Lipids (2015) 50:483–492 DOI 10.1007/s11745-015-4010-3

ORIGINAL ARTICLE

Alteration of Wax Ester Content and Composition in Euglena gracilis with Gene Silencing of 3‑ketoacyl‑CoA Thiolase Isozymes Masami Nakazawa1,2 · Hiroko Andoh1 · Keiichiro Koyama1 · Yomi Watanabe3 · Takeo Nakai3 · Mitsuhiro Ueda1 · Tatsuji Sakamoto1 · Hiroshi Inui1 · Yoshihisa Nakano1 · Kazutaka Miyatake1 

Received: 5 November 2014 / Accepted: 3 March 2015 / Published online: 10 April 2015 © AOCS 2015

Abstract  Euglena gracilis produces wax ester under hypoxic and anaerobic culture conditions with a net synthesis of ATP. In wax ester fermentation, fatty acids are synthesized by reversing beta-oxidation in mitochondria. A major species of wax ester produced by E. gracilis is myristyl myristate (14:0-14:0Alc). Because of its shorter carbon chain length with saturated compounds, biodiesel produced from E. gracilis wax ester may have good cold flow properties with high oxidative stability. We reasoned that a slight metabolic modification would enable E. gracilis to produce a biofuel of ideal composition. In order to produce wax ester with shorter acyl chain length, we focused on isozymes of the enzyme 3-ketoacyl-CoA thiolase (KAT), a condensing enzyme of the mitochondrial fatty acid synthesis pathway in E. gracilis. We performed a gene silencing study of KAT isozymes in E. gracilis. Six KAT isozymes were identified in the E. gracilis EST database, and silencing any three of them (EgKAT1-3) altered the wax ester amount and composition. In particular, silencing EgKAT1 induced a significant compositional shift to shorter carbon chain lengths in wax ester. A model fuel mixture inferred from the composition of wax ester in EgKAT1-silenced cells showed a significant decrease in melting point compared to that of the control cells.

* Masami Nakazawa [email protected]‑u.ac.jp 1

Department of Applied Biological Chemistry, Osaka Prefecture University, Osaka 599‑8531, Japan

2

PRESTO, Japan Science and Technology Agency (JST), Saitama 332‑0012, Japan

3

Osaka Municipal Technical Research Institute, Osaka 536‑8553, Japan



Keywords  Euglena gracilis · Wax ester fermentation · 3-Ketoacyl-CoA thiolase · Mitochondrial fatty acid synthesis · Acyl chain length modification · Algal lipids Abbreviations CoA Coenzyme A DSC Differential scanning calorimetry EST Expressed sequence tag FA Fatty acid FAlc Fatty alcohol FAME Fatty acid methyl ester FAS II Type-2 fatty acid synthase KAT 3-Ketoacyl-CoA thiolase RT Reverse transcription TAG Triacylglycerol

Introduction Algal biofuel is thought to be an attractive alternative to fossil fuel. Many microalgae accumulate triacylglycerols (TAGs) under photooxidative stress or other adverse environmental conditions (e.g., nitrogen starvation) [1]. Similar to plants, most microalgae synthesize fatty acids, building blocks of TAGs, in the chloroplast. This pathway consists of ATP-dependent acetyl-coenzyme A (CoA) carboxylase, which produces malonyl-CoA, and type-2 fatty acid synthase (FAS II) [2–4]. The most common fatty acids in microalgal TAG are 16- and 18-carbon fatty acids with saturated and unsaturated chains [1], the same as in plant TAG. Transesterifying TAG with alcohols results in biodiesel, which consists of the corresponding alkyl esters. There are two major technical performance problems with the use and commercialization of biodiesel: the high melting

13

484

point and poor oxidative stability [5] because of the chemical properties of fatty ester. Saturated compounds in biodiesel have higher melting points than unsaturated fatty compounds with the same acyl chain length. The melting point of fatty acid alkyl esters also increases with increasing acyl chain length. Microalgal and plant oils contain significant amounts of saturated long-chain fatty acids in addition to unsaturated long-chain fatty acids. Thus, biodiesel made from these oils has a high melting point, leading to clogged fuel lines, filters, pumps and injectors [6]. Introduction of unsaturated bonds to fatty acid esters is an efficient way to improve cold flow properties, but it decreases fuel oxidative stability. Shorter saturated fatty acid esters below C12 are a good solution for a biofuel that can overcome both cold flow and oxidative stability problems [5]. Euglena gracilis, a unicellular microalga, produces wax esters using the storage polysaccharide paramylon under anaerobic and hypoxic conditions [7]. Wax esters produced by E. gracilis in the range of 23–33 carbons consist of individual saturated fatty acid and alcohol chains ranging from 10 to 18 carbons. The major species of these is myristyl myristate (14:0-14:0Alc) [8]. Because of its shorter carbon chain length, biodiesel produced from E. gracilis wax ester may have better cold flow properties with higher oxidative stability than that produced from plant and other microalgal TAGs. Alkyl esters of capric acid (10:0) and lauric acid (12:0) are ideal for their combustion properties, cold flow properties and oxidative stability. We reasoned that a slight metabolic modification would enable E. gracilis to produce a biofuel of ideal composition. In the wax ester fermentation, fatty acids are synthesized in the mitochondria of E. gracilis using acetyl-CoA, not malonyl-CoA, as C2 donors by a reversal of beta-oxidation [9]. Acyl-CoA produced in mitochondria is exported to the endoplasmic reticulum and then converted to fatty alcohol by fatty acyl-CoA reductase. Fatty alcohol and acyl-CoA are esterified by wax synthase to produce wax ester [10]. In order to produce wax ester with shorter acyl chain length, we focused on the enzyme 3-ketoacyl-CoA thiolase (KAT; EC 2.3.1.9 and 2.3.1.16) [11], a condensing enzyme in the mitochondrial fatty acid synthesis in E. gracilis. KAT isozymes have different substrate chain-length specificities, catalytic efficiencies and cellular locations, and we speculate that metabolic regulation of each KAT isozyme has the potential to produce fatty acids with any desired chain length. In this article, we performed a gene silencing study on KAT isozymes in E. gracilis. Six isozymes were identified in the E. gracilis EST database, and three of them controlled the amount or composition of wax ester.

13

Lipids (2015) 50:483–492

Materials and Methods Organism and Culture Euglena gracilis SM-ZK, achloroplast mutant strain [12], was cultured in Koren-Hutner medium [13] with aeration at 27 °C for 4 days to the late logarithmic phase of growth. Hypoxic cells were prepared by transferring an aliquot of 1.5-ml aerobic culture into a 1.5-ml plastic tube, which was then tightly capped and allowed to stand without agitation at 27 °C for 48 h. The cell number was counted using the CDA-1000 particle analyzer (Sysmex, Japan). Cell viability was evaluated by propidium iodide staining [14]. Specifically, a 100-μl aliquot of the cell culture was mixed with 0.5  μl of propium iodide solution (1.0 mg/ml, Life Technologies) and incubated at room temperature for 15 min. Then dead cells were stained and visualized with a fluorescent microscope (BZ-9000, Keyence) with a TRITC filter set. Viability (%) was calculated as follows: (total cell number − stained cell number) × 100/total cell number. Cloning of Full Length cDNA Encoding E. gracilis 3‑ketoacyl‑CoA Thiolase We used tblastn to search the TBestDB Euglena expressed sequence tag (EST) database [15] (http://tbestdb.bcm. umontreal.ca/) for genes encoding E. gracilis 3-ketoacyl-CoA thiolase (EgKAT). Total RNA was extracted from E. gracilis according to the method in Nakazawa et al. [16] and reverse transcribed with SuperScript III reverse transcriptase (Life Technologies) with the GeneRACER(dT)24primer (Table 1). To obtain the nucleotide sequences of unknown regions of EgKAT4, 5 and 6, gene-specific primers were designed (Table 1). Nucleotide fragments containing the 5′ end of the cDNA were amplified with a forward primer SL-Fw encoding a spliced leader sequence common to the vast majority of cytoplasmic mRNAs in E. gracilis [17] (designated as SL Fw in Table 1) and gene-specific reverse primers (EgKAT4-374Fw, EgKAT5-10Fw, EgKAT6-22Fw, respectively). Nucleotide fragments containing the 3′end of the cDNA were amplified with a gene-specific forward primer (EgKAT4-1147Rv) and the GeneRACER 3′primer (Life Technologies). PCR amplification was carried out using Phusion High-Fidelity DNA Polymerase (Thermo Scientific). Amplified cDNA fragments were cloned into a pCR2.1 vector using the TOPO TA cloning kit (Life Technologies) after adding 3′ A-overhangs and sequenced. Multiple sequence alignments were constructed using the ClustalW program on DDBJ (http://clustalw.ddbj.nig.ac.jp/).

Lipids (2015) 50:483–492

485

Table 1  Oligonucleotide primers used in this study Primer name

Target cDNA

Experiment

Oligonucleotide

EgKAT1-17Fw EgKAT1-598Rv EgKAT2-19Fw EgKAT2-647Rv EgKAT3-423Fw EgKAT3-783Rv EgKAT4-374Fw

EgKAT1 EgKAT1 EgKAT2 EgKAT2 EgKAT3 EgKAT3 EgKAT4

Semi-qRT-PCR Semi-qRT-PCR Semi-qRT-PCR Semi-qRT-PCR Semi-qRT-PCR Semi-qRT-PCR Semi-qRT-PCR and 3′-cloning

ATGCTTGGCCGTAAAGTTGCG CTCATCCATCTCCTCACGGGA ATGAAGGGAATGCGGAAGGTTG GATTTAGTGACTCGTTCAACGT CTGCTATGACGCCCTCACTC AGTCACACTCCCCACCTTTG CATATGTCTTGCCCACTGTA

EgKAT4-1147Rv

EgKAT4

Semi-qRT-PCR and 5′-cloning

GTAATGTGACCAGGATACGG

EgKAT5-297Fw EgKAT5-534Rv EgKAT6-22Fw

EgKAT5 EgKAT5 EgKAT6

Semi-qRT-PCR Semi-qRT-PCR Semi-qRT-PCR 3′-cloning

CTACCCTGAAACCACCTCCA GACGTTCTCCGACGTGATG TCACAATGCTCAACCGAGT

EgKAT6-437Rv EgAtub-853Fw EgAtub-1267Rv T7EgKAT1-114Fw T7EgKAT1-567Rv T7EgKAT2-562Fw T7EgKAT2-971Rv T7EgKAT3-152Fw T7EgKAT3-501Rv T7EgKAT4-668Fw T7EgKAT4-1029Rv T7EgKAT5-79Fw T7EgKAT5-557Rv T7EgKAT6-293Fw T7EgKAT6-651Rv EgKAT5-10Fw

EgKAT6 Alpha tubulin Alpha tubulin EgKAT1 EgKAT1 EgKAT2 EgKAT2 EgKAT3 EgKAT3 EgKAT4 EgKAT4 EgKAT5 EgKAT5 EgKAT6 EgKAT6 EgKAT5

Semi-qRT-PCR Normalizer Normalizer RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi

CTTGTTGTTCATCCGGTATC AGAAGGCGTACCATGAACAGC TCACCTTCCTCCATACCCTCT CTAATACGACTCACTATAGGGAGATTCCTAGCGTCAACAGCCTTT CTAATACGACTCACTATAGGGAGATTGTGTGCCAAAAACTCAGCTGTC CTAATACGACTCACTATAGGGAGATTGGCTCACAAACACCGAATCTC CTAATACGACTCACTATAGGGAGATTGACTGCTGGCACTGGACTTTC CTAATACGACTCACTATAGGGAGATTGATAAGGCCATTATCGGT CTAATACGACTCACTATAGGGAGAATCCAAGGGGTAAGCCACAA CTAATACGACTCACTATAGGGAGATTGCGGCCGAGATCGTCCCC CTAATACGACTCACTATAGGGAGAAACGCCTCGTGCAGCTCCACC CTAATACGACTCACTATAGGGAGAGACGTGGTCATCGTCAGC CTAATACGACTCACTATAGGGAGACCGTACCGCGCCGCGACGTTC CTAATACGACTCACTATAGGGAGATGGCATGCAGGCGCTCATGGAC CTAATACGACTCACTATAGGGAGATCCCTCTCTTGCTGTACTCCAC GGCTACCCCAAGATGTCTGC

SL-Fw

All mRNA

5′-cloning

ACACTTTCTGAGTGTCTATTTTTTTTCG

GeneRACER(dT)24

All mRNA

3′-cloning

GCTGTCAACGATACGCTACGTAACGGCATGACAG TGTTTTTTTTTTTTTTTTTTTTTTTT

GeneRACER-3′

All mRNA

3′-cloning

GCTGTCAACGATACGCTACGTAACG

3′-cloning

Underlining shows T7 promoter sequence Semi-qRT-PCR semiquantitative RT-PCR, RNAi RNA interference

RNAi Experiments Silencing experiments of EgKAT isoenzymes by RNAi were performed as described in previous papers [18, 19] with slight modifications. Partial cDNA of EgKAT isozymes were PCR-amplified with the addition of the T7 RNA polymerase promoter sequence at the 5′-ends of both primers. The sequences of primers are listed in Table 1. The primers used were as follows: T7EgKAT1-114Fw and T7EgKAT1-567Rv for EgKAT1, T7EgKAT2-562Fw and T7EgKAT2-971Rv for EgKAT2, T7EgKAT3-152Fw and T7EgKAT3-501Rv for EgKAT3, T7EgKAT4-668Fw and

T7EgKAT4-1029Rv for EgKAT4, T7EgKAT5-79Fw and T7EgKAT5-557Rv for EgKAT5, T7EgKAT6-293Fw and T7EgKAT6-651Rv for EgKAT6. Double-strand RNAs (dsRNAs) containing a partial EgKAT isozyme sequence (approximately 400 bp) were synthesized and purified using the MEGAscript RNAi kit (Ambion) following the instructions supplied by the manufacturer. E. gracilis cells from 4-day-old cultures in Koren-Hutner medium were collected, washed in PBS (+) twice and resuspended in PBS (+). The cell suspension containing 4 × 106 E. gracilis cells (400 μl) was transferred to a 0.2-cm-gap cuvette and electroporated with 15 μg (for EgKAT1, 2, 4) or 30 μg (for

13

486

EgKAT3) of EgKAT dsRNA. In the control experiment, 15 μl of Tris-EDTA buffer, pH 8.0, containing no dsRNA was introduced. The conditions of electroporation using BTX ECM630 were at 0.5 kV and 200 μF. After electroporation, 1 ml of Koren-Hutner medium (pH 5.0) was added and incubated at room temperature (approximately 27 °C) with gentle shaking using a gyratory shaker. After 3 h, aliquots were diluted in Koren-Hutner medium and cultured with continuous shaking (120 rpm) at 27 °C. Reverse Transcription (RT)‑PCR Five hundred nanograms of total RNA extracted from 3 days’ culture of E. gracilis (in late log phase) were reverse transcribed using PrimeScript RT Master Mix (Takara Bio, Japan) in 10 μl of reaction mixture. Semiquantitative RT-PCR was performed using specific primers for each EgKAT isozyme. Primers used were as follows: EgKAT117Fw and EgKAT1-598Rv for EgKAT1, EgKAT2-19Fw and EgKAT2-647Rv for EgKAT2, EgKAT3-423Fw and EgKAT3-783Rv for EgKAT3, EgKAT4-374Fw and EgKAT41147Rv for EgKAT4, EgKAT5-297Fw and EgKAT5-534Rv for EgKAT5, and EgKAT6-22Fw and EgKAT6-437Rv for EgKAT6. Nucleotide sequences of these primers are listed in Table 1. Amplification of alpha-tubulin cDNA from E. gracilis with primers EgAtub-853Fw and EgAtub-1267Rv was used as a normalizer. The 25-μl GoTaq Green Master Mix (Promega) PCR reaction mixture contained 0.4 μM of each primer and 0.5 μl of template cDNA. The PCR amplification was carried out with denaturation at 94 °C for 30 s, primer annealing at 55 °C for 30 s and extension at 72 °C for 1 min/kb, respectively. Amplification cycle numbers of each gene were as follows: 25 cycles for EgKAT1 and EgKAT2, 22 cycles for EgKAT3, 28 cycles for EgKAT4, 29 cycles for EgKAT5, 35 cycles for EgKAT6 and 18 cycles for alpha-tubulin.

Lipids (2015) 50:483–492

gas chromatography (GC-2014, Shimadzu) equipped with a hydrogen detector, on a glass column (2.1 m × 3.2 mm) packed with 2.5 % Thermon-3000 (Shinwasorb-S 60/80) (Shinwa Chemical Industries, Japan) at 230 °C. A defined concentration of myristyl myristate (Larodan Fine Chemicals AB, Sweden) was used as a standard. Wax esters consisting of saturated carbon chains in both the fatty acid and fatty alcohol moieties were detected and analyzed. To determine the composition of fatty alcohol and fatty acid in wax ester, the lipid fractions were saponified according to the method in Inui et al. [8]. The fatty acid fractions were collected and methylated with trimethylsilyldiazomethane. Fatty alcohols and fatty acid methyl esters were analyzed using gas chromatography on a glass column (2.1 m × 3.2 mm) packed with 2.5 % Thermon-3000 (Shinwasorb-S 60/80) at 160 °C. Preparation of Artificial Biodiesel Fatty alcohol (C10-C18) and even-numbered fatty acid methyl ester (FAME,C10-C18) were purchased from Wako Chemical, Japan. Odd-numbered FAMEs were prepared using anhydrous hydrogen chloride in methanol [23]. Fatty alcohol and FAME were mixed according to the composition of the imaginary biodiesel made from E. gracilis wax esters, which was inferred from fatty alcohol and FAME analyses. Mixed samples were heated at 50 °C to dissolve the solid component completely and cooled to room temperature (28 °C). Differential Scanning Calorimetry (DSC)

Extraction of paramylon from E. gracilis cells was done according to the method in Takenaka et al. [20]. Precipitated paramylon was dissolved in an adequate amount of 1 M NaOH and determined by the phenol–sulfuric acid method [21] using defined concentrations of glucose solution as a standard.

DSC measurements were performed with a DSC6100 thermal analysis system (Seiko Instruments Inc.) in an argon atmosphere (20 ml/min). We used a temperature program with two steps, in which the sample was first heated from −150 to 80 °C at 5 °C min−1 followed by a second cooling step at 5 °C min−1 to −150 °C. Data acquisition and analysis were carried out using EXSTAR6000 software, version 5.6, provided by Seiko Instruments Inc. High-purity indium and cyclohexane were used to calibrate the DSC signals. Mixed samples containing fatty alcohols and FAMEs were put in an aluminum sample pan and sealed. Melting and freezing points were determined according to the method in Dunn [24].

Determination of Wax Ester

Statistical Analysis

Extraction of lipid fractions containing wax ester from E. gracilis cells was done according to the method in Bligh and Dier [22]. The lipid fractions were evaporated and dissolved in chloroform. Wax esters were determined with

All data are represented as the group mean ± SD. Data were analyzed using the SPSS statistical program. The significance of differences relative to the control was determined using Student’s t test.

Determination of Paramylon

13

Lipids (2015) 50:483–492

487

Results Six Putative KAT Isozymes in the E. gracilis EST Database A local tblastn search was performed against the nucleotide data in the E. gracilis EST database. The amino acid sequence of Zoogloea ramigera biosynthetic thiolase (ZRAT), which is the best characterized thiolase [25], was used as a query. We found six putative KAT isozymes and named them EgKAT1-6 (the corresponding ID numbers in the Euglena gracilis EST database are shown in Table 2). Complete full length sequences of EgKAT1, 2 and 3 with a 5′-terminal SL sequence and 3′-terminal poly (A) were found in the database. Unknown sequences of cDNA regions in EgKAT4, 5 and 6 cDNA were cloned by RT-PCR using the primers listed in Table 1. Accession numbers of the nucleotide sequence cloned in this study are as follows: EgKAT4, AB968430; EgKAT5, AB968431; EgKAT6, AB968432. Multiple sequence alignment of deduced amino acid sequences of EgKAT and ZRAT revealed that the catalytic center residues (Cys89, His348 and Cys378 in ZRAT) [25] were completely conserved in all six of the EgKATs (data not shown). Mitochondrial localization of EgKAT1-4 was deduced by in silico prediction using TargetP [26] and PSORT [27]. Effect of Gene Silenced EgKAT on Wax Ester Production Gene silencing was done to clarify whether or not regulating EgKAT isozymes alters wax ester profiles. Gene silencing of each EgKAT isozyme was confirmed by semiquantitative RT-PCR (Fig. 1). The expression of EgKAT isozymes was silenced separately in each silencing experiment even though they showed high amino acid sequence similarity (35–75 % positional identity, data not shown). No effect on aerobic cell growth was observed with EgKAT silencing (data not shown). These results suggest that EgKAT isozymes do not contribute to the aerobic metabolism under the experimental conditions of this study. In contrast, EgKAT3-silenced cells showed a significant decrease in viability in hypoxic conditions (Table 3). Table 2  List of EgKAT isozyme cluster numbers of in the Euglena gracilis EST database Name

Cluster ID on EST database

EgKAT1 EgKAT2 EgKAT3 EgKAT4 EgKAT5

ELL00002550 ELL00002493 ELL00002599 ELL00008048 ELL00000286

EgKAT6

ELL00000780

Fig. 1  Semiquantitative RT-PCR analysis of EgKAT isozymes and alpha-tubulin (for normalization). The leftmost column shows the type of amplified mRNA. The other columns represent template mRNA variations: C without dsRNA, 1 EgKAT1 dsRNA introduced, 2 EgKAT2 dsRNA introduced; 3 EgKAT3 dsRNA introduced; 4 EgKAT4 dsRNA introduced; 5 EgKAT5 dsRNA introduced; 6 EgKAT6 dsRNA introduced Table 3  Viability of EgKAT-silenced cells after exposure of hypoxic conditions for 48 h Cell

Viability (%)

Control EgKAT1 RNAi EgKAT2 RNAi EgKAT3 RNAi

92 ± 3.3 91 ± 3.4 94 ± 2.9 35 ± 1.9*

EgKAT4 RNAi

92 ± 4.6

Viability (%) = (total cell number − stained cell number) × 100/total cell number. Values represent the mean ± SD (n = 3) * Shows significant difference versus the control (P < 0.05)

The effects of EgKAT silencing on hypoxic wax ester production were quite different in each isozyme. Silencing EgKAT4, 5 and 6 showed no significant effect on wax ester production (data not shown except EgKAT4). Total wax ester production of EgKAT3-silenced cells was greatly lowered to approximately 25 % of the control level (Fig. 2a). EgKAT1-silenced cells showed a slight decrease in wax ester production to approximately 85 % of the control level (Fig. 2a). Detailed analysis of the wax ester composition showed different acyl chain length distributions of wax ester in EgKAT1- and EgKAT2-silenced cells compared to those in control cells (Fig. 2b). C28 wax ester was dominant in the control cells, whereas C26 was dominant in EgKAT1-silenced cells and C27 in EgKAT2-silenced cells. Importantly, the amount and the ratio of wax ester with an acyl chain length shorter than C26 significantly increased in EgKAT1- (0.62 mg/ml cell suspension, 70 % in total wax ester) and EgKAT2-silenced cells (0.43 mg/ml,

13

1.2

*

0.9

0.6

*

0.3

Ai R

KA

T4

R Eg

T3 KA Eg

N

Ai N

Ai N R

T2 Eg

KA Eg

(b)

KA

T1

R

N

tro l

Ai

0 on

(a)

C

Fig. 2  Effect of EgKAT gene silencing on wax ester contents after exposure to hypoxic conditions for 48 h. No wax esters were detected in cells without hypoxic exposure. Wax esters produced by E. gracilis composed of saturated fatty acids and saturated fatty alcohols. a Total wax ester contents, b composition of wax ester in EgKAT1- and EgKAT2-silenced cells, c composition of wax ester in EgKAT3- and EgKAT4silenced cells. Error bars indicate standard deviation of the mean (n = 3).The significance of differences relative to the control was determined using Student’s t test. Asterisks show a significant difference versus the control (P < 0.05)

Lipids (2015) 50:483–492

Wax ester content (mg/mL cell suspension)

488

30

% of total wax ester content

Control

25

EgKAT1 RNAi EgKAT2 RNAi

20 15 10 5 0 20

21

22

23

24

25

26

27

28

29

30

31

32

Acyl chain length of wax ester

(c) 30

% of total wax ester content

Control

25

EgKAT3 RNAi EgKAT4 RNAi

20 15 10 5 0 20

21

22

23

24

25

26

27

28

Acyl chain length of wax ester

13

29

30

31

32

Fig. 3  Effect of EgKAT1 gene silencing on fatty acid and fatty alcohol profiles in wax ester. a Fatty acid profiles; b fatty alcohol profiles. Crude lipid fractions were saponified and analyzed using gas chromatography with a hydrogen detector. Composition of fatty acids and fatty alcohols in the wax of control and EgKAT1-silenced cells are shown

489

(a)

50

% of total FA content

Lipids (2015) 50:483–492

40

Control FA EgKAT1 RNAi FA

30

20

10

0 10

11

12

13

14

15

16

17

18

(b)

50

% of total FAlc content

Acyl chain length of FA

40

Control FAlc EgKAT1 RNAi FAlc

30

20

10

0 10

11

12

13

14

15

16

17

18

Acyl chain length of FAlc

41 %) compared to that in control cells (0.25 mg/ml, 23 %). The wax ester composition of EgKAT3-silenced cells was almost the same as that of control cells (Fig. 2c). To determine in detail the significant compositional change of wax ester in EgKAT1-silenced cells, the extracted crude lipid fraction was saponified and analyzed (Fig.  3). The main components of the crude wax extract from control cells were C14 fatty acid and C14 fatty alcohol. In contrast, the silencing of EgKAT1 induced a compositional shift to shorter chain production, and the main components of wax ester from those cells were C12-C13 fatty acids and C12 fatty alcohol. Paramylon Degradation A previous study by Inui et al. [7] suggested that all carbons in the newly synthesized wax esters are supplied from paramylon degraded in hypoxic conditions. Here we analyzed the paramylon utilization of EgKAT-silencing cells in

hypoxic culture conditions. After 48 h exposure to hypoxic conditions, the degradation of paramylon was stimulated in EgKAT1- and 3-silenced cells (Table 4). These results suggest that the carbon supply from paramylon degradation in the EgKAT-silenced cells was sufficient to produce wax ester in hypoxic conditions, the same as for control cells. Thermal Profile of the Model Fuel Mixture To determine the effect of acyl chain truncation on thermal profiles of the fuel produced from wax ester, model fuel mixtures based on the composition of saponified and methylated wax ester from EgKAT1-silenced cells were prepared. Pure fatty alcohols and FAMEs were mixed and analyzed. DSC analysis revealed a significant decrease in melting point (−26 to −38 °C) and freezing point (21 to 13 °C) in the EgKAT1silenced group compared to the control group (Fig. 4). These results suggest that the biofuel from EgKAT1-silenced cells had improved cold flow properties.

13

490

Lipids (2015) 50:483–492

Table 4  Intracellular paramylon contents before and after exposure to hypoxic conditions

Initial

48 h hypoxia

Degraded

Control EgKAT1 RNAi EgKAT2 RNAi EgKAT3 RNAi

5.1 ± 0.22 5.5 ± 0.12 5.1 ± 0.31 5.7 ± 0.20*

0.66 ± 0.077 0.56 ± 0.054 0.86 ± 0.44 0.29 ± 0.030*

4.4 ± 0.15 4.9 ± 0.077* 4.3 ± 0.13 5.4 ± 0.18*

EgKAT4 RNAi

4.9 ± 0.49

0.76 ± 0.15

4.1 ± 0.48

Values represent the mean ± SD (n = 3) * Show significant difference versus the control (P < 0.05)

Discussion The shift of E. gracilis culture conditions from aerobic to hypoxic or anaerobic induces the wax ester production using the storage polysaccharide paramylon [7]. In this article, we aimed to regulate the wax ester production profile in E. gracilis and focused on the enzyme 3-ketoacyl-CoA thiolase (KAT), a condensing enzyme of mitochondrial fatty acid synthesis. KAT isozymes vary widely in substrate chain-length specificity, catalytic efficiency, function and cellular location. We aimed to identify the KAT isozymes involved in wax ester fermentation and used them to modify the wax ester production profiles. First, we searched for putative KAT isozymes in E. gracilis in the EST database. Six candidates were found, with four of them (EgKAT1-4) predicted in silico to localize in mitochondria. The present study suggests different roles for each EgKAT isozyme in hypoxic wax ester production. When EgKAT3-silenced cells were exposed to hypoxic conditions for 48 h, wax ester synthesis was greatly reduced (Fig. 2a) and cell viability significantly decreased (Table 3). This suggests that EgKAT3 is a short- and medium-chainspecific enzyme crucial for the hypoxic synthesis of wax esters from paramylon and that wax ester synthesis from paramylon is critical to survive under hypoxic conditions in Euglena. But paramylon degradation also took place in EgKAT3-silenced cells. To learn more about the effects of EgKAT3 silencing on the hypoxic metabolism, silenced cells were exposed to short term hypoxic conditions (6 h). Most of the cells survived, and the degradation of paramylon was accelerated although wax ester synthesis was greatly reduced from control cell levels (data not shown). We think that under hypoxic conditions unknown anaerobic products are produced in EgKAT3-silenced cells from paramylon, generating ATP inefficiently. In a previous article, we reported that thiamin deficiency results in a decrease in cell viability under anaerobic conditions because of

13

Cooling

Paramylon content (mg/ml cell suspension)

0.5

DSC (W/g)

Cell

1

0

-0.5

Heating

-1

-1.5 -100

-75

-50

-25

0

25

50

Temperature (°C)

Fig. 4  Analysis of the thermal profiles of model fuels. Differential scanning calorimetry analysis of model fuels based on the composition of FAlcs and FAMEs in the saponified and methylated wax ester from control (broken lines) and EgKAT1-silenced (solid lines) cells

reduced wax ester synthesis resulting from a decrease in the activity of pyruvate: NADP+ oxidoreducase that catalyzes the conversion from pyruvate to acetyl-CoA [28]. We found alcohols and lactate, in addition to wax esters, as anaerobic end products in the thiamin-deficient cells. However, it is not clear whether alcohols or lactate are produced in the EgKAT3-silenced cells when exposed to hypoxic conditions. Gene silencing of EgKAT1 and EgKAT2 induced truncation of wax ester carbons. The major products of EgKAT1- and EgKAT2-silenced cells were C26 and C27, respectively; those of control cells were C28 (Fig. 2a). The total wax ester content of EgKAT2-silenced cells was approximately at the control level and that of EgKAT1silenced cells was slightly lower. These results suggest that EgKAT1 and EgKAT2 catalyze medium- and long-chain (above C14) acyl-CoA production in mitochondrial fatty acid synthesis. Further analysis of saponified wax ester also revealed a compositional shift to shorter chain production in EgKAT1-silenced cells. The main components of wax ester from those cells were C12 fatty alcohol and C12-C13 fatty acids, in contrast to C14 fatty alcohol and C14 fatty acid in control cells. We achieved the enrichment of shorter saturated fatty acids and fatty alcohols in wax ester by gene silencing EgKAT1. There are two major metabolic engineering strategies to obtain shorter saturated fatty acids (C8–C14) in transgenic plants and microalgae [29]. One is heterologous expression of medium-chain-length-specific acyl-acyl carrier protein (ACP) thioesterase, which releases fatty acids from

Lipids (2015) 50:483–492

acyl-ACP. The other is heterologous expression of 3-ketoacyl-ACP synthetase, a condensing enzyme in FAS II, with activity on short and medium chains, which results in an increase in medium-chain acyl-ACP pool sizes. Transformation of these two genes into plants results in accumulation of shorter chain saturated fatty acids, but at the same time, induces a futile cycle of fatty acid synthesis and degradation in the transgenic plant [30]. In particular, transgenic hosts induce a degradation pathway that is specific to medium-chain-length fatty acids. Thus, transgenic plants do not produce medium-chain fatty acids efficiently. In the case of diatoms, a transformant which heterologously expressed C12-specific acyl-ACP thioesterase shows a significant decrease in cellular growth, and the lauric acid content was less than 5 % in total fatty acid in the transformant [31]. These results suggest that the production of unusual fatty acids in transgenic organisms induces their degradation and sometimes has unexpected effects on the host organism. In contrast, silencing EgKAT1 did not affect aerobic cellular growth or anaerobic viability of E. gracilis. E. gracilis has at least other two fatty acid synthesis systems, the cytosolic and chloroplast types. Under the experimental conditions of this study, altering mitochondrial fatty acid synthesis might not affect cellular lipid components other than wax ester. The article is the first example of altering wax ester composition by metabolic engineering in E. gracilis. Shortening long acyl chains in wax ester should enable us to produce biodiesel with a lower melting point. To determine the thermal properties of fuel prepared from the engineered wax ester, a model fuel mixture with pure fatty alcohols and FAMEs according to the composition in EgKAT1silenced cells (Fig. 3) was prepared and analyzed using DSC (Fig. 4). It showed significantly decreased melting (12 °C) and freezing (8 °C) points. These results suggest the cold flow properties of wax ester-derived biofuel are improved by silencing EgKAT1 in E. gracilis. The potential of reversed fatty acid beta-oxidation for the synthesis of fuels and chemicals is receiving significant attention. A functional reversal of fatty acid beta-oxidation in Escherichia coli is achieved by the following complex steps: mutations to catabolite repression factors, overexpression of fatty acid beta-oxidation enzymes, disruptions of intracellular acetyl-CoA consumption enzymes and disruption of fermentative pathways [32]. The specificity of KAT is a key factor in the determination of an engineered pathway product [32]. Knowing how EgKAT is involved in mitochondrial fatty acid synthesis in E. gracilis could contribute to the production of desired acyl chain length fuels and chemicals in other organisms including E. coli. In conclusion, we found three 3-ketoacyl-CoA thiolases involved in wax ester fermentation in E. gracilis. Two of

491

them (EgKAT1 and 2) catalyzed medium- and long-chain acyl-CoA synthesis, and the other (EgKAT3) catalyzed short- and medium-chain acyl-CoA synthesis in mitochondria. Silencing EgKAT1 induced a shortening of long acyl chains in wax ester. These findings are useful in engineering the metabolism of E. gracilis to produce wax ester with a desired acyl chain length. Acknowledgments  This work was supported by the Japan Science and Technology Agency (JST), PRESTO program. The authors thank Dr. Joseph Rodrigue for critical reading of the manuscript. Conflict of interest  The authors declare that they have no competing interests.

References 1. Hu Q, Sommerfeld M, Jarvis E, Ghirardi M, Posewitz M, Seibert M, Darzins A (2008) Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and advances. Plant J 54:621–639 2. Sirevåg R, Levine RP (1972) Fatty acid synthetase from Chlamydomonas reinhardi. J Biol Chem 247:2586–2591 3. Fan J, Andre C, Xu C (2011) A chloroplast pathway for the de novo biosynthesis of triacylglycerol in Chlamydomonas reinhardtii. FEBS Lett 585:1985–1991 4. Fan J, Yan C, Andre C, Shanklin J, Schwender J, Xu C (2012) Oil accumulation is controlled by carbon precursor supply for fatty acid synthesis in Chlamydomonas reinhardtii. Plant Cell Physiol 53:1380–1390 5. Knothe G (2009) Improving biodiesel fuel properties by modifying fatty ester composition. Energy Environ Sci 2:759–766 6. Stansell GR, Gray VM, Sym SD (2011) Microalgal fatty acid composition: implications for biodiesel quality. J Appl Phycol 24:791–801 7. Inui H, Miyatake K, Nakano Y, Kitaoka S (1982) Wax ester fermentation in Euglena gracilis. FEBS Lett 150:89–93 8. Inui H, Miyatake K, Nakano Y, Kitaoka S (1983) Production and composition of wax esters by fermentation of Euglena gracilis. Agric Biol Chem 47:2669–2671 9. Inui H, Miyatake K, Nakano Y, Kitaoka S (1984) Fatty acid synthesis in mitochondria of Euglena gracilis. Eur J Biochem 142:121–126 10. Teerawanichpan P, Qiu X (2010) Fatty acyl-CoA reductase and wax synthase from Euglena gracilis in the biosynthesis of medium-chain wax esters. Lipids 45:263–273 11. Fox AR, Soto G, Mozzicafreddo M, Garcia AN, Cuccioloni M, Angeletti M, Salerno JC, Ayub ND (2014) Understanding the function of bacterial and eukaryotic thiolases II by integrating evolutionary and functional approaches. Gene 533:5–10 12. Oda Y, Nakano Y, Kitaoka S (1982) Utilization and toxicity of exogenous amino acids in Euglena gracilis. J Gen Microbiol 128:853–858 13. Koren LE, Hutner SH (1967) High-yield media for photosynthesizing Euglena gracilis z. J Protozool 14(Supplement):17 14. Sauch JF, Flanigan D, Galvin ML, Berman D, Jakubowski W (1991) Propidium iodide as an indicator of Giardia cyst viability. Appl Environ Microbiol 57:3243–3247 15. O’Brien EA, Koski LB, Zhang Y, Yang L, Wang E, Gray MW, Burger G, Lang BF (2007) TBestDB: a taxonomically broad database of expressed sequence tags (ESTs). Nucleic Acids Res 35:D445–D451

13

492 16. Nakazawa M, Minami T, Teramura K, Kumamoto S, Hanato S, Takenaka S, Ueda M, Inui H, Nakano Y, Miyatake K (2005) Molecular characterization of a bifunctional glyoxylate cycle enzyme, malate synthase/isocitratelyase, in Euglena gracilis. Comp Biochem Physiol B Biochem Mol Biol 141:445–452 17. Tessier L, Keller M, Chan RL, Fournier R, Weil JH, Imbault P (1991) RNAs to pre-mature mRNAs by trans-splicing in Euglena. EMBO J 10:2621–2625 18. Iseki M, Matsunaga S, Murakami A, Ohno K, Shiga K, Yoshida K, Sugai M, Takahashi T, Hori T, Watanabe M (2002) A bluelight-activated adenylyl cyclase mediates photo avoidance in Euglena gracilis. Nature 415:1047–1051 19. Ishikawa T, Tajima N, Nishikawa H, Gao Y, Rapolu M, Shibata H, Sawa Y, Shigeoka S (2010) Euglena gracilisas corbate peroxidase forms an intramolecular dimeric structure: its unique molecular characterization. Biochem J 426:125–134 20. Takenaka S, Kondo T, Nazeri S, Tamura Y, Tokunaga M, Tsuyama S, Miyatake K, Nakano Y (1997) Accumulation of trehalose as a compatible solute under osmotic stress in Euglena gracilis Z. J Eukaryot Microbiol 44:609–613 21. Hodge JE, Hofreiter BT (1962) Determination of reducing sugars and carbohydrates. In: Whistler RL, Wolfrom ML (eds) Methods in carbohydrate chemistry, vol 1. Academic press, New York, pp 380–394 22. Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37:911–917 23. Christie WW (1993) Preparation of ester derivatives of fattyacids for chromatographic analysis. In: Christie WW (ed) Advances in lipid methodology—two. The Oily Press, Dundee, UK, pp 69–111

13

Lipids (2015) 50:483–492 24. Dunn RO (1999) Thermal analysis of alternative diesel fuels from vegetable oils. J Am Oil Chem Soc 76:109–115 25. Meriläinen G, Poikela V, Kursula P, Wierenga RK (2009) The thiolase reaction mechanism: the importance of Asn316 and His348 for stabilizing the enolate intermediate of the Claisen condensation. Biochemistry 48:11011–11025 26. Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating proteins in the cell using TargetP, SignalP and related tools. Nat Protoc 2:953–971 27. Nakai K, Horton P (1999) PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem Sci 24:34–36 28. Inui H, Ochi H, Nogami K, Miyatake K, Nakano Y, Kitaoka S (1988) Effect of thiamin deficiency on wax ester fermentation in Euglena gracilis. Agric Biol Chem 52:49–54 29. Thelen JJ, Ohlrogge JB (2002) Metabolic engineering of fatty acid biosynthesis in plants. Metab Eng 4:12–21 30. Eccleston V, Ohlrogge J (1998) Expression of lauroyl-acyl carrier protein thioesterase in Brassica napus seeds induces pathways for both fatty acid oxidation and biosynthesis and implies a set point for triacylglycerol accumulation. Plant Cell 10:613–622 31. Radakovits R, Eduafo P, Posewitz MC (2010) Genetic engineering of fatty acid chain length in Phaeodactylum tricornutum. Metab Eng 13:89–95 32. Dellomonaco C, Clomburg JM, Miller EN, Gonzalez R (2011) Engineered reversal of the β-oxidation cycle for the synthesis of fuels and chemicals. Nature 476:355–359