We report a 14 months -old b o y , t h e second child of unrelated parents w i t h b i r t h weight 4620 g and height 60 cm .There were no p e r i n a t a l p r o b l e m s . O n e month after b i r t h he was a d d m i t e d to the Children's Clinic for dysmorphic features. At the age of one year he was addmited to N e p h r o l o g y D e p a r t m e n t for heamaturia.On renal u l t r a s o u n d the right pelvis was filled w i t h bright echo cluster casting acousting shadows.On metabolic investigation of the urine 2,8,DHA was found. D e t a i l e d purine m e t a b o l i c investigation from urine blood and erythrocytes followed and APRT deficiency was confirmed. I n t e r e s t i n g finding was that patient was p a s s i n g d u r i n g h o s p i t a l i z a t i o n a lot of small stones w i t h o u t pain. Neurologic examination found central h y p o t o n i c syndrome. M a c r o c e p h a l y was also f o u n d . N e u r o l o g i c a l findings could be probably coincidental. D e t a i l e d family i n v e s t i g a t i o n found 4 h e t e r o z y g o t e s . T h e r a p y w i t h allopurinol 8 mg/kg per day was iniciated. Our case,first in S l o v a n i a n p o p u l a t i o n , e m p h a s i s e s the importance of physician's awareness of this disorder presenting w i t h u r o l i t h i a s i s and also stress the need for appropriate available d i a g n o s t i c network services for purine investigations in East E u r o p e , i n c l u d i n g therapy monitoring.
IstituLo di Chimica Biologica, University of Pisa, Pisa, Italy, *Krebz In3titute, Dept. of Molecular Biology and ~iotechno!o,~-, University of Sheffield, Sheffield, U.K.
1 Centre for M e t a b o l i c Disorders, ist Medical Faculty, Charles University, Prague 2 Department of Pediatrics, Thomayer's Hospital, Prague 3 Purine R e s e a r c h Laboratory, Guy's Hospital, London
We now describe the separation of the tryptic digest by gel filtration and reverse phase HPLC that resulted in the isolation of three major components. N-terminal se~ence analysis of the peptides identified them as ec~livalent to the 4 to 18, 24 to 73 and 80 to 95 encoded sequences of human and rat ~4P deaminase genes 3 Since all the peptides removed from the enzyme during incubation w i t h trypsin derive from the N-terminus, it can be concluded that a regulatory d o m a i n is located within residues 1-95 of AMP de~tlinase that causes il-H%ibition by ATP at acidic pH. This pl~enomenon may be of physiological relevance in avoiding the depletion of muscle adenine nucleotide stores that would ensue from an unrestrained activity of AMP deaminase during sustained contractile activity.
TRACERKINETIC STUDIES IN THE PURINE METABOLISM EHRLICH-ASCITES-TUMOR-CELLS AND LIVER CELLS EHRLICH-ASCITES-TUMOR-BEARING MICE
OF OF
SchwendeI A.1, Grune T.2, Siems W.G.3, and Holzhuetter H,G.1 I) 2) 3)
Institute of Biochemistry, Humboldt University, Hessische Str. 3-4, D - O - I 0 4 0 Bertin, FRG Clinic of Physiotherapy. CharitA, Schumannstr. 20-21, D-O-1040 Bertin. FRO Herzog-Julius Hospital of Rheumatolog7 and Orthopaedics, Kurhausstr.13-17, D-W-S388 Bad Harzburg, FRG
The evaluation of traeerkinetie experiments and the estimation of flux rates is a powerful tool for the investigation of changes in metabolic pathways. A number of analytical methods can be used for this purpose, e.g. HPLC technique and TLC.
Since HPLC was applied, low metabolite concentration could be taken to account. Carrying on experiments describes in Ref.1, the pool sizes and radioactivities were measured at the same time in the cell material. [U-14Cladenine has been used as the radioactive precursor. The dynamic of radioactive tracers was mathematically modelled by a system of differential equations. The estimation of flux rates was done under the assumption of a metabolic steadystate.
Our experiments on the purine catabolism of mice hepatoeytes yield a remarkably higher purine degradation during the resting period of tumor growth then in the proliferating period. The obtained flux rates for Ehrlich ascites tumor cells (EATC) indicate a marked decrease of the adenine nucleotide metabolism in the resting phase as compared with the proliferating phase of tumor growth. Our results show that the flux rates through the purine metabotire pathways in EATC-bearing mice hepatocytes depends on the phases of tumor growth in EATC. 11] Grune T. et.ai.. J. of Chromatogr., 553, 1991, 193-199
A2a A D E N O S I N E
R E C E P T O R IN G U I N E A P I G AND BOVINE LUNG
G. Senatore. G. Del Lucchese.C. Martini.A. Lucacchini
The methylxanthine theophylline is one of the mainstays of therapy in bronchial asthma. For many years it has been thought that the anti asthmatic effect of theophylline is due to an inhibition of phosphodiesterase with resultant accumulation of cyclic AMP. However, it has been repeatedly found that theophylline at therapeutic concentrations does only weakly inhibit phosphodiesterase. Methylxanthines are potent antagonist at adenosine receptors that have been divided into subtypes: A 1,A 2 and A 3. The A 2 receptors ,that activate adenylate cyclase, are further sub classified in relation to their affinity (high or low ) into A2a and A2b. Therefore we have attempted to characterize adenosine receptors in guinea pig and bovine lung by radioligand binding using 3H-CGS 21680, a specific agonist of A 2 receptors. Lungs diluted h l 0 w/v with 10 mM CaCI2 were homogenized and centrifuged at 1000g for 10 rain. at 4 ~ the supernatant was centrifuged at 48000 g for 30 rain. at 4 oC. The resulting pellet was suspended with i0 mM CaCt 2 and centrifuged at 48000 g. The pellet was suspended with adenosine deaminase 2U/ml and protease inhibitors in 10 mM CaCI 2 at 37~ for 30 min. and centrifuged at 48000 g. The pellet was suspended in 50 mM phosphate buffer pH 6.5 containing 10 mM CaCI2 at 4rag of protein/ml and used for binding assay. Binding of 3H-CGS 21680 to membranes was performed in a total volume of 500 gl containing 10 nM 3H-CGS 21680 for 90 rain. at 25~C in the presence of 50 nM cyclopentyladennsine. Separation of bound and free ligand was achieved by filtration through Whatman GF/C filters. Specific binding was defined as the difference between the amount of radiotigand bound in the absence and presence of 30 g/vl CGS 21680. 3H-CGS 21680 bound to membrane from guinea pig lung . Specific binding of 3H-CGS 21680 was saturable with increasing concentration of the radioligand. Non specific binding increased linearly with 3H-CGS 21680 concentration. The Scatchard plot of the data is linear indicating a homogeneous population of non interacting binding sites with a Kd of 17 nM and a binding capacity Bmax of 48 fmol/mg. Competition experiments were done in order to assess the pharmacological profile of 3H-CGS 21680 binding sites . CGS 21680 and NECA were the most potent agonists in competing for radioligand binding followed by R-PIA and theophylline. Similar results were obtained with membranes from bovine lung. Therefore our results show the presence of A2a in guinea pig and bovine lung. This work was supported by MIIRST (40%) lstituto Policattedra di Discipline Biologiche, Univcrsit:', degli Studi di Piss Via Bonanno 6 56100 P1SA (Italy)
t'h,m.m F Jlbdd &-N,r~..' Voh,,t,e 15 . . . . . . .
;
F25
NAD PRODUCTION IN NORMAL AND HPRT DEFICIENT FIBROBLASTS s.sestim, J.A.Dule~*, H.A. Simmonds* Most human cells and tissues are able to synthesise NAD from pyridine bases by the salvage pathway, although to a different extent. We have investigated the ability of fibroblasts of two healthy controls and one patient with HPRT deficiency to produce NAD from nicotinic add (NA) or nicotinamide (NAn'*), when added to a NAm- medium in concentratiom near the physiologicallevels, ARer 24 hours of culture in Ham's medium, cells were incubated for 20,
hours in EBSS in the presence of 5pM * ~ NA or NAm. The uptake of pyridine bases was about 7% (6.6% NA, 7.4% NAm), the major amount being detected in NAD; morn from NA (2.53 nmoles/mg protein) than from NAm (0.7I nmoles/mg protein). OnIy traces of intermediates (NAMN and NAAD) were d~ected from NA, while 5.5 umoles/mg protein of NMN were detected from NAm. No radioactive compounds, o~er than those initially added, were present in the supernatants. In the fibroblasts of the HPRT- patient, more NAD with respect to the controls was preseat (40% more from NA, 80% from NAm), probably due to high levels of endogenous PRPP present in HPRT- ceils. In the supeanatams of these fibroblasts, both radiolabded rice bases were present together. While Nam (6%) can derive from NA through lhe cleavage of the NAD formed, by polyADPR synth~qase or by NAD glycohydrolase, NA (8%) should come directly from NAm, but there is currently no evidence, for a human NAm deamidase. The incorporation of radiolabeUed precursors into the nucleofide pool of HPRT- patient fibroblasts has been checked also during various stages of their growth: at 0, 24, and 72 hours of culture, with the above method. Using NA, the highest amount of N A n was detected inside the cells after 24 hours of culture, while NAm appeared at 72 hours, probably due to N A n cleavage. From NAm, NAD was formed at the same extent at 0 and 24 hours, while no NAD but the highest content of NMN was produced inside the cells after 72 hours of culture.
Dipartimento di Biologia Molecolare, UniversitAdi Siena (Italy) *Purine Research Laboratory, Guy's Hospital, London (UK)
STRUCTURE-ACTIVITY OF
A.C.
w,c..
Siems
g, M_~Tk~h, ~.__E~_9.t_~__T~=_9_r?j.gn~
Skladanowsk~*, ~ W. M a k a r e w i c z
H o f f m a n n . J.D~ , B. J a s t o r f f
ISOZYMES
Krass,
Twenty one different purine nucleotide monophosqhates s e l e c t e d as a t e s t k i t for m o l e c u l a r i n t e r a c t i o n s were s c r e e n e d as p o t e n t i a l s u b s t r a t e s for N-I ( A M P - p r e f e r r i n g ) and N-It (IMP-preferring) isozymes 2 of cytosolic 5'-nucleotidase isolated from rabbit heart. C h e m i c a l m o d i f i c a t i o n c o n c e r n e d a l m o s t a l l p o s i t i o n s in substrata molecule. E l e v e n a n a l o g s of AMP, d e p h o s p h o r y l a t e d at t h e h i g h e s t rate, w e r e s e l e c t e d for the k i n e t i c e x p e r i m e n t s . M i c h a e l i s c o n s t a n t s for N - I and N-II i s o z y m e s v a r i e d f r o m 1.0 t o 15.0mMof s u b s t r a t e c o n c e n t r a t i o n a n d V a ~ v a l u e s w e r e in t h e r a n g e of 5 - 90 ~ m o l s x m l n i x m g prot. 1. I n h i b i t o r y e f f e c t s of v a r i o u s d e r i v a t i v e s on d e p h o s p h o r y l a t i o n of A M P b y A M P - p r e f e r r i n g c y t o s o l i c 5 ' - n u c l e o t i d a s e isolated from pigeon heart were quantified. 2',3'-isoprcpylideneadenosine was found to be a noncompetitive-type i n h i b i t o r of t h e last i s o z y m e a n d the potency of its action was comparable to that exerted by earlier described inhibitory adenosine analog - 5'-deoxy-5'-isobutylthioadenosine (IBTA) 3 . The results obtained a l l o w us r e q u i r e m e n t s f o r a s u b s t r a t a to i n t o a p r o d u c t by two d i f f e r e n t 5'-nucleotidase. (Grants: K B N 4
to propose structural be b o u n d a n d c o n v e r t e d i s c z y m e s of c y t o s o l i c 4034 9102, W-25)
1 B. J a s t o r f f e t a l . , I n M. B a l a b a n ted.), M o l e c u l a r M e c h a n i s m s of B i o l o g i c a l R e c o g n i t i o n , E l s e v i e r / N o r t h H o l l a n d , 1979, 107 2 V.L. T r u o n g , A.R. C o l l i n s o n & J.M. L o w e n s t e i n , B i o c h e m . J. 253 (1988) i17. 3 A.C. S k l a d a n o w s k i , G.B. Sala & A.C. Newby, B i o c h e m . J. 262 (1989) 2 0 3 . *Department ul. D e b i n k i
of B i o c h e m i s t r y , G d a n s k S c h o o l l, 8 0 - 2 1 1 G d a n s k , P o l a n d
of M e d i c i n e ,
D e p a r t m e n t of B i o l o g y / C h e m i s t r y , University L e o b e n e r Str., 2800 B r e m e n 33, F.R.G.
A D E N I N E NIICI,EOTTDE I.k~VEL8 AND LTpTn p ~ O X T D A T T O N AT H Y P O X [ A AND ]~t~XMGENATTON IN D I F W E W E N T CF.LL TypEN
Bnvin~ aortic endothelial c~llq nr j mary pi 0 braid endothelial eel I~, h u m a ~ k i d n e y c e i l s , h e p a t o e y + e ~ and smal [ J nteStiDe from starved rats ware nqod for comparative ~ p a r i m e n e s nn hypoxia a,d r a o x y t e n a t i n n . Hypoxia (up +o two bn~Irg) was iDtillCed w i t h S5% n i t r n f f ~ n / 5 % (~arhon d i o x i d e , raoxy~enat i0% was p e r f o r m e d with 95% nxyffen/5% carhnn dioxid~. !D all fiv~ m~ll ~ypms a rapid d ~ r e a m e of ATP ]mv~l d~ring h y p n ~ a was observed; b*l'l: i~he new s t e a m y ~at~. ievol n~ ATp as We~! aS "~h~ v a ~ n c i e y o f ~TP r e s e o r a t i n n wora d i f f e r e n t , The co) l*~lar ATP ]evols d e ~ r e a s e d ~nder hypnxic ~nnditioD~ to the fol Inwino n~w s t e a d y state cnnt~entra*inn~: ~hnut 10% nf ~he initial valuo in h e p a e o c y ~ e s q09~ ~ intestinal ~alts, 35% in k i d n e y calls. 40% iD a c t + i t e n d o t h e l i a l cells add t O 45% Of qho initial jn b r a ~ n o p d n ' ~ h e l i n l c~!Is. The r e c o v e r y of ~TP d u r i n g the r a o x y g e n a e i n ~ period wa~ fas~zer iD ~he f o l l o w i n g rang~: brain endn~be]Jal ce]!s > aortlc endothelial cells > kidn~.y ceils > in+es%i*lal e e l [ ~ > bepa%ncytes. [n FeZ i n t - e ~ t - i n e a l r a n d y after ona hour n f oxygen d e f i c i e n c y only a v e r y slow ATP r e s t ~ r a t i n , could b~ meamlred . In freshly pr~pa red h~pa%n~.y~ ee a comnle+e r e g e n e r a t i o n n f ATP was only p o s s i b l e if the d u r a e i n n of bypoxic period did ~o~ exceed 30 miD1;~s. W h e r e a q ~he d~.gr~ of ATP loss c n r ~ e l a t e s i n v e r s e l y to qh~ th~ v ~ I n c i t y nf ATP r e c o v e r y the ATP }aSs dONS nO# t~or~-eia~e t o t'he act~Hrnnl~t-ie~D of lipid p e r n x i d a ~ i n ~ p r n d u c ~ s such as MDA. In atl five cell types which w~re i n v e s t i g a t e d a frma radiea) %ndllc~.d lipid peroxidat ion d u r i n g the first mintlteS of pnsthvpnxic r e e x y ~ e n a t i n n was d~mnnslzrated. Prereq~liSitas f o r increasad p n s t h y p n x i e fre~. r a d i c a l f o r m a t i o n are the a c t t n ~ l l l a t i o ~ t~ic h y p n x a n t h i n e d~Iripg h y p n x i a and the pres~Dr.e of nxidas~ fo~-m o f xan#h Inenxi doredqc~zase. ]9 is sugoes%ed %ha% t-ha ATP r e c o v e r y depends re%her on t,eeaholie a d a p t a t i o n n f d i f f e r e n t cell types to hypoxi~ et~nd i tines tbab %O %he extent of pn~thypox~ c r a d i c a l forma§ and I ipid peroxida+i.no, Cml 1 c u l +ivntions in 9mn~ral soem tn be more r e s i s t a n t against ATP Inqq ~han freshly prepared cell s u s p e n s i n n q nr solid t i s s t t ~ q Hnder iI~ viva cOnt~i~intlS h~Catls~ Of SllCh a d a p t a t i o n p r n c o ~ e m in ATP-g~.nera~ i D a pa~zhways .
RELATIONSHIP FOR CYTOSOLIC HEART 5'-NUCLEOTIDASE
of
Bremen,
COMPARTMENTATION O F RIBONUCLEOTIDES IN PC-12 CELLS: FREE AND PROTEIN BOUND RIBONUCLEOTIDES R.J. SIineerland, J.M. Bodlaender, H. Van Lenthe, L. EIzinua. A.B.P. Van Kuilenburg, P.A. Vo6te, A.H. Van Gennip. Nucleotide imbalances are associated with transformation in rat pheochromocytoma (1) and in human leukemic cells (2,3). The imbalances in leukemic cells are caused by increased activities of 'key'-enzymes of the anabo[ic ribonucleotide pathways (2,4). In leukemic cells the adenine/guanine ribonucleotide ratio as well as the uracil/cytosine ribonucleotide ratio are different from that'observed in normal ceils (3,5). In contrast, in rat pheochromocytoma cells we observed only an uracil/cytosine total dbonucleotide imbalance. So far, different compartmentation of adenine and guanine ribonucleotides in PC-12 cells in comparison with normal cells has not been investigated. This implies that an imbalance between the free metabolic adenine and guanine dbonucleotide pools might still be present. Therefore, we measured the free ribonucleotide pools and ribonucleotide fractions bound to protein in exponential growing PC-12 cells. About 20 percent of the guanine fibonucleotide pools appeared to be bound to protein whereas about 4.5 percent of the adenine pool was bound to protein. The pydmidine ribonucleotide pools where not significantly compartmentalised. Experiments to reveal ribonucleotide compartments in these cells in comparison with normal cells are in progress. Knowledge of this compartmentation is necessary in order to study flaxes through the anabolic ribonucleotide pathways. I. 2. 3. 4. 5.
R.J. Slingerlandet al. Clin. Chem. and Enzymol. Commun. in press~ Y.M.T.Marijaenet al. 8iochim, Biophys. Acta, [012. (1989),148. D. De Korte et aL LeukemmRes. 10, (1986), 389. G. Weber. Cancer Res. 43, (I953), 3466. A.A. Van den Berg et aL Eur. J, Btochcm., submtttedfor publication.
*This study was supported by a grant from the Dutch Foundation f o r Pediatric Cancer Research S , K . K . no. 90-02. Academic Medical Center Amsterdam. Departments of Pediatrics aml Clinicul ChemlMry. Meibergdreef 9, 1105 AZ Amsterdam. The Netherlands.
Hprzn~ . r u l i u s H o s p i t a l f o r Rh~.umacnln~y and Orthopaedics, g H r h a q s S t r . 13-]7, W-3qAR Bad Harzhllr~ C~ermany and I~stit~l~ of Mnlee111ar P h a r m a c o l o g y ; ~nwalk~str. , O - t i n 6 B~r] i n, G e r m a n y
~26
IVmrm,J~y Ilbfld 0 S,ic..'
EVALUATION OF IMMUNOHISTOCHEMICAL STAINING AND ACTIVITY OF THYMIDYLATE SYNTHASE IN MURINE COLON TUMORS AND COLON TUMOR CELL LINES
DIr~J~NTIAL DIAGNOSIS OF GOUT
M.L. Sorqi, C. Rucci, C.P. Quaratino, A. Z o ~ i n i and A. Giacomello
K. Smid, C.L van der Wilt, G.W. Aherne 2, H.M. Pinedo 1, G.J. Peters. A high amount of thymidylate synthase (TS) in tumor tissue may be connected with resistance against anticancer drugs acting on TS, e.g. 5fluorouraci] (5FU). TS can be measured using several assays, e.g. the [6-3H] FdUMP ligand binding assay which determines the binding capacity of TS, while the tritium release assay, based on the conversion of [5-3H]-dUMP into dTMP and 3H20, determines the catalytic activity of TS. A polyclonal antibody which has been raised against human TS (ahTS) allows the detection of TS with immunohistochemical (IHC) staining methods and requires less cells or tissue than the enzyme assays. Correlation between the intensity of IHC staining and the other assays has already been observed in a series cell lines. The ahTS also recognized murine TS. We performed standard IHC staining (with horse-radish peroxidase and di-amino-benzidine) in cytospins of murine cell lines and murine tissue sections. Generally the staining was rather homogeneous, hardly showing any structure. The intensity of the staining was scored from low (+) to high ( + + + + ) . A panel of 3 murine colon tumor cell lines C38-2, C26-10 and C2610/F with an ascending catalytic activity 109, 7100 and 9503 pmol/hr/mg protein scored + + , + + + and + + + + , respectively. The murine colon tumor tissues Colon 38, Colon 26, Colon 26-10 and Colon 26-B with a [6-3H] FdUMP binding 54, 126, 90 and 103, scored +, + + , + and + + , respectively. Here only the [6-3H]-FdUMP binding assay seemed to correlate with the intensity of IHC staining. Overall, the intensity of the staining showed a correlation with one of the two enzyme assays in this range of enzyme activities. The IHC staining of cytospins of cell lines and frozen tissue sections enabled the qualitative evaluation of TS levels but for quantitative measurements of TS levels other assays may be more reliable. Dep. Oncology, Free University Hospital and ~Netherlands Cancer Institute, P.O. BOX 7057, 1007 MB Amsterdam, The Netherlands; 2Institute of Cancer Research Sutton, Surrey SM2 5NG, United Kingdom.
During the last 20 years 4755 patients (2045 males) were admitted to the Institute of Rheumatology of the University of Rome.The prevalence of gout in women was 0.04%. The most prevalent diseases affecting men were: Rheumatoid Arthritis (RA) (22.1%), Gout (G) (11.2%), Osteoarthritis (OA) (10.3%), Ankylosing Spondylitis (AS) (8.4%) and Psoriatic Arthritis (PA) (5.4%). About 1/3 of the gouty patients had Tophaceous Gout (YG). Gouty subjects were older and had a higher age at onset of the disease than patients with AS and PA. Body mass index (BMI) of patients with G, but not of those with TG, was higher than in other diseases but in OA. In gouty subjects the mean level of systolic pressure was higher than in other patients and diastolic pressure was higher than in AS. A diastolic pressure above 90 [~nHg and an history of cardiovascular diseases were more frequent in TG. Percentage distribution of a positive history for nephrolithiasis was higher in gouty patients. The number of radiological examinations performed on admission was higher in patients with AR and PA. In gouty patients ESR was lower than in subjects with RA, PA and AS. Serum uric acid was significantly higher in gout than in other diseases. In TG serum glucose levels were higher than in AS and in G and ~qG blood urea nitrogen was higher than in AS. Percentage distribution of positive tests for Rheumatoid Factor was higher in RA. The correlation matrix between considered variables will be discussed and a multivariate model for the differential diagnosis of gout will be presented.
Istituto di Reumatologia, Universit& "La Sapienza" di Roma e Cattedradi Patologia Clinica dell' Universit& di Chieti. Italy.
ADENINE PRODUCTION IN THE ISCHEMIC HEART A POSSIBLE ROLE OF METHYLTHIOADENOSINE PHOSPHORYLASE R.T.
Smolenski
W. Makarewicz
~.M. Zydowo, H.A. Simmonds
C o r o n a r y effluent of the heart subjected to ischemia and reperfusion c o n t a i n s s o m e a d e n i n e . In t h e r a t h e a r t c o r o n a r y effluent collected in the first 30 sec of reperf u s i o n a f t e r 25 min of n o r m o t h e r m i c ischemia, adenine reached concentration 0.86• ~M and a c c o u n t e d for 1.7• of all p u r i n e c a t a b o l i t e s (n=5, • Alt h o u g h a d e n i n e is not a p r o d u c t of p u r i n e n u c l e o s i d e p h o s p h o r y l a s e activity, there are its two other potential sources. T h e s e are the a c t i v i t y of m e t h y l t h i o a d e n o s i n e (MTA) phosphorylase and the S-adenosylhomocysteine (SAH) h y d r o l a s e p r o d u c i n g a d e n i n e by t h e b r e a k d o w n of t h e u n s t a b l e intermediate complex of this enzyme. SAH hydrolase a c t i v i t y was found to be p r e s e n t both in the h u m a n and rat m y o c a r d i u m but the data on the a c t i v i t y of MTA p h o s p h o r y l a s e in the heart are scarce. In this study the a c t i v i t y of M T A p h o s p h o r y l a s e in the rat h e a r t and in the human m y o c a r d i u m obtained during cardiac surgery was evaluated. In an assay system based on HPLC determination of s u b s t r a t e c o n v e r s i o n into product, f o l l o w i n g r e s u l t s (• have been obtained: MTA phosphorylase (nmol/min/g wet w) H ~ HEART RAT HEART
(n=5) (n=5)
OEOXYPYRIMIDINE NUCLEOSIDE SALVAGE HEASUREO IN LYHPHOCYTES AND IN NON OIVIOIN6 NACROPHAGES
39.0 • 12.4 •
Interestingly, MTA p h o s p h o r y l a s e w a s four t i m e s m o r e active in the human heart than in the rat heart. Although a d e n o s i n e is a poor substrate of MTA phosphorylase, some c o n v e r s i o n of this c o m p o u n d may occur, s p e c i a l l y at a v e r y h i g h a d e n o s i n e c o n c e n t r a t i o n in the h e a r t d u r i n g ischemia. MTA p h o s p h o r y l a s e a c t i v i t y is thus s u f f i c i e n t to a c c o u n t for adenine release from the heart, but the involvement of SAH-hydrolase still cannot be excluded.
Staub N.~ Sasv~ri-Sz@kely H., Spasokukockaja T. and Hrab~k A. The well balanced, strictly regulated nucleotide supply of cells is a very important requirement of cell division. In higher organisms the concentration of the nucleotides are constant in the blood and must be coordinated by the uptake and excretion of nucleotides. This balance seems to be ensured by different tissues, first of all by lymphoid and polymorphonuclear cells and by the brain. In this cells the salvage is preferential to the de novo synthesis. Earlier works in our laboratory have shown(l-5) that salvage of deoxycytidine (CdR) did not correlate either with the incorporation of deoxythymidine (TdR) or with the replication of ONA. Extracellular CdR but not TdR was shown to be salvaged into phospholipid precursors of human lymphocytes and lymphoma cells, beside its incorporation into ONA. Recently, deoxynucleoside salvage of non-dividing macrophages was investigated. CdR and TdR was salvaged mainly into the nucleotide pools. Chlorpromazine ~hifted the CdR salvage into a lipidic compound, identified as H-dCDP-diacylglycerol (dCOP-OAG). The ratio of labeled lipids to labeled ONA was eleven times higher in macrophages than in lymphocytes. The new anti-leukemic drug, 2'-Chloro-deoxyadenosine (CdA) enhanced the uptake and phosphorylation of both deoxypyrimidines while it inhibited their incorporation into DNA. This inhibitory effect could be prevented by CdR and not by TdR. The mechanism of the protection by CdR is not known. The salvage pathways of the deoxypyrimidine nucleosides have a great in~oortance in tumor chemotherapy and also in the treatment of chronic inflammation. i 2 3
Purine Research Laboratory, Guy's Hospital, London, U.K., D e p a r t m e n t of Biochemistry, University Medical School of Gdansk, Poland
T. Spasokukotskaja, G. Spirou and N. Staub (1988) Biochem. Biophys. Res. Commun. 155, 923-927 H. SasvSri-Sz@kely et al. (1989) 8iochim. Biophys. Res. Commun. 163, I158-I167 T. Spasokukotskaja, H. SasvQri-Sz@kely, J. Tal3anidzsz and M. Staub (1992) FEBS Letters 297, 151-i54 ist Inst. of Biochem., Semmelweis Medical Univ. H-iA&4 Budapest 8, POBox 260, Hungary
I'lmtm,l~ y I 1 "L~rhl t . . % ~cm c V. . . . . . . ~5 . . . .
993
F27
A FIPLCMETHODTO MEASUREPURINEENZYMEACTIVITIES IN RHEUMATOIDARTHRITIS
AOENOSINE PHOSPHORYLASE" OF THE ADULT FORM OF-PASCIOLA HEPATICA
J.N. STOLK ', R.A. De ABREU:, D.G.M. DE KONING:, LH.M. LAMBOOY2,
H. Trembacz t
PJ.$.M. KERSTENS~,A.M.Th.BOERBOOMS i L.B.A. vandePtrI'IE L Background: Patients with Rheumatoid At'thrifts(P.A) m y react very different to treatment with azathioptine (AZA) which is metabolised by purine enzymes. Patients with RA have different levelsof a .umb~" of purineenzymescomparedto healthycontrols(1,3).It is known that abnotmalitins in levels of purine enzymes may influence the outcome of AZA uentment (LcschNyhan syndrome, HGPRTdeficiency)and are also related to SOmedlseasr of the immune-system (SCID syndrome. ADA deficiency;T-lymphocytemalfunction.PNP deficiency). Recently we inesented data of a pilot study on purine enzyme activities in relatinn co AZA U'eatmeotin patients with RA compared with healthycontrols.The complete procedure for isolating pufine enzymes from blood-cells to the determination of their specific enzyme activity has been published elsewhere (2). In summary RA patients had a significantlylower levelof 5"-nacleotidase (SNT) in comparison with healthy controls and higher levels of purine onclensidepbospborylase 0PNP). Better response to AZA was associated with higher levels of 5NT add PNP O). In our opinion these results justify further investigationsespeciallyof a longitudinalstudy.
The adenosine phosphorylase (AdoPho) activity present is parasitic trematode Schistosoma mansoni ~ but absent in vertebrates being the parasites final hosts could be a convenient chemotherapeutic target. The sensitivity of AdoPho in the S. mansoni crude extract to several inhibitors differs from this of inosine phosphorylase (InoPho) from various sources and is not identical with that of the specific AdoPho from gastropod H:. P omatia~.
Conclusion: This new I-IPLC procedure is reliable and the staodmd deviationof measurements ca.,tied out i, triplicate or in quad~plicate is significandyless compared to our previous method. Furthermore it complies better with current requirements concerning laboratotV investigation proredures and eavironmentulprotection.This method will be used in our .ew studies.
we found the AdoPho activity in the F. hepatica adult form and in larval forms
I.
1
Method: A careful reviewof the laboratory lx'ocedurerevealed three major disadvantages.First we
found that the enzyme isolatesof PNP and 5NT stored at -20"C were not as stable ~.s we wanted over a period of at least 4 weeks. Second from environmentalpollution and radiation hygienic viewpoint a radiocbemical ~say is less preferable nowadays. And at last the fact that this labomory procedure is very lime-consuming. To rule out these disadvantages a HPLC method with ultra violet detection of substrate and products was developed for a longitudinal end other new studies. Aftex preparation of the lyophifizedlympbocytes(2) (1.500 ceils per Eppendofftube for the pNP-aasay and 18,000 cells for the 5NT assay) the incubation with substrate takes place respectively during 1 hour in the PNPassay and 3 hotws in the 5NT.aasay. Immediatolyafterwards the incubation is stopped by a 0.8 M solution of perchlorie acid (PCA). Alter cenedfugalio, the supematant is neutmlised with 0.2 M K2HPOA. Stored at -20~ this solutionremains stable for a period of at least 4 weeks. To separate the substrate and product(s) a HPLC column (C18: reversed phase method) is used. At the stu.'ling point the buffer consists of 2% of a solutioncontaining0.05 M KHePO4and CH~OH(3:hv/v) and 98% of 0.025 M KHpt~O4.Near the endpoint of separation at 25 minutes the proportions have changed to respectively20% and 80%, The flow.rate is 1.25 ml/min.
AppelboomTh. Mandelbaum I. Vertonge, F. Purine enzyme levels in rheumatoidarthritis. J Rheum 1985;12:1075-1078. van LaathovenJ.P.R.M., SpierenburgG.T.. de Bmyn C.H.M.M. Enzymoingicalanalysisof putl,e metabolismin lymphoidcells. J lmmunolMeth 1980:39:47-58. KerstensP. Boerbooms A. Lamlx)oyL. et al. Associationot" ptwineenzyme levelsa,d response to azathioprinein rheumatoid arthritis. ArthritisRheum 1992;35(Suppl):S200.
2. 3.
2
CHANGES (ADA)
IN AND
PURINE
ACTIVITY
P.
ERYTHROCYTE NUCLEOTID
DURING
Sz~ts
*
erythrocyte
ADA
in
for
one
this
two
play
impaired
50
%
in
by
the
both
critical rapid
but
remained
Authors
suggest
enzynes
strong
role
severe
pronounced
hypoxia.
of
purine
immunregulatory
the
immunological
in
of
in
a
important
having
can
the
and
provoked
thereafter,
after
very
during
Activity
showed
minutes
hour
metabolism, effect
and
15
Abrahgm.
ps
pathomechanism state
of
of
hypoxic
newborns.
Dept.
of
University H
6701
and
Pediatrics, Medical
P.O.B.
471,
Clinical Erzsabet
H-6800,
F28
Albert School, *:
Laboratory "
Town
present
Szent-Gydrgyi Szeged, adress:
Dept., Hospital,
H6dmez6vAsarhely,
Hungary,
Dr
Imre
J.
u.
Random urine ,samples from 614 neonates were ,screened for metabolites of purinc and pyrimidine metabolism using a slightly adapted column chromatographic method previously described in the literature (1). Two categories of neonates were investigated. Group A was formed by 510 neonates, who had a birthweight above 2800 g and were born at~er an uneventful pregnancy and delivery. Group B comprised 104 prematures and/or dysmatures who w~re admitted to the neonatal intensive care unit. In both groups only a limited number of metabolites, namely pseuOouridine, uric acid and 7-methylguanine, appeared in the chromatogram. The peaks of xanthine and hypoxanthine was much lower or even absent. With this method only very high concentrations of orotic acid and orotidine appeared as an isolated peak. The pattern was not influenced by the type of feeding or t.V. nutrition. Metabolites from different medications were identified in group B. An as yet unidentified peak with a retention time of 8.5 rain. and a max. U.V. absorption at 249 rim, was t~,served in many chromatograms, especially in group B (33% as compared to 2.3% in group A). Its molecular weight is 109. We will attempt further identification in the future. The median and 97 th centile value of pseudouridine excretion is identic-,d in both groups. A highly significant linear correlation was found between pseudouridine and creatinine. We will investigate the value of urinary pseudouridine as an indicator of glomerular filtration in another study. The median and 97 th centile values uf uric acid were lower in group B than in group A (p<0.005). In agreement with the literature (2), the excretion ratio of uric acid and creatinine (mmollmmol) was extremely high in both populations (21. No inborn errors of purine and pyrimidine metabolites were fuund. One female patient with an increased excretion of uracil was shown to be heterozygous for OCT-deficiency. The method used in this study is .sensitive enough tot detect inborn errors of purine and pyrimidine metabolism. Screening on a larger scale is necessary to determine the prevalence of these disorders in a neonatal population. 1. G.S. Morris, H.A. Simmonds, P.M. Davies. Biomed. Chromat. 1 (1986) 109-118 2. J.S. Cameron, F. Moro, H.A. Simmonds. Pediatr. Nephrol. 7 (19i:)3)105-t 18
Pediatric
Hddmez6vgsgrhely
Hungary
SCREENING OF URINARY PURINE AND PYRIMIDINE METABOLITES IN THE NEONATE. K.J. Van Acker. F.J. Evskenx. R.H. Verk~:rk. S.S. Schar~_"
decrease
activity
newborn
about
hypoxia
increase
that
PNP
of
decreased of
(PNP)
PIGLETS
marked
pneumothorax.
enzymes
low
Cs.
a
and
state
artificial
NEWBORN
Havass*
observed
hypoxaemic
point
IN
Szirovicza. Z.
DEAMINASE
PHOSPHORYLASE
HYPOXIA
s
Authors
ADENOSINE
Miech R. P., Senf A. W. and Senf D. G. (i775) Biochem. Pharmac. 24, 407 - ~11. TrembaczH. and Jezewska M. M, (1993) Comp. Biochem. P h y s i o l . , part B, in press.
Dept. of Comparative Biochemistry, I n s t . Biochem. Biophys., Polish Academy of Sciences, 02-532 Warszawa, 36 Rakowiecka S t . , Poland.
Depts. of Rheumatology~ and Paediatrics (Laboratory of Purine and Pyrimidine metabolism)*'. UniversityHospitalNijmegen.Postbox 9101. 6500 HB Nijmege,, The Netherlands.
"
M. M. 3ezewska
2.
Dept. of Pediatrics, University Hospital of Antwerp and Lab. of Clinical Biochemistry, Faculty of Medicine, Antwerp, Belgium.
l,h,,.,,,,, y 11',,hi ~ S.c.."
IMMUNOLOCALIZAT1ON OF AMP-DEAMINASE ISOZYMES 1N HUMAN SKELETAL MUSCLE IN V1VO AND IN VITRO. CONCENTRATION
OF ISOFORM M AT NEUROMUSCULAR
REGULATION OF DEOXYCYTIDINE KINASE (dCK) BY CTP AND UTP
JUNCTIONS
G. Veerman, V.W.T. Ruiz van Haperen. J.B. Vermorken. G..I. Peters T . H van KuppeveltL J.H. Veerkamp'. R,L. Sabina2 AMP-deaminase (EC 3.5.4.6.) catalyzes the deamination of AMP to IMP and ammonia. In humans, three isozymes are present, the M (muscle), the El (erythrocyte), and the L (liver) isoform. Polyclonal rabbit antisera raised against these isoforms were used for their immunolocalization. Human diafragm and quadriceps muscle, and cultured muscle cells were used. Cryosectlons and cell cultures were incubated with isofbrm-specific rabbit antiserum and indirect immunofiuorescence was performed using fluorescein (FITC)-labeled goat anti-rabbit IgG antibodies. Neuromuscular junctions were visualized using tetramethylrodamine (TRITC)labeled ct-bungarotoxin. Type II fibers were identified'with a monoclonal antibody against fast myosin. The M-isofurm is mainly located in muscle cells, with a predominance for type II fibers, and shows a clear cross-striation. A particularly strong staining was present at the neuromuscular junction. Capillaries were also immunoreactive. The L-isoform is predominantly observed in nerve bundles and to a minor extent in smooth muscle ceils and endothelial cells. The Erisoform is present in muscle fibers, with a predominance for type I cells; smooth muscle cells and nerve bundles are also immunoreactive. In quadriceps muscle of four patients with primary myoadenylate deaminase deficiency, no immunostaining for the Misozyme is observed, while the reactivity for the L- and Erisoform is unaltered. In human muscle cell culture, mononuclear cells (myoblasts) are immunoreactive for the L-isoform and to a lesser extent the E,-isoform, while only a faint reaction is observed for the M-isoform. In myotubes, a diffuse or fibrillar staining is present for all three isoforms; only the M-isoform, however, shows a clear cross-striation pattern in highly differentiated myotubes. :Dept. of Biochemistry, University of Nijmegen, P.O.Box 9101, 6500 HB Nijmegen, The Netherlands and :Dept. of Biochemistry, Medical College of Wisconsin, Milwaukee, WI, USA.
Deoxycytidine kinase (dCK) activates several anticancer drugs such as the deoxycytidine analogues Gemcitabine (dFdC), arabinofuranosyl-cytosine and that of the purine nucleoside 2-chlorodeoxyadenosine. dCK is a key enzyme in the pyrimidine salvage, catalyzing rate limiting phosphorylation of deoxycytidine to the monophosphate dCMP. Phosphorylation of dFdC yields dFdCMP and subsequently dFdCTP which can be incorporated into DNA. dFdCTP accumulation in A2780 (a human ovarian carcinoma cell line), WiDr (a human colon cell line) and C26-10 (a murine colon cell line), was associated with major changes in the normal nucleotide pools, predominantly changes in CTP and UTP pools. Since UTP and CTP are known to regulate dCK we studied enzyme kinetics of deoxycytidine, the natural substrate for dCK, in these three cell lines. A substrate concentration of I0 mM ATP with 1 mM UTP or CTP as modulators was used. To exclude the possibility of interference of Thymidine kinase, we included thymidine in the assay, to prevent Thymidine kinase from phosphorylating deoxycytidine. The same activity for dCK was observed with and without thymidine. So, Thymidine kinase was not disturbing the experiments. In all three cell lines biphasic kinetics for deoxycytidine were observed with high and low Km values of 10.6 and 1.2 for A2780, 14.2 and 1.5 for C26-10 and 13.0 and 1.5/~M for WiDr. In the presence of UTP with respect to high Km value a non competitive inhibition was observed in A2780, with respect to the low Km value, however, a competitive inhibition. In the C2610 cell line with respect to both Km values an activation was found and in WiDr a non competitive inhibition. In C26-10 CTP induced a competitive inhibition for deoxycytidine and in WiDr an activation. In A2780, however, no bipbasic but monophasic kinetics was found. So, the effect of adding UTP or CTP differs from cell line to cell line. In conclusion, Thymidine does not affect the Km and Vmax values for deoxycytidine of deoxycytidine kinase in these cell lines, while UTP and CTP can influence the enzyme kinetics of deoxycytidine kinase by either stimulating or inhibiting the enzyme. Department of Oncology, Free University Hospital, PO Box 7057, 1007 MB, Amsterdam, The Netherlands.
ENHANCEMENT OF THE ANTITUMOR ACTIVITY OF 5-FLUORO2'-DEOXYURIDINE AND CIS-PLATINUM BY N-(PHOSPHONACETYL)L-ASPARTATE IN THE MURINE COLON 26 CARCINOMA. Van Laar J.A.M.. Mayhew E., Durrani F.A., Peters, G.J., Ru~tumY.M. N-(phosphonacctyl)-L-aspartate (PALA) can potentiate the antitumor activity of fluoropyrimidines by blocking the biosynthesis of pyrimidine nucteotides, resulting in a prolonged TS inhibition of thymidylate synthase (TS) and increased incorporation into RNA. Cisplatin (CDD.P) is a DNA cross linking anticancer agent, which is also known to interact with TS. In combination with fiuoropyrimidines, CDDP is used for the treatment of patients with head and neck cancer. We have evaluated the antitumor activity of CDDP and/or 5-Fluoro-2'-deoxyuridine (FdUrd) 4- PALA and the nucleotide triphosphate levels after PALA in a tumor model using the routine Colon 26 carcinoma. PALA was used at an inactive dose of 100 mg/kg, 24 hr before treatment. Combination therapy of CDDP with 200 mg/kg FdUrd was carried out at the optimal schedule for both CDDP and FdUrd. Therapy FdUrd PALA-FdUrd FdUrd-CDDP PALA-FdUrd-CDDP
dose (mg/kg) 200 200 200-2.5 200-2.5
TD (days) 19.1 5:2.0 30.4 5:1.7 24.0 + 2.4 37.5 + 3.2
CR (%)
TIC
0.20 0.06 0.12 0.04
5:0.03 -4- 0.01 5:0.02 5:0.01
4 29 25 70
Cytidine triphosphate (CTP) and uridine triphosphate (UTP) levels decreased within 8 hours after PALA treatment to 10 % and remained low the following five days. CDDP alone at the highest dose (9 mgtkg) produced marginal antitumor activity. Pretreatment with PALA increased the tumor doubling time (TD) about three fold; 9.8 without compared to 25.9 days with PALA. The TIC (tumor volumes of the treated group over the untreated) were also significantly improved (0.21 to 0.08). Addition of an inactive dose of CDDP (2.5 mg/kg) to FdUrd (200 mg/kg) increased antitumor activity. PALA before FdUrd +_ CDDP improved long term effects (complete regressions, CR) in favor of the CDDP containing schedule (see table). It can be concluded that a nontoxic dose of PALA can improve antitumor activity of CDDP + FdUrd. The mechanisms might be associated with the low CTP and UTP levels affecting DNA repair of the DNA damage caused by CDDP. These observations might have clinical implications on the use of fluoropyrimidines and CDDP in combination therapy. Dept. of Oncology, Free University Hospital, PO Box 7057. 1007 MB Amsterdam, The Netherlands. Grace Cancer Drug Centre. Roswell Park Cancer Institute, Buffalo, NY, 14362, USA
MECHANISM OF RIBOSE 1-P DEPENDENT A D P FORMATION. Note 1 J.Z. Wang*, R. Leoncini, D. Vannoni, E. Marinello, R. Pagani From our previous studies t it is quite clear that the formation of ADP and ATP in rat liver extracts is, under our conditions, a ribose 1-P (R1-P) dependent reaction, but the biochemical mechanism of such reaction is still unknown. The main problem is if R1-P transfer directly its phosphorus to AMP thus forming ADP. With the intention to clarify this problem, a careful investigation was carried out and part of the results is reported as follows: RI-~2P was synthesized by Camici's method 2 with a slight modification. 0.1 mCi ~2p was used in an assay mixture with a final volume of 1.0 ml. The formation of R1-P was followed by measuring the appearance of uric acid at 293 nm. The addition of catalase did not affect the formation of R1-P. Synthetised labeled R1-P was stable during lyophilization and storage in 4~ or frost overnight. It was completely hydrolized after boiling 10 rain. in 0.1N HC1, while it was stable by boiling 5 rain. in 50 mM Tris-HC1 (pH 7.5) buffer solution. A careful study was carried out for the separation of R1-P from free phosphorus. The best result was obtained by using a Dowex 1X8 resin and eluting with 0.1 M NH4F/FA pH 4.0 buffer. The recovery of R I - P after chromatography was about 70%. 20 btCi RI-~2P synthesized was added to the assay mixture which was composed as previously reportedL The partially purified enzyme from rat liver supematant had an activity of 420 umol/mg prot/h. There was no formation of radioactive ADP after incubation RI-~2P or J2p with AMP and enzyme. The same amount of radioactive R1-P was recovered both at 0 min and 60 rain after chromatography. Combining our other results obtained by kinetic studies (in which a typical allosteric regulation of R I - P was observed), we conclude that R1-P does not directly participate in the transfer of phosphorus but acts as an allosteric effector of the enzyme activity. Further studies are necessary to understand the original donor of phosphorus in the formation of ADP. I R. Leoncini et al..It. J. Biochcm., 41/5 (1992) 331A 2 M. Camici et al. Anal. Biochcm., 166 (I987) 253 * Biochemistry Dept., Tongji Medical University, Wuhan, Hubei, 430030 - P.R. China Istituto di Biochimica e di Enzimologia - Universith di Siena, Italy
Pharma~I' 11'odd& S, w.~ c vo,.,.o ,s ~,., ,99~
F29
MECHANISM OF RIBOSE 1-P DEPENDENT ADP FORMATION. Note 2 J.Z. Wang*, D. Vannoni, R. Leoncini, E. Marinello, R. Pagani Since several years, the Authors of the abstract have been working on a research program involved in the ribose 1-P (R1-P) dependent enzyme activity in rat liver L2. One main problem is the variations of the enzyme which has seriously hindered the progress of the research. Therefore, we have studied recently the most important characteristics of the enzyme. Our main results are the following: the enzyme with a specific activity of 420 U (1U=I nmol/mg prot/h) was a partially purified fraction from rat liver supematant as previously reported 3. It was stable for 146 h daring the storage at 4~ and dilution of protein till 0.5 mg/ral did not affect the stability. The effect of various ions at different concentrations (0.08 raM, 0.8 raM, 8 raM) was investigated. The results showed that dithiothreitol, K§ Na§ involved neither stimulation nor inhibition of the enzyme activity within the range of investigated concentrations, while Mg~, Fe+*, Zn++ and Ca~" inhibited the activity especially at the highest concentrations. Chelate EDTA activated slightly the enzyme activity at 0.08 raM, but strongly interfered and inhibited the reaction at higher concentrations. Kinetic studies showed that the R1-P, within concentrations ranging from 0.2raM to 4.0 raM, was an aUosteric stimulator of the enzyme (Kcat=88.8 nl~olfh, K=7.4 raM, Hill coefficient=2.1), while AMP as substrate, in which concentration ranged from 0.5 mM to 4.0 mM, followed Michaelis Memen mechanism (K~=109.9 nmol/h, K~=l.8 raM). Higher concentration (> 4 raM) of AMP inhibited the activity. All results are good reference in our further study of the enzyme, such as purification and mechanism of action. 1 D.Vannoni et al. Communication XXXVI National Congress SIB, 10-13 september 1991 - Ferrara 2 D.Vannoni et al. Biochem. Soc. Transactions, 20 (1992) 382S 3 R.Leoncini et al. It. J. Biochem., 41/5 (1992) 331A * Biochemistry Dept., Tongji Medical University, Wuhan, Hubei, 430030 - P.R. China Istituto di Biochimica e di Enzimologia - Universith di Siena, Italy
F30
Iqlam.l~), Ili.ld ,b ::,.c.."