J Cancer Res Clin Oncol (2012) 138:2017–2026 DOI 10.1007/s00432-012-1282-3

ORIGINAL PAPER

Angiopoietin-2 inhibition using siRNA or the peptide antagonist L1–10 results in antitumor activity in human neuroblastoma Saritha Sandra D’Souza • Karine Scherzinger-Laude Marc Simon • Bharathi P. Salimath • Jochen Ro¨ssler

•

Received: 26 March 2012 / Accepted: 22 June 2012 / Published online: 10 July 2012 Ó Springer-Verlag 2012

Abstract Purpose The angiopoietin/Tie-2 system has been identified as a key role player in tumor angiogenesis. We investigated whether angiopoietin-2 could be a promising target in human neuroblastoma. Methods Angiopoietin-2 down-regulation by siRNA or shRNA was evaluated in vitro in Kelly cells. Angiopoietin2 shRNA-transfected Kelly cells were tested in a chorioallantoic membrane (CAM) assay to evaluate tumor growth and microvessel density. The effects of L1–10, a peptide– Fc fusion molecule blocking angiopoietin-2/Tie-2 interaction, administered 3 times/week were assessed in a murine neuroblastoma xenograft model. Results Angiopoietin-2 down-regulation by siRNA or shRNA in Kelly cells inhibited cell proliferation and migration. In vivo growth and microvessel density of angiopoietin-2 shRNA-transfected Kelly cells in the CAM assay were reduced. Therapy of advanced tumors with L1–10 did not stop tumor progression. However, starting L1–10 treatment at the same time as neuroblastoma cell injection significantly inhibited tumor growth (vehicule: 903 ± 160 mm3; L1–10: 270 ± 152 mm3 after 26 days; Saritha Sandra D’Souza and Karine Scherzinger-Laude have equally contributed to this work. S. S. D’Souza  K. Scherzinger-Laude  M. Simon  J. Ro¨ssler (&) Clinic IV: Pediatric Hematology and Oncology, Center of Pediatrics and Adolescent Medicine, University Medical Hospital, Mathildenstrasse 1, 79106 Freiburg, Germany e-mail: [email protected] S. S. D’Souza  B. P. Salimath Department of Studies in Biotechnology, University of Mysore, Manasagangotri, Mysore 570006, Karnataka, India

P \ 0.05). Microvessel density was reduced in both L1–10-treated tumors, whereas expression of angiopoietin-2 and VEGF-A did not change. Conclusion This first demonstration of beneficial angiopoietin-2 inhibition in neuroblastoma offers an additional approach for future therapy strategies, especially by using L1–10 in the setting of minimal residual disease. Keywords Angiopoietin-2  Tie-2  L1–10  siRNA  Microvessel density  Childhood neuroblastoma

Introduction High-stage neuroblastoma presents with an invasive, metastatic, and hyper vascular phenotype, which leads to the key obstacles to the cure of this disease. The recognition that high-risk neuroblastoma tumors are frequently hemorrhagic and that lower risk tumors are not, raises the hypothesis that angiogenesis may be instrumental in tumor metastasis and high-risk disease (Ro¨ssler et al. 2008, 2011). VEGF is a master regulator of angiogenesis and is involved in the progression of most solid tumors. However, it cannot induce on its own the formation of a functional capillary network able to sustain perfusion. Instead, it acts in concert with later regulators of the angiogenic cascade (Weidner et al. 1991). Furthermore, resistance for VEGFdriven therapies has been reported (Azam et al. 2010). While the VEGFs and their receptors have been among the most extensively studied pathways for antitumor therapy, preclinical efforts to target the more recently discovered angiopoietins/Tie-2 pathway are now gaining strength (Davis et al. 1996; Sato et al. 1998; Shim et al. 2007; Ward and Dumont 2002). Angiopoietin-1 (Ang-1) and angiopoietin-2 (Ang-2) have been identified as agonistic and

123

2018

antagonistic ligands of the vascular receptor tyrosine kinase Tie-2, respectively (Maisonpierre et al. 1997; Suri et al. 2009). Ang-1 acts as an endothelial cell survival factor and promote vascular maturation. Constitutive Ang-1/Tie-2 signaling is required to maintain the quiescent phenotype of the vascular endothelium. Ang-2 acts as a contextspecific antagonist of Ang-1/Tie-2 signaling. As such, it destabilizes the quiescent endothelial cell phenotype and primes it for exogenous cytokines including angiogenic and inflammatory stimuli (Imhof and Aurrand-Lions 2006). In consequence, Ang-2 has also been reported to be capable of acting as an agonist of Tie-2 (Teichert-Kuliszewska et al. 2001). Angiogenesis and vascular remodeling involve a complex coordination of Ang-1 and Ang-2 signaling through Tie-2 (Morisada et al. 2006). However, little is known about the mechanisms of Ang-2 function on Tie-2. It has been shown that Ang-2 supports RhoA and myosin light chain phosphorylation, promoting vascular leakage and endothelial cell migration (Parikh et al. 2006). Other studies have identified Ang-2 as a pro-inflammatory cytokine (Fiedler et al. 2006). Anti-angiogenesis in combination with chemotherapy has rapidly become part of standard tumor therapy and is now used in the treatment for different adult solid tumors, including colorectal tumors, renal cell carcinomas, mammary tumors, and lung tumors (Heath and Bicknell 2009). Yet, the efficacy of anti-angiogenic treatment is limited, and anti-angiogenic therapies are far from being exploited to their fullest extent. Recent preclinical experiments have shown that anti-Ang-2 therapy using peptide–Fc fusion proteins, antibodies, or an Ang-2-specific RNA aptamer inhibit tumor growth in xenograft as well as synergetic mouse models (Hu and Cheng 2009; Oliner et al. 2004; Sarraf-Yazdi et al. 2008). First in vitro studies targeting tumor angiogenesis in neuroblastoma using anti-VEGF molecules showed promising results (Dickson et al. 2007; Segerstrom et al. 2006; Zhang et al. 2009). Still the correct and most effective time point for introducing anti-angiogenic molecules in the multimodal therapy concept for neuroblastoma is not clear. In the present study, we evaluated Ang-2 as a target for anti-angiogenic therapy in neuroblastoma, using DNA vector-based siRNA technology to down-regulate Ang-2 expression or using L1–10, a peptide–Fc fusion protein that inhibits the interaction between Ang-2 and its receptor Tie-2 (Tressel et al. 2008). A similar peptide–Fc fusion protein, L1–7(N), has shown efficacy in the treatment for tumorbearing mice (Oliner et al. 2004). In both approaches, we evidenced that targeting Ang-2 in neuroblastoma resulted in slowing down tumor growth, raising new perspectives for anti-angiogenesis therapy in pediatric cancer.

123

J Cancer Res Clin Oncol (2012) 138:2017–2026

Materials and methods Cell lines and culture conditions The following 8 human neuroblastoma cell lines were used: SH-EP, SH-SY5Y, SK-N-AS, LAN-5, NMB, Kelly, kindly provided by M. Schwab (DKFZ Heidelberg, Germany), SK-N-LO, and SK-N-FI, kindly provided by A. Voigt (Department of Pediatrics, University Hospital of Jena, Germany). The cells were cultured in RPMI 1640 medium (Gibco-BRL, Eggenstein, Germany) supplemented with 10 % FCS, 50 U/ml penicillin G, 50 lg/ml streptomycin under 5 % CO2 at 37 °C.

Expression analysis of the angiopoietins Total RNA was isolated using the Trizol reagent (Invitrogen GmbH, Darmstadt, Germany) according to the manufacturer’s instructions. cDNA synthesis was performed with 1 lg of total RNA in a total volume of 20 ll containing 0.5 lg of oligodT primer, 10 mM dNTPs, 0.1 M DTT, and 200 U of SuperScriptII reverse transcriptase (Invitrogen GmbH, Darmstadt, Germany). Conventional PCR was carried out in a final volume of 25 ll containing 1.25 U of Taq DNA polymerase, 2 mM dNTPs, 50 mM MgCl2 (Invitrogen GmbH, Darmstadt, Germany), 1 ll of cDNA, and 10 lM of specific primers. The primers for Ang-1 were sense: 50 -GCTGGCAGTACAATGACAGGT-30 , Ang-1 antisense: 50 -TCAAAAATCTAAAGGTCGAAT-30 (35 cycles: 95 °C for 45 s, 58 °C for 1 min, and 72 °C for 1 min) and for Ang-2 were sense: 50 -GGATCTGGGGAGAG AGGAAC-30 , Ang-2 antisense: 50 -CTCTGCACCGAGTCAT CGTA-30 (35 cycles: 95 °C for 45 s, 60 °C for 45 s, and 72 °C for 1 min). b-Actin was used as RT-PCR control (Lagodny et al. 2007). It was amplified using the following primers 50 -CCAAGGCCAACCGCGAGAAGATGAC-30 and 50 -AGGGTACATGGTGGT GCCGCCAGA C-30 . For the Ang-1 and Ang-2 protein expression, 2 9 106 cells were cultured overnight in RPMI medium and total cell lysate was prepared using RIPA buffer (50 mM Tris– HCl, pH 7.4, 150 mM NaCl, 1 % NP-40, 0.25 % SDS, 1 mM EDTA, 0.5 % sodium deoxycholate, 1 mM PMSF, 1 lg/ml aprotinin, leupeptin and pepstatin, 1 mM sodium orthovanadate, and 1 mM NaF). 25 lg of protein as measured by Dc protein assay (Bio-Rad Hercules, California, USA) was resolved on 12 % SDS-PAGE under reducing conditions and transferred to nitrocellulose membrane. The membrane was probed with antibodies to Ang-1 and Ang-2 (Santa Cruz Biotechnology, Inc. Santa Cruz, CA. 95060 USA.) and b-actin (Sigma-Aldrich Chemie GmbH, Steinheim, Germany), and then with secondary antibody conjugated to HRP. The protein was detected by enhanced

J Cancer Res Clin Oncol (2012) 138:2017–2026

chemiluminescence using ECL advance western blotting kit (GE Healthcare UK Ltd, Buckinghamshire, England). Cloning of shRNA and transfection of plasmids The effective target sequence of RNAi was designed according to the guideline proposed elsewhere (Tuschl 2001, 2002). The designed siRNA (duplexes of sense and antisense strands) was synthesized by Eurofins MWG GmbH (Ebersberg, Germany). The targeted sequence of Ang-2 was 50 -AGAACCAGACGGCUGUGAUGAUAGA AA-30 . Scrambled siRNA 50 -GAUAGCAAUGACGAAUG CGUATT-30 was used as a negative control (Tressel et al. 2007). To test the efficacy of siRNA in vitro, Kelly cell line expressing Ang-2 was used. 8 9 104 cells/well were plated in 500 ll culture medium and incubated overnight to permit cell attachment. The following day, the cells were transfected with 25 nM of siRNA-Ang-2 or scrambled siRNA using HiPerFect (Qiagen, Hilden, Germany) according to the manufacturer‘s instructions. 72 h after transfection, RNA was extracted for RT-PCR to measure Ang2 expression. Two oligonucleotides corresponding to the target sequence and to the scrambled were synthesized—Ang-2 sense: 50 -GATCCCAGAACCAGACGGCTGTGATGATA GAAATTCAAGAGATTTCTATCATCACAGCCGTCTG GTTCTTTTTTGGAAA-30 , Ang-2 antisense: 50 -AGCTTT TCCAAAAAAGAACCAGACGGCTGTGATGATAGAA ATCTCTTGAATTTCTATCATCACAGCCGTCTGGTT CTGG-30 , scrambled sense: 50 -ATCCCGATAGCAATGA CCAATGCGTATTCAAGAGATACGCATTGGTCATTG CTATCTTTTTGGAAA-30 and scrambled antisense: 50 -A GCTTTTCCAAAAAGATAGCAATGACCAATGCGTA TCTCTTGAATACGCATTGGTCATTGCTATCGG-30 . The oligonucleotides were annealed (10 mM tris pH 8, 50 mM NaCl, 1 mM EDTA) and ligated into the pTER vector at BglII and HindIII to produce the construct pTER Ang-2 shRNA and pTER scrambled shRNA. The plasmid constructs were transfected into Kelly cells using the amaxa nucleofection kit (Lonza, Basel, Switzerland) using the programme X-002. The transfected cells were selected with 15 lg/ml of zeocin (InvivoGen, CA, USA) before use. Stable clone selection and confirmation The stably transfected Kelly cells were allowed to grow under selection pressure. Isolated islands of cells formed were picked and amplified separately. Total RNA was isolated from the scrambled-Kelly and Ang-2-Kelly clones. cDNA was prepared, and PCR was performed as described above. Likewise, total protein from both clones was isolated and protein expression was determined.

2019

Wound-healing assay 1 9 106 Kelly, scrambled-Kelly, or Ang-2-Kelly were seeded in a 6-well plate in complete medium and incubated overnight at 37 °C with 5 % CO2. A wound was scratched on the cell monolayer using a sterile pipette tip and photographed immediately, 24, 48, and 72 h after incubation. The distance covered by the cells into the wounded area was subsequently measured. Cell proliferation assay The cell proliferation assay was performed by using MTS (Promega Corporation, Madison, WI, USA) was performed as described by the manufacturer’s instructions. 1 9 104 cells (Kelly, scrambled-Kelly, and Ang-2-Kelly) were seeded in triplicates in a 96-well plate incubated at 37 °C with 5 % CO2 for 24, 48, or 72 h. 20 ll of the MTS solution was added per well and the plate was incubated for 2 h before measuring the absorbance of formazan formed at 450 nm. Immunofluorescence assay 1.5 9 105 cells (Kelly, scrambled-Kelly, and Ang-2-Kelly) were seeded on gelatin-coated coverslips and incubated at 37 °C with 5 % CO2 for 24 h. The cells were fixed with 4 % paraformaldehyde for 30 min at RT, permeabilized with saponin (1 mg/ml) for 10 min at RT, blocked for 30 min with 10 % FCS/PBS, washed with PBS, and incubated with rabbit anti-Ang-2 antibody diluted 1:20 in 10 % FCS/PBS for 1 h. The coverslips were washed with PBS twice before incubating with goat anti-rabbit IgG (H ? L) MFP 488 diluted 1:25 in 10 % FCS/PBS for 1 h. After washing with PBS, the nuclei were stained with DAPI diluted 1:10,000 in 10 % FCS/PBS for 20 min at RT. The coverslips were then mounted with 10 ll of the MobiGlow mounting medium (Mobitec, Go¨ttingen, Germany) and analyzed with a fluorescence microscope. Chorio allantoic membrane assay Fertilized white leghorn eggs incubated at 37 °C with 80 % humidity were used for the assay. After 10 days, a window was made on the eggs and a plastic ring was placed on the CAM. 5 9 106 Kelly, scrambled-Kelly, or Ang-2-Kelly cells mixed in 15 ll matrigel (BD Biosciences, NJ, USA) were added on the CAM inside the plastic ring. Tumors were excised on Day 17, their size and weight were measured, and they were immediately frozen in liquid nitrogen. In parallel, we assessed the anti-angiogenic efficacy of L1–10. For this purpose, we added 10 lg L1–10 on the

123

2020

CAM (Day 10) and observed its effect on the capillaries network after 48 h. Mice tumor model Principles of laboratory animal care (NIH publication No 85-23, revised 1985) were followed, as well as the current version of German Law on the protection of animals. All experiments were conducted using protocols and conditions approved by the Freiburg’s University Medical Hospital animal care and use committee. 5- to 6-week-old female SCID bg/bg mice obtained from Charles River (Sulzfeld, Germany) were kept in groups of five animals per cage under normal conditions with access to food and water ad libitum. Tumors were induced by s.c. injection of 20 9 106 wild-type Kelly cells in the right flank, and tumor growth and body weight were monitored 3 times weekly. Tumor sizes were determined according to the formula: length 9 d2 9 p/6, where ‘‘length’’ is the longest dimension and ‘‘diameter d’’ is the shortest. Treatments Mice were injected s.c. 3 times weekly for 26 days with 4 mg/kg L1–10 (kindly provided by Amgen, Thousand Oaks, CA, USA) diluted in PBS, either from the day of tumor initiation (Day 0) or starting when tumors reached *100 mm3 (Day 14). PBS-treated mice were used as control. Animals were euthanized after 26 days, and tumors were immediately collected, snap-frozen in liquid nitrogen, and stored at -80 °C.

J Cancer Res Clin Oncol (2012) 138:2017–2026

pre-cooled acetone for 5–10 min. They were then dried, rehydrated with PBS for 5 min, and blocked with normal serum diluted in PBS for 30 min. Subsequently, the sections were incubated with the rat anti-mouse CD31 antibody (Abcam, Cambridge, UK) for 1 h at room temperature. After washing with PBS, endogenous peroxidase was inhibited using 30 % MeOH/30 % H2O2. The sections were washed in PBS for 15 min and incubated with the anti-rat IgG (H ? L) HRP (Abcam, Cambridge, UK), diluted in 5 % normal serum in PBS for 45 min. The sections were washed in PBS for 15 min three times and incubated with freshly prepared DAB substrate (BD Biosciences, NJ, USA) for 10 min at RT. The sections were counterstained with hematoxylin, washed, dehydrated, and mounted using Entellan mountant. The average of CD31positive vessels was counted microscopically using 4009 magnification from three areas of the highest vascular density (vascular hot-spots) per sections. Statistical analysis The results presented in the figures are representative of at least three independent experiments. The data are presented as the mean value ± SEM. Comparisons between groups were evaluated by the Kruskal–Wallis H test (post hoc test: Mann–Whitney U test). All P values were twosided, and values less than 0.05 were considered statistically significant. Statistical analysis was performed using SPSS for Windows 15.0 (SPPS Inc, Chicago, IL, USA).

Results Tumor RNA isolation and qPCR Ang-2 is expressed by neuroblastoma cells About 6–8 frozen tissue sections (8 lm thick) were incubated with Trizol, and RNA was extracted as described above. cDNA was generated from 500 ng total RNA in a total volume of 20 ll using the QuantiTect Reverse Transcription Kit from Qiagen, and qPCR was performed with the AbsoluteTM Blue QPCR SYBRÒ Green Mix (Thermoscientific, Germany) using a MastercyclerÒ ep realplex (Eppendorf, Germany). 20 ng cDNA were mixed with the appropriate forward and reverse primers (1 lM) and Absolute Blue QPCR SYBR Green Mix (19) in a final volume of 25 ll. Expression levels of Ang-1, Ang-2, and VEGF-A were determined using the comparative Ct method (2-DDCt method) normalized to b-actin and relative to PBS-control mice. Microvessel density The frozen tissue sections (CAM and mice tumors) were thawed at room temperature for 10–20 min and fixed in

123

All neuroblastoma cell lines under study, Kelly, LAN-5, SK-N-FI, SK-N-LO, SK-N-AS, SH-EP, SH-SY5Y, NMB, showed expression of Ang-2 as evidenced by RT-PCR analysis (Fig. 1a). In contrast, Ang-1 expression was detected only in LAN-5, SK-N-AS, and NMB. Furthermore, Ang1 expression was much weaker compared to Ang-2. Immunoblotting for Ang-1 and Ang-2 confirmed these results on the protein level (Fig. 1b). For further experiments, we chose the neuroblastoma cell line Kelly. Ang-2 down-regulation by shRNA transfection in Kelly cells reduces cell proliferation and migration in vitro Transient transfection of a specific siRNA directed against Ang-2 inhibited its expression in the Kelly cell line as detected by RT-PCR (Fig. 2a). The hybridized oligonucleotides corresponding to the specific Ang-2 siRNA sequence as well as a

J Cancer Res Clin Oncol (2012) 138:2017–2026

2021

Fig. 1 Expression analysis of the angiopoietins in neuroblastoma cell lines. a Ang-1 and Ang-2 mRNA levels analyzed by RT-PCR. b-Actin served as an internal control. b Ang-1 and Ang-2 protein levels analyzed by western blotting

scrambled sequence for control were cloned into the pTER vector and used for stable transfection of shRNA into Kelly cells. Transfected Kelly cells showed a clear reduction of Ang2 expression in comparison with Kelly cells transfected with scrambled or wild-type Kelly cells, both at the RNA (Fig. 2b) and the protein level (Fig. 2c). These results were further confirmed by immunofluorescence showing a reduced expression of Ang-2 in the shRNA-transfected cells when compared to scrambled transfected cells or wild-type Kelly cells (Fig. 2d). Using the MTS cell proliferation assay, we could observe a significantly reduced proliferation of Ang-2 shRNAtransfected Kelly cells (1.25 ± 0.12) compared to scrambled shRNA-transfected cells (2.01 ± 0.45) and wild-type cells (2.12 ± 0.46) after 72 h (P \ 0.05; Fig. 3a). Moreover, cell migration assessed by the wound-healing assay was significantly reduced in Ang-2 shRNA-transfected cells (43 ± 1.75 %) compared to wild-type Kelly cells (76 ± 3.25 %) and scrambled shRNA-transfected Kelly cells (71 ± 2.75 %) after 72 h (P \ 0.05; Fig. 3b, c). Ang-2 down-regulation by shRNA transfection in Kelly cells reduces tumor formation and microvessel density in vivo In vivo growth of Kelly cells transfected by shRNA directed against Ang-2 on the CAM showed a significantly reduced volume (7.6 ± 3.09 mm3) compared to the scrambled shRNA-transfected Kelly cells (24.1 ± 2.81 mm3) or the wild-type Kelly cells (25.1 ± 2.9 mm3) (P \ 0.05; Fig. 4a, b). Furthermore, immunostaining for CD31 showed a significantly reduced number of microvessels in Ang-2 shRNA-transfected Kelly cells (2.7 ± 0.61) compared to

Fig. 2 Silencing of Ang-2 by siRNA in the neuroblastoma cell line Kelly. a Kelly cells were transiently transfected with 25 nM siRNA specific to Ang-2 or with a scrambled siRNA, and Ang-2 mRNA levels were analyzed by RT-PCR 72 h later. b-Actin served as an internal control. b, c Kelly cells were stably transfected with the shRNA expression vector pTer Ang-2 or pTer scrambled and selected using 15 lg/ml of zeocin. b Ang-2 mRNA levels were analyzed by RT-PCR. b-Actin served as an internal control. c Ang-2 protein levels were analyzed by Western blotting. d Immunofluorescence staining of Kelly cells stably transfected with the shRNA expression vector pTer Ang-2 or pTer scrambled. Secondary antibodies for Ang-2 were tagged with FITC (green), and cell nuclei were stained with DAPI (blue). All pictures are in 9200 magnification

scrambled shRNA-transfected Kelly cells (6.8 ± 0.71) and wild-type Kelly cells (7.77 ± 0.22) (P \ 0.01; Fig. 4c). L1–10 exhibits anti-angiogenic properties on the CAM Application of 10 lg L1–10 on the developing CAM (Day 10) induced an inhibition of capillaries formation, as observed after 48 h (Fig. 4d).

123

2022

J Cancer Res Clin Oncol (2012) 138:2017–2026

significant decrease of microvessel density (P \ 0.05; Fig. 5b), whereas Ang-2 mRNA level (Fig. 5c) and VEGF-A mRNA level (Fig. 5d) were not modified by L1–10 treatment. L1–10 treatment has no effect on advanced tumor growth in a neuroblastoma mouse model Mice were implanted s.c. with 20 9 106 Kelly cells, and L1–10 treatment (4 mg/kg BW, thrice weekly) was started on established tumors of approximately 100 mm3. Compared to PBS-control mice, L1–10 did not have any effect on tumor growth (Fig. 6a). However, microvessel density evaluated at the end of the treatment period was significantly reduced compared to PBS-control mice (P \ 0.05; Fig. 6b). No significant effect was observed on Ang-2 (Fig. 6c) and VEGF-A (Fig. 6d) mRNA expression on L1–10 treatment. To note, Ang-1 was not detected in tumors from both PBS-control and L1–10-treated mice. L1–10 treatment did not have any impact on mice body weight (data not shown).

Discussion

Fig. 3 In vitro characterization of Kelly cells transfected by pTer shRNA vector. a Wild-type, scrambled, and Ang-2-Kelly cells were incubated at 37 °C for 24, 48, or 72 h, and cell proliferation was assessed by MTS assay. Bar graphs represent the mean ± SEM of three independent assays (*P \ 0.05 vs wild-type Kelly cells). b Wild-type, scrambled, and Ang-2-Kelly cells were seeded in 6-well plates and allowed to grow overnight. A scratch was made on the cell monolayer the following day; the wound area was photographed after 0, 24, 48, and 72 h. c The distance covered by the cells was expressed as percentage of wound closure. Bar graphs represent the mean ± SEM of three independent assays (*P \ 0.05 vs wild-type Kelly cells)

L1–10 treatment started at tumor initiation reduces tumor growth in a neuroblastoma mouse model Mice were implanted s.c. in the right flank with 20 9 106 Kelly cells, and L1–10 treatment was simultaneously initiated (4 mg/kg BW, thrice weekly). Compared to PBScontrol mice, L1–10 inhibited tumor growth, with a statistically significant effect observed after 21 days of treatment (P \ 0.05; Fig. 5a). This was accompanied by a

123

Angiogenesis is a very complex process and it unlikely involves only one factor to occur in a particular tumor type. Many studies contributed to the identification of VEGF-A as a potent target, especially in the treatment for pediatric tumors, such as neuroblastoma (Ro¨ssler et al. 2008). However, VEGF targeting results in transient efficacy and tumors eventually develop resistance and escape the angiogenic blockade, pointing out the need for new complementary targets. In this context, anti-angiogenic approaches using inhibitors of the angiopoietin system are currently under development with the idea that Ang-2 inhibition may promote vessel stability and reduce angiogenesis. Interestingly, Ang-2 expression has been evidenced in neuroblastoma primary tumors and cell lines together with 7 other pro-angiogenic factors and correlated with advanced tumor stage in human neuroblastoma (Eggert et al. 2000). These findings support the need of studying Ang-2 involvement in this most common extracranial solid tumor in children. In the present work, we evidence the presence of high levels of Ang-2 mRNA and protein in 8 neuroblastoma cell lines, whereas only 3 cell lines exhibit Ang-1 mRNA and protein, with a much lower expression profile. Among these 8 neuroblastoma cell lines, we chose to further use the Kelly cells to investigate the role of Ang-2 in tumor development, using 2 different approaches: (1) the down-regulation of Ang-2 gene

J Cancer Res Clin Oncol (2012) 138:2017–2026

Fig. 4 In vivo characterization of Kelly cells transfected by pTer shRNA vector using a CAM assay. a Photographs of CAM tumors obtained 7 days after implantation of wild-type, scrambled, and Ang2-Kelly cells. b Tumor size. Bar graphs represent the mean ± SEM of three independent experiments (**P \ 0.01). c Microvessel density was determined by counting the CD31-positive vessels in a 9400 magnification field. Bar graphs represent the mean ± SEM microvessel density (**P \ 0.01). d Photographs of CAM control and CAM treated with 10 lg L1–10 after 48 h

expression or (2) the inhibition of Ang-2 protein interaction with its receptor Tie-2 using L1–10, a peptide antagonist. To achieve our first approach, we developed a DNA vector-based siRNA technology to effectively silence the

2023

expression of Ang-2 in Kelly cells. We could stably transfect Kelly cells with a shRNA construct and efficiently down-regulate Ang-2 expression in these cells. The reduced Ang-2 expression resulted in decreased cell proliferation as assessed by MTS assay and inhibition of cell migration and proliferation when used in a wound-healing assay. This indicates that Ang-2 is required for Kelly cells proliferation and migration. We next wanted to investigate whether this property has an effect in vivo on tumor formation and vascularization. For this purpose, we used these cells to induce tumor in a chick embryo model. Grafting of mammalian cells and tissues to the CAM is a well-established experimental system to evaluate many different parameters of tumor growth (Chambers et al. 1992). The ability of cells from solid cancers grafted to the CAM to reproduce many of the characteristics of tumors in vivo, including tumor mass formation, angiogenesis, and metastasis has been utilized in many studies, and the CAM model has been considered as an ideal alternative model system for cancer research, because it conveniently and inexpensively reproduces many of the tumor characteristics in vivo (Quigley and Armstrong 1998). In our study, grafting of wild-type Kelly cells on the CAM resulted in the formation of well-vascularized tumors, whereas grafting of Kelly cells transfected with Ang-2 shRNA resulted in reduced tumor formation and was associated with a lower microvessel density. This could be in accordance with an enhanced tumor endothelial cells apoptosis in response to Ang-2 blockage through the inhibition of Ang2-dependent Tie-2/Akt signaling pathway (Daly et al. 2006). These results indicate that Ang-2 plays an important role in neuroblastoma tumorigenesis, probably through a combined effect on tumor cells, as shown in vitro by a reduced cell proliferation, and through a pro-angiogenic effect. Knowing that Ang-2 acts as a context-specific antagonist of Ang-1/Tie-2 signaling, its involvement in angiogenesis occurs probably through the destabilization of the quiescent endothelial cell phenotype, resulting in loss of cell–cell contact leading to endothelial cell migration and new vessel formation. To further investigate the role of Ang-2 in neuroblastoma, we used as a second approach L1–10, an inhibitor of the Ang-2/Tie-2 receptor interaction, to treat mice xenotransplanted with Kelly cells. L1–10, a peptide–Fc fusion protein, has recently been used with success to inhibit the development of epidermoid and colorectal tumor xenografts (Oliner et al. 2004). In our present study, subcutaneous administration of L1–10 at the dose of 4 mg/kg, thrice weekly, starting at the same time as tumor initiation resulted in tumor growth inhibition compared to untreated mice, with a significant effect observed 21 days after tumor/treatment initiation, and a reduced microvessel density. L1–10 treatment did not cure the tumor, but

123

2024

J Cancer Res Clin Oncol (2012) 138:2017–2026

Fig. 5 Effect of angiopoietin-2 inhibition by L1–10 in vivo on tumor initiation in neuroblastoma-bearing mice. Tumors were initiated by s.c. injection of 20 9 106 Kelly cells and treatment with 4 mg/ kg L1–10 s.c. 3 times/week was simultaneously started (Day 0). a Effect on tumor growth. PBStreated mice were used as controls. Results show the mean ± SEM tumor size (mm3) in groups of 8 mice (*P \ 0.05 vs PBS control). b Microvessel density was determined by counting CD31-positive vessels in an 9400 magnification field. Bar graphs represent the mean ± SEM value of 7 tumors per groups (*P \ 0.05 vs PBS control). c Ang-2 and d VEGFA mRNA levels analyzed by quantitative real-time PCR. b-Actin served as an internal control. Bar graphs represent the mean ± SEM value relative to PBS-control tumors, with 6–8 tumors per groups

stabilized its growth, as previously observed with other tumor types and Ang-2 inhibitors (Oliner et al. 2004; Villeneuve et al. 2008). Although L1–10 decreased tumor volume, we observed a slight discordance between tumor volume and gene expression profile of Ang-2 and VEGF. Inhibition of Ang-2 using a specific inhibitor did exhibit slight increase in the expression of Ang-2, which is in accordance with the results of Morrissey et al. (2010). However, this increased expression of either Ang-2 or VEGF is not significant. In the tumor xenograft studies discussed so far, dosing began at the same time as tumor initiation. To better replicate conditions of established disease, tumors were allowed to grow for 14 days before L1–10 treatment started. In these conditions, treatment could not affect tumor growth suggesting that Ang-2 affects the early stages of tumor formation. This interesting phenomenon of Ang-2 was also previously reported (Nasarre et al. 2009). A comparative study between the growth of different tumors in wild-type and Ang-2-deficient mice revealed that though all the tumors under study grew slower in Ang-2-deficient mice, the tumor growth in both mice models dissociated only during early stages of

123

tumor development, whereas growth rates during later stages of primary tumor progression were similar. While very attractive as therapeutic target, previous studies have highlighted the complexity of Ang-2 function. It can agonize or antagonize the Tie-2 receptor and plays also opposite roles at the cellular or organism level promoting either vascular sprouting or regression, depending on whether VEGF is present (Maisonpierre et al. 1997). Systemic anti-Ang-2 therapy has been very beneficial in inhibiting tumor growth and angiogenesis in preclinical pharmacology models and has been well tolerated. In early clinical studies, specific Ang-2 inhibitors have shown promising antitumor activity as well as pharmacodynamic activity (Coxon et al. 2010). The distinct safety profile of anti-Ang-2 inhibitors in clinical studies suggests that they could be used with other VEGF inhibitors to achieve a combined disruption of tumor neovascularization and thereby improve clinical efficacy. In conclusion, our results demonstrate that inhibiting Ang-2 activity disrupts angiogenesis and tumor growth of neuroblastoma xenografts. Based on these data, we can conclude that Ang-2 inhibition along with other treatments

J Cancer Res Clin Oncol (2012) 138:2017–2026

2025

Fig. 6 Effect of angiopoietin-2 inhibition by L1–10 in vivo on established tumors in neuroblastoma-bearing mice. Tumors were initiated by s.c. injection of 20 9 106 Kelly cells and treatment with 4 mg/kg L1–10 s.c. 3 times/week was started when the tumor size was *100 mm3 (Day 14). a Effect on tumor growth. PBS-treated mice were used as controls. Results show the mean ± SEM tumor size (mm3) in groups of 8–10 mice. b Microvessel density was assessed after 26 days treatment by immunostaining of tumors for CD31. Microvessel density was determined by counting CD31positive vessels in an 9400 magnification field. Bar graphs represent the mean ± SEM value of 7–9 tumors per groups (*P \ 0.05 vs PBS control). c Ang-2 and d VEGF-A mRNA levels analyzed by quantitative real-time PCR. b-Actin served as an internal control. Bar graphs represent the mean ± SEM value relative to PBS-control tumors, with 6–10 tumors per groups

could represent a potential therapy for patients with metastatic malignancies. Acknowledgments We would like to thank Peter No¨llke for assistance in statistics and Christiane Olk-Batz and Nora Fischer for assistance in qPCR. The work was supported by a grant of the Wissenschaftliche Gesellschaft Freiburg. Saritha S D’Souza received a short-term scholarship of the Deutscher Akademischer Austausch Dienst (DAAD). Conflict of interest conflict of interest.

All authors disclose no financial and personal

References Azam F, Mehta S, Harris AL (2010) Mechanisms of resistance to antiangiogenesis therapy. Eur J Cancer 46:1323–1332 Chambers AF, Shafir R, Ling V (1992) A model system for studying metastasis using the embryonic chick. Cancer Res 42:4018– 4025 Coxon A, Bready J, Min H, Kaufman S, Leal J, Yu D et al (2010) Context-dependent role of angiopoietin-1 inhibition in the suppression of angiogenesis and tumor growth: implications for AMG 386, an angiopoietin-1/2-neutralizing peptibody. Mol Cancer Ther 9:2641–2651

Daly C, Pasnikowski E, Burova E, Wong V, Aldrich TH, Griffiths J et al (2006) Angiopoietin-2 functions as an autocrine protective factor in stressed endothelial cells. Proc Natl Acad Sci USA 103:15491–15496 Davis S, Aldrich TH, Jones PF, Acheson A, Compton DL, Jain V et al (1996) Isolation of angiopoietin-1, a ligand for the tie-2 receptor, by secretion-trap expression cloning. Cell 87:1161–1169 Dickson PV, Hamner JB, Sims TL, Fraga CH, Ng CY, Rajasekeran S et al (2007) Bevacizumab induced transient remodelling of the vasculature in neuroblastoma xenografts results in improved delivery and efficacy of systemically administered chemotherapy. Clin Cancer Res 13:3942–3950 Eggert A, Ikegaki N, Kwiatkowski J, Zhao H, Brodeur GM, Himelstein BP (2000) High-level expression of angiogenic factors is associated with advanced tumor stage in human neuroblastomas. Clin Cancer Res 6:1900–1908 Fiedler U, Reiss Y, Scharpfenecker M, Grunow V, Koidl S, Thurston G et al (2006) Angiopoietin-2 sensitizes endothelial cells to TNF-alpha and has a crucial role in the induction of inflammation. Nat Med 12:235–239 Heath VL, Bicknell R (2009) Anticancer strategies involving the vasculature. Nat Rev Clin Oncol 6:395–404 Hu B, Cheng SY (2009) Angiopoietin-2: development of inhibitors for cancer therapy. Curr Oncol Rep 11:111–116 Imhof BA, Aurrand-Lions M (2006) Angiogenesis and inflammation face off. Nat Med 12:171–172 Lagodny J, Ju¨ttner E, Kayser G, Niemeyer CM, Ro¨ssler J (2007) Lymphangiogenesis and its regulation in human neuroblastoma. Biochem Biophys Res Commun 352:571–577

123

2026 Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C et al (1997) Angiopoietin- 2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277:55–60 Morisada T, Kubota Y, Urano T, Suda T, Oike Y (2006) Angiopoietins and angiopoietin-like proteins in angiogenesis. Endothelium 13:71–79 Morrissey C, Dowell A, Koreckij TD, Nguyen H, Lakely B, Fanslow WC et al (2010) Inhibition of angiopoietin-2 in LuCaP 23.1 prostate cancer tumors decreases tumor growth and viability. Prostate 70:1799–1808 Nasarre P, Thomas M, Kruse K, Helfrich I, Wolter V, Deppermann C et al (2009) Host-derived angiopoietin-2 affects early stages of tumor development and vessel maturation but is dispensable for later stages of tumor growth. Cancer Res 69:1324–1333 Oliner J, Min H, Leal J, Yu D, Rao S, You E et al (2004) Suppression of angiogenesis and tumor growth by selective inhibition of angiopoietin-2. Cancer Cell 6:507–516 Parikh SM, Mammoto T, Schultz A, Yuan HT, Christiani D, Karumanchi SA et al (2006) Excess circulating angiopoietin-2 may contribute to pulmonary vascular leak in sepsis in humans. PLoS Med 3:e46 Quigley J, Armstrong P (1998) Tumor cell intravasation alu-cidated: the chick embryo opens the window. Cell 94:281–284 Ro¨ssler J, Taylor M, Geoerger B, Farace F, Lagodny J, Peschka-Su¨ss R et al (2008) Angiogenesis as a target in neuroblastoma. Eur J Cancer 44:1645–1656 Ro¨ssler J, Monnet Y, Farace F, Opolon P, Daudigeos-Dubus E, Bourredjem A et al (2011) The selective VEGFR1-3 inhibitor axitinib (AG-013736) shows antitumor activity in human neuroblastoma xenografts. Int J Cancer 128:2748–2758 Sarraf-Yazdi S, Mi J, Moeller BJ, Niu X, White RR, Kontos CD et al (2008) Inhibition of in vivo tumor angiogenesis and growth via systemic delivery of an angiopoietin-2 specific aptamer. J Surg Res 146:16–23 Sato A, Iwama A, Takakura N, Nishio H, Yancopoulos GD, Suda T (1998) Characterization of TEK receptor tyrosine kinase and its ligands, angiopoietins, in human hematopoietic progenitor cells. Int Immunol 10:1217–1227

123

J Cancer Res Clin Oncol (2012) 138:2017–2026 Segerstrom L, Fuchs D, Backman U, Holmquist K, Christofferson R, Azarbayjani F (2006) The anti-VEGF antibody bevacizumab potently reduces the growth rate of high-risk neuroblastoma xenografts. Pediatr Res 60:576–581 Shim WS, Ho IA, Wong PE (2007) Angiopoietin: a TIE(d) balance in tumor angiogenesis. Mol Cancer Res 5:655–665 Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis S et al (2009) Requisite role of angiopoietin-1, a ligand for the tie-2 receptor, during embryonic angiogenesis. Cell 87:1171–1180 Teichert-Kuliszewska K, Maisonpierre PC, Jones N, Campbell AI, Master Z, Bendeck MP et al (2001) Biological action of angiopoietin-2 in a fibrin matrix model of angiogenesis is associated with activation of Tie2. Cardiovasc Res 49:659–670 Tressel SL, Huang RP, Tomsen N, Jo H (2007) Laminar shear inhibits tubule formation and migration of endothelial cells by an angiopoietin-2 dependent mechanism. Arterioscler Thromb Vasc Biol 27:2150–2156 Tressel SL, Kim H, Ni CW, Chang K, Velasquez-Castano JC, Taylor WR et al (2008) Angiopoietin-2 stimulates blood flow recovery after femoral artery occlusion by inducing inflammation and arteriogenesis. Arterioscler Thromb Vasc Biol 28:1989–1995 Tuschl T (2001) RNA interference and small interfering RNAs. ChemBioChem 2:239–245 Tuschl T (2002) Expanding small RNA interference. Nat Biotechnol 20:446–448 Villeneuve J, Galarneau H, Beaudet MJ, Tremblay P, Chernomoretz A, Vallie`res L et al (2008) Reduced glioma growth following dexamethasone or anti-angiopoietin 2 treatment. Brain Pathol 18:401–414 Ward NL, Dumont DJ (2002) The angiopoietins and Tie2/Tek: adding to the complexity of cardiovascular development. Semin Cell Dev Biol 13:19–27 Weidner N, Semple JP, Welch WR (1991) Tumor angiogenesis and metastasis—correlation in invasive breast carcinoma. N Engl J Med 324:1–8 Zhang L, Smith KM, Chong AL, Stempak D, Yeger H, Marrano P et al (2009) In vivo antitumor and antimetastatic activity of sunitinib in preclinical neuroblastoma mouse model. Neoplasia 11:426–435