Apoptosis (2011) 16:606–618 DOI 10.1007/s10495-011-0594-0

ORIGINAL PAPER

Apoptosis induced by an antagonist peptide against HPV16 E7 in vitro and in vivo via restoration of p53 Caiping Guo • Kewei Liu • Yi Zheng • Haibo Luo • Hongbo Chen • Laiqiang Huang

Published online: 8 April 2011 Ó Springer Science+Business Media, LLC 2011

Abstract Human papilloma virus type 16 (HPV16) E7 is a viral oncoprotein that is believed to play a major role in cervical neoplasia. A novel antagonist peptide against HPV16 E7 was previously selected by phage display screening and the selected peptide was found to have antitumor efficacy against HPV16-positive cervical carcinoma through induction of cell cycle arrest. In the current study, to further elucidate the mechanisms of the antagonist peptide, the effects of the peptide on apoptosis are investigated by RT-PCR, Western blotting, MTT assay, TUNEL staining, Annexin V apoptosis assay, flow cytometry, and animal experiments. The antagonist peptide showed obvious anti-tumor efficacy through apoptosis induction, both in HPV16-positive cervical cancer cell lines and tumor xenografts. Our results also revealed that the peptide induced accumulation of cellular p53 and p21, and led to HPV16 E7 protein degradation. In the case of mRNA levels, it resulted in unaltered p53 and HPV16 E7 expression, but increased expression of p21. In contrast, the induction of apoptosis and p53 reactivation effects by the selected peptide were abolished after E7 knocked down with siRNA. These results demonstrate that the selected peptide can induce E7 degradation and lead to marked apoptosis in HPV16-related cancer cells by activating cellular p53 and its target genes, such as p21. Furthermore,

C. Guo  K. Liu  Y. Zheng  H. Luo  H. Chen  L. Huang School of Life Sciences, Tsinghua University, Beijing 100084, China C. Guo  K. Liu  Y. Zheng  H. Luo  H. Chen  L. Huang (&) The Shenzhen Key Lab of Gene and Antibody Therapy, Center for Biotech & BioMedicine and Division of Life Sciences, Graduate School at Shenzhen, Tsinghua University, The University Town, Shenzhen, Guangdong 518055, China e-mail: [email protected]

123

the evident therapeutic efficacy obtained from the subcutaneous tumor model experiments in nude mice suggests a therapeutic potential for HPV16-related cancers of the selected peptide. Therefore, this specific peptide may be used to create specific biotherapies for the treatment of HPV 16-positive cervical cancers. Keywords Antagonist peptide  Cervical cancer  E7 protein  HPV  Apoptosis  p53

Introduction Cervical cancer is the second leading cause of cancer death in women worldwide. In the past 20 years, a large number of studies have suggested that the role of high-risk human papilloma virus (HPV) is critical for the occurrence and development of cervical cancer [1, 2]. The oncogenic function of HPVs has been primarily attributed to E6 and E7, the two major HPV oncoproteins. They are selectively expressed in cervical cancer cells to inactivate tumor suppressor proteins such as p53 and Rb, leading to cell cycle disorder, telomerase activation, and cell immortalization. Their continued expression is essential for the malignant transformation and maintenance of tumor cells [3–7]. E6 is able to induce the degradation of p53, thereby inhibiting p53-dependent signaling, and contributing to tumorigenesis [8–10]. In the case of the HPV-E7, deregulation of the host cell cycle seems a major function of the oncoprotein. It is associated with the retinoblastoma family of proteins (pRb, p107, and p130) and prevents G1 arrest in response to a variety of anti-proliferative signals, such as growth factor withdrawal, loss of cell adhesion, and DNA damage [11]. It also has the potential to eliminate G2/M checkpoint control, inducing genetic instability via its

Apoptosis (2011) 16:606–618

ability to induce abnormal centrosome numbers and multipolar mitotic spindles [12, 13]. However, increasing evidence indicates that E7 modulates additional cellular regulatory pathways, and these interactions contribute to its tumorigenic activity. Deregulation of cell proliferation by HPV-E7 may also contribute to the ability of E7 to induce apoptosis [14, 15], as E7-dependent apoptosis in vitro is often observed when E7-expressing cells are kept under growth-suppressive conditions [14, 16, 17]. However, depending on the cell type and the viral type, the E7 oncoprotein can also inhibit apoptosis and decrease sensitivity to cytokine-mediated cell death. For example, the HPV-16 E7 oncoprotein reportedly inhibits TNF-a-mediated apoptosis and caspase8 activation in normal human fibroblasts [18]. Similarly, reduced apoptosis in HaCaT cells expressing E7 was also observed after exposition to genotoxic stress, such as the alkylating agent mitomycin C or UVC [19]. HPV-16 E7 has recently been reported to interact with the pro-apoptotic cellular factor Siva-1, which inhibits apoptosis in UV radiation-exposed HaCaT cells. Interestingly, HPV-16 E7 appeared capable of interfering with the binding of Siva-1 to Bcl-XL in vitro, and the released Bcl-XL could possibly exert fully its anti-apoptotic function [20]. In addition, E7-expressing HaCaT cells modulate expression of several genes in response to oxidative stress. In these cells, the expression of catalase and Bcl-XL are increase, and the expression of IL-18, Fas, and Bad are decreased, resulting in resistance to oxidative stress-induced cell death [21]. Specific peptide aptamers that target E7 have also been demonstrated to induce apoptosis in cervical carcinoma cells [22], implying that E7 may be involved in the suppression of cell death. However, the precise mechanisms by which E7 suppresses apoptosis remain unclear. The treatment of cervical cancer is currently based on surgery, radiotherapy, and the use of chemotherapeutic drugs. Radiotherapy fails to control the progression of cervical cancer in 35–90% of women with locally advanced diseases [23], whereas chemotherapy has many side effects because it discriminates poorly between target and normal cells or tissues. Novel therapeutic strategies target the HPV oncoproteins E6 and/or E7 [24, 25] or their mRNA coding. Some studies have shown that antisense and peptide aptamers that target HPV E6/E7 can induce target cell apoptosis [26–32]. Therefore, strategies for achieving specific and selective antagonist peptide to abrogate E7 function may be a rational therapeutic approach for treating HPV-positive carcinoma of the cervix [33]. In a previous study, we screened for an HPV16 E7 antagonist from a C7C phage library and found a novel peptide against HPV16 E7 (namely Pep-7). The peptide selectively represses the proliferation of HPV16-positive

607

cervical carcinoma cells by inducing cell cycle arrest via rescuing the pRb/E2F pathway (unpublished data). In the present study, the anti-tumor mechanisms of the peptide are further investigated. We demonstrate that the selected peptide induces massive apoptosis in HPV16-related cancer cells by activating cellular p53 and p21. More encouragingly, subcutaneous tumor model experiments show that the peptide completely removes tumor xenografts at a dosage 160 lg/mouse/day. In light of these results, there is strong evidence that the selected peptide is a ‘‘good candidate’’ for the treatment of HPV16-related neoplasms.

Materials and methods Cell lines HPV16-positive SiHa and CaSki cervical carcinoma cells were supplied by the China Center for Type Culture Collection (CCTCC). Other cell lines HPV18-positive HeLa cervical carcinoma cells, CNE nasopharyngeal carcinoma cells, HaCat human keratinocyte cells, 293T (human kidney epithelial cells), and NIH/3T3 mouse embryonic fibroblast cells, used in this experiment came from our laboratory. All cells were maintained in a humidified 5% CO2 atmosphere, Dulbecco’s modified Eagle’s medium (DMEM, pH 7.2), supplemented with 10% fetal calf serum (FCS). Antibodies and reagents Mouse anti-HPV16E7, mouse anti-p21, and mouse antip53 antibodies were supplied by Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG and HRP-conjugated goat anti-rabbit IgG were supplied by Amersham Biosciences (Piscataway, NJ, USA) and KPL (Gaithersburg, MD, USA), respectively. Mouse anti-HPV18E7 and mouse anti-HPV58E7 serum were prepared in our laboratory. The TMB substrate kit was obtained from eBioscience Inc. (San Diego, CA, USA). DMEM, trypsin, and TRIzol reagent were supplied by Invitrogen (Carlsbad, CA, USA). Fetal calf serum (FCS) was purchased from Sijiqing (Hangzhou, P.R. China). 3-(4,5)-Dimethylthiazol (-2-y1)3,5-diphenyltetrazolium bromide (MTT) and dimethylsulfoxide (DMSO) were supplied by the Sigma Chemical Co. (St. Louis, MI, USA). Annexin V-FITC/PI staining apoptosis assay kit was supplied by Kengentec (Nanjing, P.R. China). Terminal deoxynucleotidyl transferase-mediated UTP nick end labeling (TUNEL) in situ cell death detection kit and fluorescein were supplied by Roche Diagnostics (Shanghai) Limited (Shanghai, P.R. China).

123

608

All other chemicals were of analytical grade and obtained from local commercial resources. Peptide affinity and specificity determination The specificity and affinity of the peptides were determined by competitive ELISA. Microtiter wells were coated with antigen protein (HPV16 E7, HPV18 E7, or HPV58 E7) at 400 ng/well and incubated overnight at 4°C. Then, peptides at different concentrations were incubated with the E7-coated microtiter wells for 2 h at 37°C. Thereafter, the unbound E7 proteins were tested with the corresponding antibodies, and the reaction was revealed by incubation with HRP-conjugated goat anti-mouse antibodies (KPL, Gaithersburg, MD, USA), followed by TMB substrate coloration (eBioscience, San Diego, CA, USA) for colorimetric evaluation. The absorbance value was measured at 450 nm (A450) on a microplate reader. The affinity constant is defined as the peptide concentration required to inhibit 50% maximal binding of the antibodies mixed with the solvent only and is expressed as IC50 (mM). Half-life measurement SiHa cells seeded in 6-well plates were treated with or without 80 lM Pep-7 for 24 h. The cells were then treated with 50 lg/ml cycloheximide for 0–4 h. The cell lysates collected at different time points were subjected to Western blotting as above. Band intensity was used to determine the proteins half-life. siRNA synthesis and cell transfection The siRNAs were synthesized by Shanghai Gene Pharma Co., Ltd. (Shanghai, P.R. China), as follows: E7 siRNA (target sequence: GCTTCGGTTGTGCGT) [34], sense: 50 -GCUUC GGUUGUGCGUACAA dTdT-30 , antisense: 50 -UUGUAC GCACAACCGAAGC dTdT-30 , negative controls siRNA, sense: 50 -UUCUCCGAACGUGUCACGUTT-30 , antisense: 50 -ACGUGACACGUUCGGAGAATT-30 . Human SiHa cells were seeded in 6-well plate at a density of 5 9 105 cells/well. The following day, cells were transfected with HPV16E7 siRNA and negative control siRNA respectively, using LipofectamineTM 2000 as described in the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). Cell viability assay Cell viability was determined with an MTT assay. Briefly, the cells were seeded into 96-well plates at a density of 4–5 9 103 cells/well. The cells were allowed to recover for 24 h before the medium was replaced with DMEM

123

Apoptosis (2011) 16:606–618

supplemented with the selected or negative control peptide at different concentrations. The solvent of the peptides was set as the control. The peptide-supplemented medium was replaced daily and the respective concentrations were maintained. The cells were subjected to an MTT cell proliferation assay after 72 h treatment. The plates were incubated at 37°C for 3 h with the addition of MTT (5 mg/ml, 20 ll/well). Untransformed MTT in the solution was removed by aspiration. The formazan product was dissolved in DMSO, and plates were shaken vigorously at room temperature for 10–15 min to ensure complete solubilization. The optical density of the formazan solutions was measured by microplate reader at 540 nm. Western blot Western blotting was carried out as described previously [35, 36]. The cells were seeded into 6-well plates, allowed to attach to the substrate overnight, and then treated with or without 80 lM Pep-7. After another 48 h of treatment, the cells were lysed in lysis buffer (Beyotime Institute of Biotechnology, Haimen, Jiangshu, China) containing PMSF (Sigma Chemical Co., St. Louis, MI, USA) for 30 min at 4°C. The lysate was then centrifuged for 20 min at 13,000 rpm and 4°C. The proteins were then separated through SDS-PAGE and transferred onto the PVDF membrane (ImmobionÒ-P Transfer Membrane, Millipore Corp., Billerica, MA, USA). Membranes were blocked in a Tris-buffered saline with 0.1% Tween-20 (TBS-T) solution with 5% nonfat dry milk and incubated overnight with primary antibodies at 4°C. The immunoreactive signals were detected by HRP-conjugated secondary antibodies (KPL, Gaithersburg, MD, USA.) followed by SuperSignalÒ West Pico Chemiluminescent Substrate (Thermo Scientific, Milford, MA, USA.). Anti-b-actin antibodies were used to control protein loading. For the in vivo studies, tumors were harvested, and the cell lysates were prepared and transferred to a clean Eppendorf tube and centrifuged for 30 min at 14,000 rpm. The supernate was probed by western blotting, as described above. RNA extraction and qRT-PCR Total RNA was extracted from the cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) as specified by the manufacturer’s instructions. qRT-PCR was used to confirm the mRNA expression levels. Reverse transcription and qPCR was performed according to the protocol of Reverse Transcriptase SystemTM and SYBRÒ premix Ex TaqTM (Perfect Real Time) (TaKaRa, Dalian, China) on the ABI 7300 Real Time PCR System (AB Applied Biosystems, Foster City, CA, USA) supplied with analytical software. b-actin mRNA levels were used for

Apoptosis (2011) 16:606–618

normalization. Each sample was determined in triplicate. The results represent means ± SE from three experimental runs. The primers used for real-time PCR [35, 36] are listed as follows: P21 sense, 50 -TTCCGCACAGGAGCAAAG T-30 ; P21 antisense, 50 -CGGCGCAACTGCTCACT-30 ; 16E7 sense, 50 -CG GAATTCCCACCATGCATGGAGAT ACACCTACA-30 ; 16E7 antisense, 50 -CGGGATCCCGTG GTTTCTGAGAACAGATGG-30 ; p53 sense, 50 -AAGATC CGCGGGCGTAA-30 ; p53 antisense, 50 -CATCCTTTAAC TCTAAGGCCTCATTC-30 . Annexin V-FITC/PI apoptosis detection The cells were seeded at a density of 2 9 105 cells/well in 12-well plates and incubated overnight. Cells were then exposed to Pep-7 at concentrations of 32 and 80 lM for 24 or 48 h. After treatment, all cells were collected and subjected to Annexin V-FITC/PI staining (Kengentec, Nanjing, P.R. China) assay, as specified by the manufacturer. The apoptosis rate was then analyzed by flow cytometry analysis performed on an Epics-XL flow cytometer (Beckman Coulter, Inc. Brea, CA USA). For siRNA transfected cells, Pep-7 was added into the cell medium 24 h post transfection and maintained for 48 h. Thereafter, the apoptosis detection was performed as described above. TUNEL analysis The cells were seeded onto coverslips (placed in 12-well plates) at the density of 2 9 105 cells/well. At 24 h post seeding, the medium was replaced with DMEM without or with Pep7 at concentrations indicated in the figures. After another 24 h incubation, TUNEL analysis was performed with in situ cell death detection kit, Fluorescein (Roche, Shanghai P.R. China) as specified by the manufacturer. TUNEL-positive cells were visualized by immunofluorescence microscopy, using an FV1000 scanning laser microscope (OLYMPUS, JAPAN) equipped with FV10-ASW1.7 software. For the tumor specimen assay, the paraffinembedded sections were dewaxed, rehydrated, and the antigen was retrieved. Then the sections were subjected to TUNEL analysis as described above. The TUNEL-positive cells were visualized by immunofluorescence microscopy under a Leica DMI 6000B equipped with Leica AF6500 software (Leica Mikrosysteme Vertrieb GmbH, Wetzlar, Germany). Illustrations were organized using Adobe Photoshop. TUNEL positive and negative cells were counted. At least 500 total cells were counted in each case. Mice maintenance and subcutaneous tumor model Female Balb/C-nu/nu mice were supplied by the Medical Experimental Animal Center of Guangdong Province

609

(Guangdong, China). The care and use of laboratory animals was approved by the Tsinghua University Animal Care and Use Committee. A subcutaneous tumor model of nude mice was constructed. Six-week-old female nude mice (18 ± 2 g) were subcutaneously inoculated with 1.5 9 107 SiHa cells. When the tumor size reached about 100 mm3, the mice were randomly divided into four groups with six mice each. The groups were treated everyday with intratumoral injections of PBS or Pep-7 at doses of 16, 80, and 160 lg/ mouse, respectively. Every 3 days, tumor sizes were measured with a caliper and the weight of each mouse was measured with a scale. Tumor volume was calculated using ‘‘volume = length 9 width2/2.’’ The treatment was performed for 15 days. The mean tumor volume and mouse weight were used to construct tumor growth and mouse growth curves to evaluate efficiency and toxicity. At the end of the treatment, the mice in each group were sacrificed and dissected. The heart, liver, lungs, spleen, kidneys, and other organs were checked for signs of toxicity, and the weights of the detached tumors were measured. The tumor growth inhibition ratio was represented as the tumor weight relative to the control and calculated using the formula, ‘‘Relative tumor weight (% of control) = average tumor weight of treatment group/average tumor weight of control group 9 100%.’’ Tumor specimens were then prepared as paraffin-embedded sections for TUNEL assay and HPV16E7 and p53 immunohistochemical staining. To determine further whether the anti-tumor efficacy of Pep-7 is sequence-dependent, the effect on tumor xenografts growth was compared among PBS, a negative control peptide (named ‘‘N-pep’’), and Pep-7. A similar subcutaneous tumor model of nude mice was constructed and divided into three groups. The treatment and evaluation were processed as mentioned above, except PBS, 80 lg N-pep, or Pep-7 were administered to each mouse from the corresponding groups.

Immunohistochemistry HPV16 E7 and p53 expression in the tumor tissues were immunohistochemically assessed as previously described [37]. Immunostaining was performed on formalin-fixed, paraffin-embedded sections using mouse anti-HPV16E7 and anti-p53 monoclonal antibodies. Before the application of the primary antibodies, an antigen retrieval technique was performed. The deparaffinized and rehydrated slides were placed in 10 mmol/l citrate buffer (pH 6.0) and heated in a microwave oven for 15 min at 700 W. H2O2 was used to inhibit endogenous alkaline phosphatase. The slides were incubated overnight with anti-p53 antibodies at 4°C under dilutions of 1:100. The associated antibodies were detected

123

610

using the streptavidin–biotin complex (SABC) method (Wuhan Boster Biological Technology, Ltd., Wuhan, P.R. China.) according to the manufacturer’s instructions. Stained slides were examined under a Nikon ECLIPSE TE2000-U microscope (Nikon Corporation, Tokyo, Japan) and images were collected and analyzed with Pixera Penguin 600CL DiRactorTM (Pixera Corporation, Los Gatos, CA, USA) [38].

Statistics and data analysis All cell culture-based experiments were repeated at least three times unless otherwise indicated. Images of cell apoptosis, Western blotting, and immunostaining results from representative experiments are presented. The figures were created using Adobe PhotoshopÒ CS graphics program. All data were analyzed by paired t test using SPSS 11.0 software. Differences were considered statistically significant at P \ 0.02.

Fig. 1 Affinity, specificity, and effect of Pep-7 on HPV16 E7 a affinity of Pep-7 and N-pep with the E7 protein of various HPV types, expressed as IC50 from competitive ELISA (N/A: not detected in the experiment); b half-life study of HPV16E7 with or without Pep-7 treatment. The SiHa cells, incubated with or without 80 lM Pep-7, were treated with 50 lg/ml cycloheximide for 0–4 h, and the cells were harvested for Western blotting. The band intensity of E7 against b-actin was used to determine the halflife of the protein

123

Apoptosis (2011) 16:606–618

Results Pep-7 binds to HPV16 E7 and induces its degradation The specificity and affinity of Pep-7 for HPV16 E7 was determined by competitive ELISA. The IC50 of Pep-7 and N-pep for E7 proteins from different types of HPV are summarized in Fig. 1a. The IC50 of Pep-7 for HPV16 E7 was approximately 0.458 mM, whereas those for HPV18 E7 and HPV58 E7 were estimated to be greater (more than 1 mM). Meanwhile, N-pep showed low affinity to HPV16 E7 proteins, as the IC50 was also more than 1 mM. These results suggest that Pep-7 could bind to HPV16 E7 specifically with high affinity. The effect of Pep-7 binding on HPV16 E7 stabilization was tested. Measurements of the half-life of E7were carried out on SiHa cells as described in ‘‘Materials and methods’’ section. As indicated in Fig. 1b, the half-life of the E7 protein was markedly reduced by Pep-7, from 2.5 ± 0.42 h to about 1 h, suggesting that Pep-7 greatly induced HPV16 E7 degradation.

Apoptosis (2011) 16:606–618

611

The peptide pep-7 suppresses cell proliferation in HPV16-positive cell lines specifically

Pep-7 induces cell apoptosis in HPV16-positive cell lines

We have previously found that the selected peptide Pep-7 inhibits HPV16-positive CaSki cells in time- and dosedependent manners (unpublished data). In the current study, the effect of Pep-7 on the growth of the other cell lines was tested using an MTT assay. Similar to the results with CaSki cells, Pep-7 suppressed cell proliferation of SiHa cells, another HPV16-positive cervical carcinoma cell line, in time- and dose-dependent manners, whereas the negative control peptide N-pep did not show any effect on cell viability at the same concentrations (Fig. 2a, b). A comparison growth experiment performed among six different cell lines, including the HPV16-positive cell lines CaSki, and SiHa, the HPV18-positive cervical cancer cell line HeLa, and HPV-negative cell lines CNE, HaCat, and NIH 3T3, indicated that Pep-7 significantly repressed the proliferation of SiHa and CaSki cells. However, it showed negligible effect on the propagation of HeLa, and the HPV-negative cell lines (Fig. 2c). Results revealed that repression of cell growth was highly specific to HPV16.

SiHa cells were treated with Pep-7 and then subjected to Annexin V-FITC/PI staining apoptosis assay by flow cytometry. As shown in Fig. 3a–d, the apoptosis rate of SiHa cells was increased slightly from 6.7 to 14.2% when treated with Pep-7 at dose of 32 lM for 24 h; Pep-7 significantly induced apoptosis in SiHa cells with treatment for 48 h at concentrations above 32 lM (P \ 0.02). The apoptosis rate of SiHa cells treated with 80 lM Pep-7 for 48 h reached up to 33.85%, dramatically higher than that of the cells in the control group. Next, the apoptosis induction effect of Pep-7 was further confirmed in the CaSki cell line by TUNEL. CaSki cells seeded onto coverslips were treated with Pep-7 at concentrations indicated in Fig. 3 for 48 h. Then, the cells were subjected to TUNEL assay as described in ‘‘Materials and methods’’ section. Results similar to those of the Annexin V-FITC/PI assay were obtained. Pep-7 clearly induced apoptosis in CaSki cells. The percentage of the TUNEL-positive (indicating apoptosis) cells increased from 7.14% (control) to 24.15% when treated with 32 lM Pep-7, and to 35.06% when treated

Fig. 2 Cell proliferation effects of Pep-7. Cell viability was tested by the MTT assay and presented as a percentage of A540 relative to the control cells. Results are presented as the mean ± SE obtained from at least two independent experiments run in sextuplicate. a The time- and dose-dependent effects of Pep-7 on SiHa cell growth; b N-pep effect on SiHa cell growth; c comparison of the effects of 80 lM Pep-7 on cell proliferation in the cell lines indicated (*P \ 0.02)

123

612

Apoptosis (2011) 16:606–618

Fig. 3 Apoptosis induction by Pep-7 in HPV16-positive cells. Apoptosis was tested by Annexin V-FITC/PI staining or TUNEL staining apoptosis assay after treatment with Pep-7 at the indicated concentrations. Quantification data are presented as the mean ± SE from three independent experiments (scale bar, 20 lm; *P \ 0.02; **P \ 0.01). a The apoptosis rate in the SiHa cells was analyzed by Annexin V staining and flow cytometry after 24 h treatment with Pep7; b representative image of flow cytometry after Annexin V staining

of the SiHa cells after 24 h treatment with Pep-7; c the apoptosis rate in the SiHa cells was analyzed by Annexin V staining and flow cytometry after 48 h treatment with Pep-7; d representative image of flow cytometry after Annexin V staining of the SiHa cells after 48 h treatment with Pep-7; e the apoptosis rate of the CaSki cells tested by TUNEL staining after 48 h treatment with Pep-7; f representative image of TUNEL staining of the CaSki cells after 48 h treatment with Pep-7

with 80 lM Pep-7. The differences are statistically significant (Fig. 3e, f, P \ 0.02), confirming that Pep-7 significantly induced apoptosis both in SiHa cells and in CaSki cells with treatment for 48 h at the high dose (above 32 lM), though the apoptosis induction effect was slighter with treatment for shorter time and at lower concentrations. This is consistent with the results of the MTT assay, which showed a cell viability repression of Pep-7 in a time- and dose-dependent manner.

of p21, a p53-responsive gene product [39], in SiHa cells was observed following the Pep-7 treatment. Compared with the results of the cells treated with the solvent (control), the expression of p53 and p21 protein increased in the SiHa cells treated with 80 lM Pep-7 by 84 and 104%, respectively, though they did not change much in the 32 lM Pep-7 treatment group. Meanwhile, the expression of 16E7 decreased by 79% in the SiHa cells treated with 32 lM Pep7, and 68% when treated with 80 lM Pep-7. The RT-PCR results revealed that the p21 mRNA levels increased by more than 90% with Pep-7 treatment in both the SiHa and CaSki cell lines (Fig. 4c). In contrast, the mRNA levels of HPV16-E7 and p53 in the treated cells appear unaffected compared with that in the control group (Fig. 4c, P [ 0.05). This indicates that the peptide restored functional p53 protein by facilitating E7 protein degradation, which promoted p21 transcription.

Pep-7 regulates cellular accumulation of p53 and p21 Considering that apoptosis usually paralleled the augmentation of the p53 protein, we investigated whether the peptide-induced apoptosis correlated with alterations in p53. As shown in Fig. 4a and b, in line with a strong reduction of E7, an obvious accumulation of p53 and concomitant induction

123

Apoptosis (2011) 16:606–618

613

Fig. 4 Restoration of p53 by Pep-7 in HPV16-positive cells (a and b). Western blot analysis of SiHa cells at 48 h post treatment with Pep-7 at the indicated concentrations. b-actin antibodies were set as the loading control. Relative levels of p53, p21, and E7 calculated from the band intensities are shown (a); c the RNA levels of p53, HPV16 E7, and p21 in the SiHa cells treated with 80 lM Pep-7 for 48 h were measured by qRT-PCR. b-actin mRNA levels were used for normalization (*P \ 0.02)

Pep-7 depends on HPV16 E7 protein to induce cell apoptosis To characterize further the induction of apoptosis by Pep-7, HPV16 E7 expression in SiHa cells was knocked down by transient transfection with E7 siRNA, as described in ‘‘Materials and methods’’ section. The cells were treated for 48 h with or without 80 lM Pep-7 at 24 h post transfection. The frequency of apoptosis was determined in situ by TUNEL staining. For quantification of the results, the number of TUNEL-positive cells was determined (Fig. 5b). As shown in Fig. 5a and b, Pep-7 significantly increased the fraction of TUNEL-positive cells in the cells transfected with negative control siRNA. The apoptosis ratio increased from 3.6 to 32.5% when treated with 80 lM Pep7. These results are in line with those of the Annexin V and TUNEL experiments on the parental SiHa and CaSki cell lines. When the E7 protein was knocked down, the Pep-7 treatment had no significant influence on the rate of apoptosis. The fraction of TUNEL-positive cells is similar in both the untreated groups and the Pep-7 treated groups,

25.1 and 26.9%, respectively (Fig. 5b), suggesting that induction of apoptosis by Pep-7 depends strictly on the presence of the HPV16 E7 protein. The results of Annexin V apoptosis assay in HeLa cells, which indicated that Pep-7 had negligible effect on HeLa cell apoptosis (data not shown), provided evidence for this correlation. Furthermore, the protein levels of E7, p53, and p21 were studied by western blot analysis in each case. Pep-7 caused obvious accumulation of p53 and concomitant induction of p21, paralleled with the HPV16 E7 decline in the cells transfected with negative control siRNA. In contrast, it did not have a significant influence on these protein levels in the cells with E7 knocked down (Fig. 5c, d). Pep-7 inhibits tumor growth and induces apoptosis in vivo The anti-tumor efficacy and apoptosis induction of the selected peptide were further evaluated in vivo. A subcutaneous tumor model was constructed in nude mice by inoculation with 1.5 9 107 SiHa cells, and then different

123

614

Apoptosis (2011) 16:606–618

Fig. 5 Pep-7 function is blocked by HPV16 E7 knockeddown. The HPV16 E7 in the SiHa cells was knocked down by E7 siRNA. Negative control siRNA (NC siRNA) transfection was set as the control. The cells were then treated with or without 80 lM Pep-7 for 48 h and subjected to in situ TUNEL apoptosis detection and western blot of the protein expression assay. The function of Pep-7 was abolished in cells with knocked out HPV16 E7. a Representative images of TUNEL staining in each case; b quantification of the results calculated from 500 total cells in each case; c representative images of the western blot analysis in each case. b-actin was set up as the internal normalization standard. d The relative levels of p53, p21, and E7 were calculated from the band intensities (*P \ 0.02)

treatments were carried out, as mentioned in ‘‘Materials and methods’’ section. In the experiment, Pep-7 therapy showed significant tumor inhibition at doses above 80 lg/ mouse/day (P \ 0.02, Fig. 6). The 80 lg Pep-7/mouse remedy inhibited tumor growth by more than 91.48%, whereas the N-pep treatment at the same dosage showed no anti-tumor effect compared with the control (Fig. 6b). When the xenograft-bearing mice were treated with the highest dose (160 lg/mouse), more than 60% of them showed complete tumor inhibition (tumor disappeared). In contrast, all mice in PBS treatment group, N-pep treatment group, and the low dose group (16 lg/mouse) bore tumors at the end of the study. The H/E staining of the tumor tissues also revealed that Pep-7 suppressed tumor progression (data not shown). More encouraging, the Pep-7 showed no toxicity on the host mouse at any dosage during the experiment. As indicated in Fig. 6a and d, no significant difference in mouse weight gain was observed between each Pep-7 therapy group and the control group. At the end of the experiment, dissection results revealed that there were no obvious signs of toxicity in the heart, liver, lungs, spleen, kidneys, and other organs in each group. The apoptosis induced in the tumor tissues was detected by TUNEL. As shown in Fig. 7a and d, Pep-7 therapy

123

induced obvious apoptosis in the tumor xenografts, similar to those of the cell experiments. The percentage of TUNEL-positive cells increased from 7% in the 0 lg Pep-7/ mouse dose (PBS) group to about 20% in the 16 lg Pep-7/ mouse dose group and 39% in the 80 lg Pep-7/mouse dose group. The differences are statistically significant (Fig. 7d, P \ 0.005). Immunohistochemistry results of tumor tissues showed that the p53 protein level increased, whereas the HPV16 E7 levels decreased in the Pep-7-treated group compared with those in the control group (Fig. 7b, c). Immunoblot analysis confirmed the immunohistochemical observations. The Pep-7-treated group had higher levels of p53 protein and lower levels of HPV16 E7 protein than the control group. In addition, the increase in p53 upon Pep-7 treatment was linked to p21 induction (Fig. 7e, f).

Discussion To obtain therapeutic agents that could be utilized to treat HPV-associated tumors, a novel HPV16 E7 antagonist peptide, Pep-7, was isolated from a phage display library. The peptide binds to HPV16 E7 protein with high specificity in vitro, induces HPV16 E7 protein degradation (Fig. 1), and inhibits cell proliferation in HPV16-positive

Apoptosis (2011) 16:606–618

615

Fig. 6 The toxicity and anti-tumor efficacy of Pep-7 in vivo. Mice bearing subcutaneous tumors were treated for 15 days with daily intratumoral injections of PBS (control), N-pep, or Pep-7 at the doses indicated. Mouse and tumor growth curves were drawn with average mouse weight and tumor volume in each group. Tumor volume was calculated using the formula ‘‘volume = (length 9 width2)/2’’. The tumor growth inhibition ratio was represented as the relative tumor weight calculated using the formula ‘‘relative tumor weight (% of control) = average tumor weight of each dose treatment group/

average tumor weight of control group’’. Results represent means ± SE. a Effects of Pep-7 at different doses on mouse growth; b effects of Pep-7 at different doses on tumor growth; c comparison of anti-tumor efficacy among PBS and Pep-7 at different doses; d comparison of effects between Pep-7 and N-pep on mouse growth; e comparison of effects between Pep-7 and N-pep on tumor growth; f comparison of anti-tumor efficacy between N-pep and Pep-7 (*P \ 0.02; **P \ 0.01)

cell lines. Furthermore, these effects were highly specific. Pep-7 had no effects on the proliferative capacity of other type HPV-positive cells or HPV-negative cells. Control peptide N-pep only played a negligible role in the growth of HPV16-positive cells (Fig. 2). In our previous study, the proliferation inhibition was associated with cell cycle arrest and functional restoration of pRb (data not shown). Induction of apoptosis, as well as cell cycle disturbance is believed to contribute to tumor suppression. In the current study, the effects of Pep-7 on apoptosis, both in vitro and in vivo, were investigated. First, the Annexin V apoptosis test indicated that the peptide induced apoptosis in SiHa cells in a time- and dose-dependent manner (Fig. 3a–d), which concurs with the cell proliferation inhibition results (Fig. 2). The apoptosis induction by Pep7 was further confirmed in CaSki cells by in situ TUNEL assay. Therefore, the proliferation inhibition by Pep-7 in HPV16-positive cells could also be due to apoptosis induction in addition to cell cycle suppression. Identical

findings were obtained in animal experiments. Pep-7 treatment resulted in significant anti-tumor effect, in line with apoptosis induction, in a dose-dependent manner, compared with the PBS or N-pep treatment (Figs. 6, 7). The apoptosis rates induced by Pep-7 treatment in tumor xenografts were higher than those in the cell lines. This difference is probably due to the difference in treatment periods. These findings indicate that specific HPV16 E7 inhibitors can efficiently induce cell death in HPV16positive cancer cells and provide a novel basis to generate pharmacologically useful agents for treating HPV-associated lesions. The E6 gene abrogates p53-dependent apoptosis by inducing the proteolytic eliminations of p53. The E7 protein of HPV-16 can either induce [14, 15] or prevent [18] apoptosis, depending on the genetic background of the cell. For HPV16-positive CaSki cells, a previous study has shown that specific peptide aptamers targeting E7 could induce apoptosis in cervical carcinoma cells [26], implying

123

616

Apoptosis (2011) 16:606–618

Fig. 7 Apoptosis induction and protein modulation by Pep-7 in tumor tissues. The cell apoptosis and HPV16 E7 and p53 proteins expression in the tumor tissues of each group of mice were tested by TUNEL staining (a and d), immunohistochemical assay (b and c), and western blotting (e and f). a TUNEL staining of the tumor tissues: panel 1, negative control staining of the 80 lg Pep-7 treatment group; panel 2, TUNEL staining of the control (PBS treatment) group; panel 3, TUNEL staining of the 16 lg Pep-7 treatment group; panel 4, TUNEL staining of the 80 lg Pep-7 treatment group; b immunohistochemical staining of p53 expression: panel 1, tumor tissue from the 80 lg Pep-7 treatment group stained with PBS; panel 2, tumor tissue from the control group stained with p53 antibodies; panel 3, tumor tissue from the 16 lg Pep-7 treatment group stained with p53

antibodies; panel 4, tumor tissue from the 80 lg Pep-7 treatment group stained with p53 antibodies. c Immunohistochemical staining of HPV16 E7 in epithelial tissue from a normal Kunming mouse (panel 1), tumor tissue from the control group (panel 2), tumor tissue from the 16 lg Pep-7 treatment group (panel 3), and tumor tissue from the 80 lg Pep-7 treatment group (panel 4); d statistical analysis of the TUNEL-positive cells by accounting for 500 total cells in each case; e and f p53, p21, and E7 were detected by Western blotting, results are shown as representative images (e) and quantification data were calculated from band intensities (f). b-actin was set up as the internal normalization standard. Tissues from the 160 lg dose group were not tested due to the small size of the tumor (scale bar, 50 lm; *P \ 0.02)

that oncoprotein E7 helps CaSki cells to avoid cell death. Our results are in line with this. Pep-7 induced apoptosis associated with E7 degradation in the HPV16-positive cell lines CaSki and SiHa (Figs. 1, 3, 4, 5), as well as tumor xenografts constructed with SiHa cells (Fig. 7). Moreover, our study revealed that treatment with Pep-7 specifically restored functional p53 protein, which promoted the

transcription of p21, a well-known p53 target gene, in the HPV16-positive CaSki and SiHa cell lines (Fig. 4). In the current study, the relationship between apoptosis induction by Pep-7 and HPV16-E7 protein was verified. The MTT assay shows that suppression of cell proliferation by the peptide was specific to HPV16-positive cell lines; apoptosis detection in HeLa cells indicated that Pep-7 had no effect on

123

Apoptosis (2011) 16:606–618

apoptosis in HPV16-negative cell lines; more convincing evidence came from the HPV16 E7 knocked down SiHa cells. When E7 protein was knocked down by siRNA, the Pep-7 function was consequently blocked, suggesting that Pep-7 induced cell apoptosis via HPV16 E7. More interestingly, the HPV16 E7 siRNA transfection in SiHa cells obtained results similar to those of the Pep-7 treatment, inducing apoptosis through p53 augmentation linked with p21 expression promotion (Fig. 5). This indicates that like HPV16 E7 siRNA, Pep-7 induced apoptosis via elimination of HPV16 E7, preventing p53 degradation, and consequently restoring the function of p53. The difference lies only in that HPV16 E7 siRNA reduced E7 levels by blocking gene transcription, whereas Pep-7 induced protein degradation. The siRNA transfection in our study only partially knocked down E7 protein by about 80%, which is similar to the previous reports [2, 29]. However, Pep-7 did not reduce the E7 protein in the E7 siRNA group. This finding parallels those by von Knebel Doeberitz and Feng WangJohanning [24], suggesting that a threshold level of E7 protein is required to manifest the neoplastic phenotype. Another explanation of our finding that the remaining E7 oncoprotein in the E7 siRNA group cannot be further deleted by Pep-7 is that it could only partially ablate E7. Considering the limitation of the E7 protein level remained after siRNA treatment, and the test deviations, we were not surprised to found insignificant differences in E7 levels between the Pep-7-treated and untreated groups. In summary, Pep-7 has anti-tumor efficacy, both in vitro and in vivo, through induction of apoptosis. This mechanistic study reveals that the apoptosis induction by the peptide is mainly due to the functional destruction of HPV16 E7 protein by inducing its degradation, thereby reactivating the functional p53 protein.

617

3.

4.

5.

6.

7.

8.

9.

10.

11. 12.

13.

14.

Acknowledgments This study was supported by grants from Guangdong Province Natural Science Fund (No. 05010197 and No. 06301451), China Postdoctoral Science Foundation (No. 20060400072), Shenzhen Sci-Tech Plan (No. JC200903180532A), and in part from China MOST National ‘‘973’’ Key Research Program (No. 2005CCA03500), China NSFC (No. 30671034), and from Shenzhen City for the Key Lab of Gene & Antibody Therapy and for Upgrading the Building of the National Key Lab of Health Science & Technology. We thank Dr. Jing Zhou for technical assistance and carefully reading the manuscript.

15.

The authors confirm that there are no conflicts

18.

Conflict of interest of interest.

16.

17.

19.

References 1. Schiffman MH, Brinton LA (1995) The epidemiology of cervical carcinogenesis. Cancer 76(10 Suppl):1888–1901 2. Chunlian N, Guolan G, Jie H, Hua L, Heping C, Ming H (2008) Human papillomavirus 16 E6, E7 siRNAs inhibit proliferation

20.

and induce apoptosis of SiHa cervical cancer cells. Chin J Cancer Res 20(4):6 Liu X, Roberts J, Dakic A, Zhang Y, Schlegel R (2008) HPV E7 contributes to the telomerase activity of immortalized and tumorigenic cells and augments E6-induced hTERT promoter function. Virology 375(2):611–623 Chu NR, Wu HB, Wu T, Boux LJ, Siegel MI, Mizzen LA (2000) Immunotherapy of a human papillomavirus (HPV) type 16 E7expressing tumour by administration of fusion protein comprising Mycobacterium bovis bacille Calmette-Guerin (BCG) hsp65 and HPV16 E7. Clin Exp Immunol 121(2):216–225 Kaufmann AM, Stern PL, Rankin EM, Sommer H, Nuessler V, Schneider A et al (2002) Safety and immunogenicity of TA-HPV, a recombinant vaccinia virus expressing modified human papillomavirus (HPV)-16 and HPV-18 E6 and E7 genes, in women with progressive cervical cancer. Clin Cancer Res 8(12): 3676–3685 Veldman T, Horikawa I, Barrett JC, Schlegel R (2001) Transcriptional activation of the telomerase hTERT gene by human papillomavirus type 16 E6 oncoprotein. J Virol 75(9):4467–4472 Nishimura A, Nakahara T, Ueno T, Sasaki K, Yoshida S, Kyo S et al (2006) Requirement of E7 oncoprotein for viability of HeLa cells. Microbes Infect 8(4):984–993 Werness BA, Levine AJ, Howley PM (1990) Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248(4951):76–79 Scheffner M, Huibregtse JM, Vierstra RD, Howley PM (1993) The HPV-16 E6 and E6-AP complex functions as a ubiquitinprotein ligase in the ubiquitination of p53. Cell 75(3):495–505 Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM (1990) The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63(6):1129–1136 Alani RM, Munger K (1998) Human papillomaviruses and associated malignancies. J Clin Oncol 16(1):330–337 Munger K, Baldwin A, Edwards KM, Hayakawa H, Nguyen CL, Owens M et al (2004) Mechanisms of human papillomavirusinduced oncogenesis. J Virol 78(21):11451–11460 Thomas JT, Laimins LA (1998) Human papillomavirus oncoproteins E6 and E7 independently abrogate the mitotic spindle checkpoint. J Virol 72(2):1131–1137 Pan H, Griep AE (1995) Temporally distinct patterns of p53dependent and p53-independent apoptosis during mouse lens development. Genes Dev 9(17):2157–2169 Jones DL, Munger K (1997) Analysis of the p53-mediated G1 growth arrest pathway in cells expressing the human papillomavirus type 16 E7 oncoprotein. J Virol 71(4):2905–2912 Puthenveettil JA, Frederickson SM, Reznikoff CA (1996) Apoptosis in human papillomavirus16 E7-, but not E6-immortalized human uroepithelial cells. Oncogene 13(6):1123–1131 Stoppler H, Stoppler MC, Johnson E, Simbulan-Rosenthal CM, Smulson ME, Iyer S et al (1998) The E7 protein of human papillomavirus type 16 sensitizes primary human keratinocytes to apoptosis. Oncogene 17(10):1207–1214 Thompson DA, Zacny V, Belinsky GS, Classon M, Jones DL, Schlegel R et al (2001) The HPV E7 oncoprotein inhibits tumor necrosis factor alpha-mediated apoptosis in normal human fibroblasts. Oncogene 20(28):3629–3640 Magal SS, Jackman A, Pei XF, Schlegel R, Sherman L (1998) Induction of apoptosis in human keratinocytes containing mutated p53 alleles and its inhibition by both the E6 and E7 oncoproteins. Int J Cancer 75(1):96–104 Severino A, Abbruzzese C, Manente L, Valderas AA, Mattarocci S, Federico A et al (2007) Human papillomavirus-16 E7 interacts with Siva-1 and modulates apoptosis in HaCaT human immortalized keratinocytes. J Cell Physiol 212(1):118–125

123

618 21. Shim JH, Kim KH, Cho YS, Choi HS, Song EY, Myung PK et al (2008) Protective effect of oxidative stress in HaCaT keratinocytes expressing E7 oncogene. Amino Acids 34(1):135–141 22. Parkin DM, Bray F (2006) Chapter 2: the burden of HPV-related cancers. Vaccine 24(Suppl 3):S3/11-25 23. Rose PG, Bundy BN, Watkins EB, Thigpen JT, Deppe G, Maiman MA et al (1999) Concurrent cisplatin-based radiotherapy and chemotherapy for locally advanced cervical cancer. N Engl J Med 340(15):1144–1153 24. Wang-Johanning F, Gillespie GY, Grim J, Rancourt C, Alvarez RD, Siegal GP et al (1998) Intracellular expression of a singlechain antibody directed against human papillomavirus type 16 E7 oncoprotein achieves targeted antineoplastic effects. Cancer Res 58(9):1893–1900 25. Giovane C, Trave G, Briones A, Lutz Y, Wasylyk B, Weiss E (1999) Targetting of the N-terminal domain of the human papillomavirus type 16 E6 oncoprotein with monomeric ScFvs blocks the E6-mediated degradation of cellular p53. J Mol Recognit 12(2):141–152 26. Nauenburg S, Zwerschke W, Jansen-Durr P (2001) Induction of apoptosis in cervical carcinoma cells by peptide aptamers that bind to the HPV-16 E7 oncoprotein. FASEB J 15(3):592–594 27. Stanley M (2003) Chapter 17: genital human papillomavirus infections—current and prospective therapies. J Natl Cancer Inst Monogr (31):117–124 28. Sima N, Wang S, Wang W, Kong D, Xu Q, Tian X et al (2007) Antisense targeting human papillomavirus type 16 E6 and E7 genes contributes to apoptosis and senescence in SiHa cervical carcinoma cells. Gynecol Oncol 106(2):299–304 29. Sima N, Wang W, Kong D, Deng D, Xu Q, Zhou J et al (2008) RNA interference against HPV16 E7 oncogene leads to viral E6 and E7 suppression in cervical cancer cells and apoptosis via upregulation of Rb and p53. Apoptosis 13(2):273–281 30. Wu S, Meng L, Wang S, Wang W, Xi L, Tian X et al (2006) Reversal of the malignant phenotype of cervical cancer CaSki cells through adeno-associated virus-mediated delivery of HPV16 E7 antisense RNA. Clin Cancer Res 12(7 Pt 1):2032–2037

123

Apoptosis (2011) 16:606–618 31. Jiang M, Milner J (2002) Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference. Oncogene 21(39):6041–6048 32. Hamada K, Shirakawa T, Gotoh A, Roth JA, Follen M (2006) Adenovirus-mediated transfer of human papillomavirus 16 E6/E7 antisense RNA and induction of apoptosis in cervical cancer. Gynecol Oncol 103(3):820–830 33. Shillitoe EJ, Kamath P, Chen Z (1994) Papillomaviruses as targets for cancer gene therapy. Cancer Gene Ther 1(3):193–204 34. Aaltonen T, Adelman J, Akimoto T, Albrow MG, Alvarez Gonzalez B, Amerio S et al (2008) Search for the Higgs boson produced in association with Z ? l?l in pp collisions at sqrt[s] = 1.96 TeV. Phys Rev Lett 101(25):251803 35. Dona MG, Giorgi C, Accardi L (2007) Characterization of antibodies in single-chain format against the E7 oncoprotein of the human papillomavirus type 16 and their improvement by mutagenesis. BMC Cancer 7:25 36. Niwa H, Wentzel AL, Li M, Gooding WE, Lui VW, Grandis JR (2003) Antitumor effects of epidermal growth factor receptor antisense oligonucleotides in combination with docetaxel in squamous cell carcinoma of the head and neck. Clin Cancer Res 9(13):5028–5035 37. Passegue E, Wagers AJ, Giuriato S, Anderson WC, Weissman IL (2005) Global analysis of proliferation and cell cycle gene expression in the regulation of hematopoietic stem and progenitor cell fates. J Exp Med 202(11):1599–1611 38. Jares P, Campo E, Pinyol M, Bosch F, Miquel R, Fernandez PL et al (1996) Expression of retinoblastoma gene product (pRb) in mantle cell lymphomas. Correlation with cyclin D1 (PRAD1/ CCND1) mRNA levels and proliferative activity. Am J Pathol 148(5):1591–1600 39. El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM et al (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75(4):817–825