Curr Genet (2010) 56:309–319 DOI 10.1007/s00294-010-0301-7

R ES EA R C H A R TI CLE

Candida albicans SH3-domain proteins involved in hyphal growth, cytokinesis, and vacuolar morphology Patrick Reijnst · Sigyn Jorde · Jürgen Wendland

Received: 23 December 2009 / Revised: 22 March 2010 / Accepted: 29 March 2010 / Published online: 11 April 2010 © Springer-Verlag 2010

Abstract This report describes the analyses of three Candida albicans genes that encode Src Homology 3 (SH3)-domain proteins. Homologs in Saccharomyces cerevisiae are encoded by the SLA1, NBP2, and CYK3 genes. Deletion of CYK3 in C. albicans was not feasible, suggesting it is essential. Promoter shutdown experiments of CaCYK3 revealed cytokinesis defects, which are in line with the localization of GFP-tagged Cyk3 at septal sites. Deletion of SLA1 resulted in strains with decreased ability to form hyphal Wlaments. The number of cortical actin patches was strongly reduced in sla1 strains during all growth stages. Sla1-GFP localizes in patches that are found concentrated at the hyphal tip. Deletion of the Wrst two SH3-domains of Sla1 still resulted in cortical localization of the truncated protein. However, the actin cytoskeleton in this strain was aberrant like in the sla1 deletion mutant indicating a function of these SH3 domains to recruit actin nucleation to sites of endocytosis. Deletion of NBP2 resulted in a defect in vacuolar fusion in hyphae. Germ cells of nbp2 strains lacked a large vacuole but initiated several germ tubes. The mutant phenotypes of nbp2 and sla1 could be corrected by reintegration of the wild-type genes. Keywords Candida albicans · PCR-based gene targeting · pFA-plasmids · Actin cytoskeleton · FM4-64

Communicated by C. D'Enfert. P. Reijnst · S. Jorde · J. Wendland (&) Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, 2500 Valby, Copenhagen, Denmark e-mail: [email protected]

Introduction Candida albicans is one of the most important human fungal pathogens. It occurs as a commensal on epithelial surfaces in oropharyngeal tissue, the gastro-intestinal tract, and in the vagina. Particularly, vaginitis and urinary tract infections caused by C. albicans are frequent in otherwise healthy individuals. Immuno-compromised patients may additionally develop life-threatening systemic infections of inner organs (Odds 1994; Calderone and Fonzi 2001). The morphological transition of C. albicans from yeast to hyphal growth has been recognized as an important virulence attribute amongst others (Sudbery et al. 2004; Kumamoto and Vinces 2005). Filamenting germ cells characteristically generate large vacuoles. This compartmentalizes the germ tube in an apical region that contains endosomes and small vacuoles, and subapical regions which harbor large vacuoles at the expense of cytoplasm. Septation in hyphal Wlaments further promotes this compartmentalization. The unequal distribution of vacuolar volume inXuences the branching frequency during Wlamentous growth (Barelle et al. 2006; Veses et al. 2009). The actin cytoskeleton is polarized at sites of polarized growth and cortical actin patches cluster in the hyphal tips. Defects in the polarization of the actin cytoskeleton, e.g. interfering with the function of several Rho-type GTPases generally lead to growth defects (Wendland 2001; Court and Sudbery 2007; Zheng et al. 2007). Actin ring formation promoted via Iqg1 at sites of septation is required for septum formation (Epp and Chant 1997; Wendland and Philippsen 2002). In S. cerevisiae, CYK3 can act as a multicopy suppressor of an IQG deletion (Korinek et al. 2000). Processes like polarized hyphal growth, endocytosis, and cytokinesis require protein networks and timely regulation within the cell cycle. SH3-domain encoding proteins are well suited to

123

310

Curr Genet (2010) 56:309–319

play important roles in these processes since they can mediate protein–protein interactions via their SH3-domains (am Busch et al. 2009). Several C. albicans SH3-protein encoding genes have already been characterized including MYO5, BEM1, and CDC25 (Enloe et al. 2000; Michel et al. 2002; Oberholzer et al. 2002; Bassilana et al. 2003). BEM1 was found to be essential, while MYO5 plays an important role during endocytosis. Both Myo5 and Cdc25 are required for Wlamentation under speciWc conditions. Therefore, other SH3-domain encoding genes may also play important morphogenetic roles. Establishing the genome sequence of C. albicans has opened the way for the functional analysis of the C. albicans gene set as has been elegantly achieved in S. cerevisiae (Winzeler et al. 1999). PCR-based gene targeting approaches similar to those used in S. cerevisiae have been established to generate homozygous mutant strains after two successive rounds of transformation (Berman and Sudbery 2002; Walther and Wendland 2008). To contribute further to the functional analysis of C. albicans genes, we have functionally analyzed the C. albicans homologs of the S. cerevisiae SH3-domain encoding genes SLA1, NBP2, and CYK3.

Materials and methods Strains and media The C. albicans strains used and generated in this study are listed in Table 1. Generally, at least two independent Table 1 C. albicans strains used in this study

Cm C. maltosa, Cd C. dubliniensis a

All CAxxxx strains are derivates of SN148

123

transformants were generated for each desired genetic manipulation. Strains were grown either in yeast extract– peptone–dextrose (YPD; 1% yeast extract, 2% peptone, 2% dextrose) or in deWned minimal media [CSM; complete supplement mixture; 6.7 g/l yeast nitrogen base (YNB) with ammonium sulfate and without amino acids; 0.69 g/l CSM; 20 g/l glucose] with the addition of required amino acids and uridine. Promoter shut down of MET3-promoter or MAL2-promoter controlled gene expression was done as described previously (Bauer and Wendland 2007). Strains were generally grown at 30°C to keep them in the yeast phase; hyphal induction of C. albicans cells was done at 37°C with the addition of 10% serum to the growth medium. Escherichia coli strain DH5 was used for pFAplasmid propagation. Transformation of C. albicans Completely independent C. albicans homozygous complete ORF-deletion strains were constructed starting from C. albicans strain SN148 (Noble and Johnson 2005). PCR-generated disruption cassettes were used to target both alleles of a gene, which were deleted by sequential transformation of Wrst SN148 and then the resulting heterozygous strains. PCR-products for transformation of C. albicans were ampliWed from pFA-vectors (Table 2) using S1- and S2-primers as described (Walther and Wendland 2008). Primers were purchased from biomers.net GmbH (Ulm, Germany). S1- and S2-primers (see Table 3) harbor 100 nt of target homology at their

Straina

Genotype

Source

SC5314

C. albicans wild type

Gillum et al. 1984

SN148

arg4/arg4, leu2/leu2, his1/his1 ura3::imm434/ura3::imm434, iro1::imm434/iro1::imm434

Noble and Johnson 2005

CAP046

NBP2/nbp2::CdHIS1, leu2, ura3, arg4

This study

CAP015

nbp2::CdHIS1/nbp2::URA3, leu2, arg4

This study

CAP191

nbp2::CdHIS1/nbp2::URA3, BUD3/bud3::NBP2-CmLEU2, arg4

This study

CAP147

CYK3/cyk3::CdHIS1, leu2, ura3, arg4

This study

CAP007

URA3-MET3p-CYK/cyk3::CdHIS1, arg4, leu2

This study

CAP054

SLA1/sla1::CdHIS1, leu2, ura3, arg4

This study

CAP024

sla1::CdHIS1/sla1::URA3, leu2, arg4

This study

CAP204

sla1::CdHIS1/sla1::URA3, BUD3/bud3::SLA1-CmLEU2, arg4

This study

CAP025

sla1::ARG4isla1::URA3, his1, leu2

This study

CAP026

sla1::ARG4/sla1::URA3, his1, leu2

This study

CAS024

SLA1/sla1::CdHIS1, leu2, ura3, arg4

This study

CAP206

URA3-MAL2p-sla1SH3#1,2/sla1::CdHIS1, leu2, arg4

This study

CAP221

URA3-MAL2p-sla1SH3#1,2-GFP-CmLEU2/sla1::CdHIS1, arg4

This study

CAS027

SLA1-GFP-CmLEU2/sla1::CdHIS1

This study

CAS030

CYK3-GFP-CmLEU2/cyk3::CdHIS1, ura3, arg4

This study

Curr Genet (2010) 56:309–319

311

Table 2 Plasmids used in this study Plasmid

Description

Source

200

pFA-URA3

Gola et al. 2003

230

pFA-URA3-MAL2p

Gola et al. 2003

627

pFA-CdHIS1

Schaub et al. 2006

697

pFA-GFP-CmLEU2

Schaub et al. 2006

873

pRS-CaBUD3-CmLEU2

Wendland

C508

pDrive-SLA1

This study

C553

pRS-BUD3-SLA1-CmLEU2

This study

C527

pDrive-NBP2

This study

C530

pRS-BUD3-NBP2-CmLEU2

This study

C177

pRS417 (GEN3)

This study

C196

pDRIVE-3⬘-CYK3

This study

C200

pRS417-3⬘-CYK3

This study

C257

pRS417-3⬘-CYK3-GFP

This study

C182

pGEM-3⬘-SLA1

This study

C201

pRS417-3⬘-SLA1

This study

C256

pRS417-3⬘-SLA1-GFP

This study

CAGFY04

SLA1-UAU1-cassette

Mitchell

CAGO130

SLA1-UAU1-cassette

Mitchell

Ca C. albicans, Cm C. maltosa, Cd C. dubliniensis

5⬘-ends. Shorter primers were used for diagnostic PCR to verify the integration of the cassettes and absence of the target gene in homozygous mutants. Transformation was done as described (Walther and Wendland 2003). SLA1 was also disrupted using two gene-speciWc UAU1 cassettes kindly provided by Aaron Mitchell. Transformation with the SLA1 cassettes on plasmids CAGFY04 and CAGO130 required linearization of the plasmid using NotI and transformation of C. albicans with a Wrst selection on ¡Arg media. Restreaking of the primary transformants on ¡Arg and ¡Ura media was done to select for recombinants in which both alleles have been disrupted (see Nobile and Mitchell 2009 for further details). Reintegration of SLA1 and NBP2 Reconstitution of the sla1 and nbp2 strains was done by reintegration of the wild-type gene at the BUD3 locus. To this end, SLA1 was ampliWed using primers #3562 and #3237 and cloned into pDrive (C508). From there SLA1 was cloned as an XhoI/BamHI fragment into plasmid #873 to yield plasmid C553. The sla1 strain CAP024 was transformed with SpeI-linearized plasmid C553. Similarly, NBP2 was ampliWed using primers #3557 and #4196 and cloned into pDrive generating plasmid C527. NBP2 was then cloned as a XhoI/BamHI fragment into #873 generat-

ing plasmid C530. Plasmid C530 was transformed after cleavage with SpeI to generate strain CAP191. Construction of SLA1-GFP and CYK3-GFP To generate chromosomally GFP-tagged strains, the following procedure was applied. The 3⬘-ends of SLA1 and CYK3 were ampliWed using primer pairs #3236/#3237 and #3222/#3223, respectively, and cloned into pDrive (plasmids C182 and C196). The fragments were recloned into pRS417, which is based on pRS415 but carries a GEN3 marker instead of LEU2. This generated plasmids C200 and C201, which were used for in vivo recombination in S. cerevisiae to add the GFP-CmLEU2 cassettes ampliWed using the primer pairs #3314/#3315 for SLA1 and #3312/ #3313 for CYK3, respectively. The resulting plasmids C256 and C257 were cleaved by XhoI/BamHI and SacII/XhoI, respectively, to release the targeting cassettes used for transformation of C. albicans. Correct fusion was veriWed by sequencing and correct integration of the cassettes was veriWed by diagnostic PCR. Construction of sla1SH3#1,2-GFP To generate a SLA1-allele which is expressed from the regulatable MAL2-promoter and lacks the Wrst two SH3domains, a PCR-based gene targeting approach was used. The URA3-MAL2p-cassette was ampliWed from a pFA vector using primers #3594 and #4265. This cassette was transformed into strain CAS023 (SLA1/sla1::CdHIS1). This generated strain CAP206 bearing a deletion of one SLA1 allele and converting the remaining allele to sla1SH3#1,2. To be able to record the localization of the truncated protein in living cells, this SLA1 allele was tagged with GFP. To this end, the SLA1-GFP-tagging cassette was used and CAP206 was transformed with SpeI/SacII digested C256 (pRS417-3⬘-SLA1-GFP). This resulted in the addition of GFP to the C-terminus of sla1SH3#1,2. Microscopy and staining procedures Fluorescence microscopy was done with an Axio-Imager microscope (Zeiss, Jena and Göttingen, Germany) using Metamorph software tools (Molecular Devices Corp., Downington, PA, USA) and a MicroMax1024 CCD-camera (Princeton Instruments, Trenton, NJ, USA). Imaging was performed using the appropriate Wlter combinations for FM4-64-imaging, GFP-localization, and actin-staining as described (Walther and Wendland 2004a, b). Quinacrine staining was done according to (Weisman et al. 1987). To this end, strains were grown overnight in YPD, and then diluted in YPD + Serum and grown for an additional 4 h. Quinacrine was added to a Wnal concentration of 200 M.

123

312

Curr Genet (2010) 56:309–319

Table 3 Primers used in this study Genes

Primer names and sequencesa

CaCYK3

#4019: S1-CaCYK3: CCTTTCATTAATTACAAAGAAAAAAATAAGAACATCAACTATCTTTTCACTCTTTTT GAACAAATTTGTATCATACTAAAAGAATTAAATAATAAATAATgaagcttcgtacgctgcaggtc

CaCYK3

#3313: S2-CaCYK3: AATGTACAAATGGCAAAAAGAAGTAGTAGCAGAAGAGGTAATCTATAAAGAATTTAAAA CTAAATAATACCCACTCTGTTTCCCTCTTTATATATATATAtctgatatcatcgatgaattcgag

CaCYK3

#4020: G1-CaCYK3: GCACACTTGATGATTTCATC

CaCYK3

#3222: G3-CaCYK3: GCTAAGATCAAGGCAGTG

CaCYK3

#3223: G4-CaCYK3: GCAACTGCTGCAGTAGAC

CaCYK3

#3312: S1-GFP-CaCYK3: TATGTTTTCGCTCAGTGGGAGTGCATAGGTAGCACAGTTGCAAATggtgctggcgcaggtgcttc

CaCYK3

#3539: G1-CaCYK3-GFP: GACTGCAAGGGCAACCAC

CaCYK3

#3747: G2-CaCYK3: AGGATTTAaagcttttaCCCAAGTGGGGTTGTTCCAGC

CaNBP2

#3589: S1-CaNBP2: GTCTTGTTTGTCCTGTGTGTGTGTGTGTGTGTGTTGATAAATCACCTGAAACATATA CTATTTAATCATTTGTTATTCATCATTATTGTCCATTTTGAATAGgaagcttcgtacgctgcaggtc

CaNBP2

#3579: S2-CaNBP2: CACATACACTCTGTTGGTATGAAAGTATAAAAACATTTGATAAAATTCGTAATCAACATT AATATAACTTAATTGTCCCTATAAGCTGGCTAATATTGGAtctgatatcatcgatgaattcgag

CaNBP2

#3557: G1-CaNBP2: GGTGTTTCACATTATTCTCCG

CaNBP2

#3309: G4-CaNBP2: TGGCCGAACCCTTCCTGG

CaNBP2

#3245: I1-CaNBP2: GACAAGTCATTTCCCACC

CaNBP2

#3246: I2-CaNBP2: CTTCAGCAACTAACCAACCTTG

CaNBP2

#4196: A4-CaNBP2: CACATACACTCTGTTGGTATG

CaSLA1

#3594: S1-CaSLA1: CAACTCCTATGTTAGAGCTAGTCGTGCTCAACACAAAACCTGATGTGAAACAATGAA ACTTTCGACGATTCTACAAAAGTGCGGAAATTGCTTGAAATCAAAGgaagcttcgtacgctgcaggtc

CaSLA1

#3315: S2-CaSLA1: AGCATTACAAACTATGAAAGGAATAAGAAATAATGAATAATATTTTGTTTGATATACAATTA TAAAATAAAAGAGTTAATAAAGGTTCAAAATGCACTTTtctgatatcatcgatgaattcgag

CaSLA1

#3562: G1-CaSLA1: CGGTAGAGATGATGTTGTG

CaSLA1

#3765: G2-SLA1: AGGATTTAaagcttttaAGGTGGTGCAGGGAAATCCG

CaSLA1

#3236: G3-CaSLA1: TGGTGGAGCACCACAGAC

CaSLA1

#3237: G4-CaSLA1: CGGCTTTGCAACATCAAGAC

CaSLA1

#3241: I1-CaSLA1: CATAGGGATAGATCACCAG

CaSLA1

#3242: I2-CaSLA1: CTTCTCTCAAACCATGGGC

CaSLA1

#3243: I3-CaSLA1: CACAACAACAACCGCCACC

CaSLA1

#3244: I4-CaSLA1: CCATACCAGTTGGTTGTGAC

CaSLA1

#3314: S1-GFP-CaSLA1: AGAGCTAATCTACAAGCAGCAACACCAGATAATCCCTTTGGATTCggtgctggcgcaggtgcttc

CaSLA1

#4265: S2-MALp-SLA1SH3#1-2: GAATCTGAGTCTGTTGCTGTGGAATAGCCTGCTGTTGTTGTGGTGGTGGTTGGAAAACCTGTTGTGGTTGTTG CTGTTGATGCTGTGCTGGCTCTGCTGTcattgtagttgattattagttaaaccac

CaURA3

#600: U2: GTGTTACGAATCAATGGCACTACAGC

CaURA3

#599: U3: GGAGTTGGATTAGATGATAAAGGTGATGG

CdHIS1

#1432: H2: TCTAAACTGTATATCGGCACCGCTC

CdHIS1

#1433: H3: GCTGGCGCAACAGATATATTGGTGC

CmLEU2

#1743: L3: GCTGAAGCTTTAGAAGAAGCCGTG

CaMAL2

#4269: G3-CaMALp: GTACAACTAAACTGGGTGATG

Ca C. albicans, Cm C. maltosa, Cd C. dubliniensis a

Upper case sequences correspond to C. albicans DNA sequences and lower case sequences correspond to 3⬘-terminal annealing regions for the ampliWcation of pFA-cassettes. All sequences are written from 5⬘ to 3⬘

Cells were incubated at 37°C for 5 min, collected by centrifugation and resuspended in 200 l YPD + Serum with 50 mM NaH2PO4. Visualization was done with the GFP Wlter. Samples were analyzed by generating either single images or stacks of 5–20 images that were processed into single plane projections using Metamorph software.

123

Results Sequence comparisons The C. albicans Sla1, Nbp2, and Cyk3 proteins share one feature in the possession of SH3-domains, which were

Curr Genet (2010) 56:309–319

313

A

B

SH3-domain

Nbp2 Cyk3 Sla1 CAP025 Sla1

SH3#1-2

CAP026

MAL2prom

Fig. 1 Alignment and position of SH3-domains. a The Wve SH3-domains of the three genes that were functionally analyzed in this study were aligned using the MegAlign tool of the DNASTAR software (http://www.dnastar.com). Consensus sites are shaded in gray while identical sites in all Wve domains are shaded in black. b The positions of the SH3-domain vary within the proteins and are for Nbp2 at amino acids

127–184, for Cyk3 at position 11–68 and for Sla1 at positions 7–73, 76–133, and 399–457. For reference, the complete protein length is drawn to scale. No other domains were found using the SMART tool at (http://smart.embl.de/) also Sla1 has several repeats at its C-terminus. Deletion of the N-terminal SH3-domains results in a sla1 allele termed Sla1SH3#1,2

identiWed using the SMART tool at http://smart.embl.de/. An SH3-domain is composed of app. 70 amino acids and several conserved residues can be found (Fig. 1a). The position of a SH3-domain within a protein may vary and there are also proteins like Sla1 that contain more than one SH3-domain (Fig. 1b). Amino acid sequence identities between the C. albicans and, for example, Saccharomyces cerevisiae proteins are overall not very high and range between 27 and 37%. The C. albicans proteins are larger than the S. cerevisiae homologs: Sla1 by only 13aa, Cyk3 by 135aa, and Nbp2 by one-third (342aa compared to 236aa). The characterizations of the yeast genes revealed that SLA1 plays a role in actin cytoskeleton assembly and endocytosis; Nbp2 is required for mitotic growth at high temperatures and for cell wall integrity and Cyk3 is involved in cytokinesis (Korinek et al. 2000; Warren et al. 2002; Ohkuni et al. 2003).

order to characterize SLA1 in more detail, we used insertional disruption cassettes based on SLA1-UAU1-cassettes. Since deletion of CYK3 was not feasible, we used a promoter shutdown approach to analyze the consequences of Cyk3 depletion. Mutant phenotypes could be obtained with the homozygous mutants of sla1 and nbp2, which in both cases could be complemented by the reintegration of the wild-type gene at the BUD3 locus. Localization of Sla1 and Cyk3 was done by Xuorescence microscopy of GFP-tagged strains. Using this array of tools, we were able to achieve an initial characterization of gene function for these genes, which will be described in the following sections.

Generation of C. albicans mutant strains In this report, we have employed several strategies for gene function analysis relying on diVerent pFA-vectors and also used a single transformation approach relying on UAU1-cassettes as described below. Initially, we used the pFA-series to generate complete ORF-deletion strains in the three genes. From two heterozygous mutant strains, we went onto obtain two independent homozygous mutant strains thereof using the C. albicans URA3 and the Candida dubliniensis HIS1 marker genes. In

Deletion of SLA1 and NBP2 results in hyphal growth phenotypes Homozygous mutant strains of sla1 and nbp2 were characterized to reveal their growth potential under diVerent growth conditions. When grown on minimal media, no strong defects during yeast growth were observable. Hyphal growth was monitored by inducing yeast cells either on solid media or in liquid culture (Fig. 2). The wild type strongly Wlaments after addition of serum or in spider medium. Mutants in sla1 or nbp2 were also able to induce Wlament formation. Hyphae of these mutant strains, however, were shorter than the wild type after several hours of induction. Interestingly, the nbp2 mutant showed frequent reinitiating of germ tube formation from the germ cell.

123

314

Curr Genet (2010) 56:309–319

A

B

C WT

sla1

nbp2

Fig. 2 Characterization of growth phenotypes of the sla1 and nbp2 mutants. The strains were grown overnight in liquid culture and then inoculated on minimal medium (a), on serum containing plates or in liquid medium supplemented with 10% serum (b), or on spider plates and in spider liquid medium (c). Plates were incubated for 3 days at

Thus, after 3 h, most of the germ cells had formed two or three germ tubes (Fig. 2).

30°C (a) or 37°C (b, c) prior to photography. Hyphal induction in liquid media was done for 3 h prior to microscopy. Bar 10 m. Note the short germ tube in the sla1 strain (middle row) and the multiple germ tubes in the nbp2 mutant (bottom row)

A

SC5314

sla1::UAU1-CAP025

sla1::UAU1-CAP026

SLA1-deletion leads to defects in actin patch assembly and distribution The actin cytoskeleton plays a major role in polarized growth. During hyphal growth, actin cables in C. albicans are formed by the tip-localized polarisome and actin patches localize to the hyphal tip at sites of endocytosis (for review see Pruyne and Bretscher 2000a, b). To analyze the growth defects of sla1 in detail, we used Xuorescence microscopy of rhodamine stained germ tubes. We analyzed three diVerent sla1 mutant strains: two bearing UAU1 cassettes, CAP025 and CAP026, and a complete ORF-deletion strain. In this way, we could analyze the eVect of truncating SLA1 at positions that potentially leave all three SH3-domains intact, truncate the protein after the Wrst two SH3-domains or entirely delete SLA1 (see also Fig. 1). The two UAU1 insertions in SLA1 already showed diVerent phenotypes. The CAP026 strain basically showed no defect, grew like wild type and accumulated actin patches in the hyphal tips. The CAP025 strain in which the UAU1 insertion truncates SLA1 downstream of the region coding for the second SH3domain, shows decreased hyphal lengths when compared with the wild type. The number of actin patches in this mutant is decreased and the patches do not accumulate in the tips of hyphae (Fig. 3a). This phenotype is even more pronounced in the complete ORF-deletion strain. This strain has a more drastic growth defect and even fewer cortical actin patches. This demonstrates that Sla1 is involved in the assembly and polarization of cortical actin patches in C. albicans. The assembly of actin cables in the hyphal Wlaments was not impaired (Fig. 3b). The growth defect of the null mutant could be complemented by reintegration of the wild-type SLA1 gene at the BUD3 locus. The assembly of cortical actin patches and their polarized localization was also restored in both yeast and hyphal cells (Fig. 3b).

123

B

SC5314

sla1

sla1, BUD3/bud3::SLA1

SLA1-GFP/sla1

Fig. 3 Deletion of SLA1 leads to defects in cortical actin patch assembly. Strains were grown overnight in YPD, diluted in new medium and grown for 4 h at 30°C for yeast cell growth or at 37°C in the presence of 10% serum to induce Wlament formation. Cells were then Wxed and stained with rhodamine-phalloidin. Bright-Weld and Xuorescence images showing the actin cytoskeleton of the indicated strains are shown. a DiVerential eVect on cortical actin patch assembly of SLA1-UAU1 insertions compared to the wild type. b Reintegration of SLA1 complements the actin patch defect of the sla1 complete ORF-deletion mutant. In vivo localization of Sla1-GFP was done without Wxation. Bars 5 m

To visualize the localization of Sla1 in vivo, a chromosomally tagged SLA1-GFP strain was constructed based on a heterozygous mutant. Sla1 shows a patch-like localization in yeast cells and hyphae (Fig. 3b). An increased number of Sla1-GFP patches can be found at sites of polarized growth,

Curr Genet (2010) 56:309–319 Fig. 4 The two amino terminal SH3-domains of Sla1 are required for the organization of the actin cytoskeleton. CAP221 was grown overnight in YPD for a full SLA1 shut-down. Then cells were diluted in either YPD (repressed) or YPM (induced) with or without serum and grown for 4 h. Afterwards, cells were Wxed and stained with rhodaminephalloidin prior to GFP and actin Xuorescence microscopy. Bar 5 m

315 DIC

GFP

MAL2p-sla1

DIC

SH3#1,2

actin

-GFP repressed

e.g. the hyphal tip. This localization pattern resembles, for example, that of C. albicans Abp1 and other proteins involved in actin patch assembly or endocytosis (Martin et al. 2007).

DIC

GFP

MAL2p-sla1

DIC

SH3#1,2

actin

-GFP induced

localize to the hyphal tip were reduced in number and thus resembled the situation in the sla1 deletion strain. This indicates that the N-terminal SH3 domains of Sla1 do play an important role in organization of the actin cytoskeleton at sites of endocytosis (Fig. 4).

The N-terminal SH3-domains of Sla1 are important for actin cytoskeleton assembly but not for localization of Sla1

NBP2-deletion leads to multiple germ tube formation

To demonstrate that the two N-terminally located SH3domains of Sla1 contribute to the function of Sla1, we generated a truncated allele, sla1SH3#1,2. This allele was placed under control of the regulatable MAL2-promoter using a PCR-based gene targeting approach, which at the same time eliminated the Wrst two SH3-domains. Furthermore, to be able to localize the truncated protein, a C-terminal tag was added to sla1SH3#1,2. This strain was then used to visualize both the localization of Sla1SH3#1,2-GFP and the organization of actin cytoskeleton in yeast and hyphal cells (Fig. 4). When grown in glucose, sla1SH3#1,2 expression was turned down and the protein could not be detected. Actin organization resembled that of a sla1 mutant strain (compare Figs. 3, 4). Growth in maltose medium induced the expression of sla1SH3#1,2-GFP. Hence Sla1SH3#1,2GFP could be detected as cortical patches in yeast and hyphal cells. Sla1SH3#1,2-GFP was also found enriched in the hyphal tips. Thus, Sla1SH3#1,2-GFP localizes in a similar manner as full length Sla1-GFP indicating that the N-terminal SH3 domains do not play a role in Sla1-targeting to the cortex. However, under inducing conditions the actin cytoskeleton assembly in the strain expressing Sla1SH3#1,2-GFP was still aberrant. Cortical actin patches that did not

Deletion of NBP2 did not reveal any defects during the yeast growth phase. Yet, under hyphal inducing conditions, we observed that all germ cells developed multiple germ tubes after 4 h and the length of the primary germ tube was decreased in nbp2 compared to that of the wild type (Figs. 2, 5). Previously, it was shown in C. albicans and Ashbya gossypii that in hyphae large vacuoles are formed in subapical compartments (Walther and Wendland 2004a; Veses and Gow 2008). This inXuences the ratio of cytoplasm versus vacuole and inXuences the branching frequency (Veses et al. 2009). Therefore, we analyzed the vacuolar compartments in FM4-64 stained yeast cells and hyphae of the wild type and the nbp2 mutant (Fig. 5). During yeast growth, both strains accumulated a larger vacuole in mother cells and showed no observable diVerence. However, staining of germlings revealed the inability of nbp2 germ cells to generate large vacuolar compartments. Fragmented vacuoles were found throughout nbp2 hyphae. Thus, the altered ratio of cytoplasm versus vacuolar space may be the causal link to increased branching of germ cells in the nbp2 mutant. To corroborate that the defect in vacuolar fusion was speciWc for the nbp2 deletion strain, we reintegrated the NBP2 gene at the BUD3-locus. As expected,

123

316

Curr Genet (2010) 56:309–319

SC5314

nbp2

nbp2, BUD3/bud3::NBP2

Fig. 5 Deletion of NBP2 results in vacuolar fragmentation in hyphae. Strains were grown under yeast or germ tube inducing conditions for 4 h. FM4-64 (0.2 g/ml) was added and samples were processed for brightWeld and Xuorescence microscopy after 1 h to allow uptake of the dye. Bars 5 m

the reintegrant showed wild type vacuolar phenotype. We also generated a chromosomally encoded NBP2-GFP, which, however, did not yield a Xuorescent signal. To analyze vacuolar acidiWcation in the nbp2 strain, we used quinacrine staining and Xuorescence microscopy (Fig. 6). Quinacrine diVuses through membranes and accumulates in acidic compartments like the vacuole (Weisman et al. 1987). The accumulation of the dye and staining of vacuoles of nbp2 hyphae indicated that vacuolar fusion but not the function of the vacuoles was aVected in the nbp2 strain (Fig. 6, 7).

Fig. 6 Vacuoles of an nbp2 mutant strain are acidic. Strains were grown under yeast or germ tube inducing conditions for 4 h. Quinacrine staining reveals acidiWed and functional vacuoles

the regulatable C. albicans MET3 promoter (Care et al. 1999). Shutdown of CYK3 expression resulted in a severe cytokinesis defect. CYK3-depleted cells were elongated or misshapen and showed abnormal chitin deposition (Fig. 5b).

Depletion of Cyk3 results in cytokinesis defects

Discussion

We were unable to generate homozygous cyk3 strains from initial heterozygous mutants, without also generating some triplication event that left a wild-type copy of the gene in the genome. Thus, we conclude that CYK3 is an essential gene. In S. cerevisiae, CYK3 is involved in cytokinesis and localizes to the bud neck in large budded cells (Korinek et al. 2000). Cyk3 localization in C. albicans was determined by producing a fusion between the chromosomal CYK3 gene with GFP in a heterozygous mutant. In C. albicans, CYK3 was found to localize at the bud neck in large budded cells similar to Cyk3 in S. cerevisiae (Fig. 5a). In S. cerevisiae, deletion of CYK3 results in only mild cytokinesis defects, which contrasts the situation in C. albicans. To assess a phenotype upon depletion of CYK3 transcript, we produced a strain which expressed CYK3 from

In this study, we have generated C. albicans mutant strains for three SH3-domain encoding genes using PCR-based gene targeting methodologies and a single-step transformation protocol with UAU1 cassettes (Walther and Wendland 2008; Nobile and Mitchell 2009). SH3-domains are small protein domains that promote protein–protein interactions, particularly by binding to proline-rich ligands with a PxxP motif (Mayer 2001). The binding aYnity and binding speciWcity are inherently rather low. This may pose some diYculties when trying to establish protein interactions using the yeast two-hybrid system. Sla1, on the other hand, contains three SH3 domains, which may help to increase speciWc binding of target proteins. Given the strong potential of SH3-domains to promote signaling and morphogenesis, a large variety of SH3-domain

123

Curr Genet (2010) 56:309–319 Fig. 7 CYK3 localization and depletion after promoter shutdown. a Cyk3-GFP Xuorescence in large budded yeast cells was observed at the bud neck. b Cells in which CYK3 expression is controlled by the regulatable MET3-promoter were grown overnight in YPD at 30°C with (repressed) or without (induced) the addition of 3.5 mM methionine and cysteine. Prior to microscopy, calcoXuor was added to the medium to stain chitin rich regions. Bar 10 m

317

A

B

MET3p-CYK3 induced

proteins can be found in eukaryotic genomes ranging from 20–30 in yeast-like ascomycetes to over 300 in humans (Karkkainen et al. 2006). In yeast-like ascomycetes, there seems to be limited evolution of SH3-domain encoding genes. For example, in S. cerevisiae, Abp1 contains one SH3-domain, while in C. albicans, the Abp1 homolog has two adjacent SH3-domains, yet deletion of CaABP1 showed no discernible phenotype (Martin et al. 2007). Deletion of the C. albicans SLA1 resulted in similar actin assembly defects compared to a SLA1 deletion in S. cerevisiae. The severe reduction in actin patches, however, did not abolish the ability to generate germ tubes in the C. albicans sla1 mutants although a decreased polarized growth rate could be observed. A similar phenotype was observed in a Camyo5(S366D) allele, which mimics a phosphorylated serine. A strain bearing this allele was found to Wlament, yet shows a largely delocalized actin cytoskeleton (Oberholzer et al. 2002). In this paper, we identiWed the N-terminal region of C. albicans Sla1 containing two SH3domains to be required for correct organization of the actin cytoskeleton. In S. cerevisiae, Sla1 localizes to the cortex via an interaction of the Sla1 C-terminal repeat region with End3 (Tang et al. 2000; Warren et al. 2002). Furthermore, Sla1 interacts with Las17 and Abp1 as shown by immunoprecipitation (Warren et al. 2002). The elimination of two SH3 domains from Sla1 resulted in profound disorganization of the actin cytoskeleton indentifying Sla1 as a major

MET3p-CYK3 repressed

player linking early events of endocytosis with the actin cytoskeleton. Nevertheless, sla1 mutants were able to generate, albeit short, hyphae. Surprisingly, sla1 did not show a defect in the formation of large subapical vacuoles (see also Fig. 2). This, on the other hand, was observed for the nbp2 mutant. In S. cerevisiae, nbp2 mutants are temperature sensitive and also sensitive to cell wall stress (Ohkuni et al. 2003). Our C. albicans nbp2 mutants were not temperature sensitive and grew well at 40°C even with the addition of 1 M sorbitol or 1.5 M NaCl (data not shown). The transformation frequency, which requires a heat shock, was also not aVected in nbp2 cells. Thus, our results indicate some novel vacuolar functions for NBP2 which are more pronounced during hyphal growth stages and not apparent in yeast cells. Germ tube formation in the nbp2 strain was altered in a way that germ cells quickly generated multiple hyphae rather than one dominant germ tube as in the wild type. Thus, such a phenotype could be useful in larger scale screenings of a C. albicans mutant collection once available. SH3-domain proteins in C. albicans are taking part in a variety of processes. In this study, we identiWed a key role of the Wrst two Sla1 SH3-domains for the polarized assembly of the actin cytoskeleton, which had not previously been identiWed in other studies. We also revealed the involvement of Nbp2 in vacuolar fusion, and of Cyk3 in cytokinesis. The promoter shutdown experiment using

123

318

MET-promoter controlled CYK3 did not result in growth arrest. This may be due to the leakiness of the promoter. However, cells were found to be deWcient in cell separation providing evidence that also in C. albicans Cyk3 is involved in this process. Our GFP-localization data of Cyk3-GFP provide further evidence for that. Similar to S. cerevisiae, C. albicans Cyk3 may, therefore, act at the level of actin ring formation or constriction. Due to the diploidy of C. albicans, gene function analyses still require much more eVort to produce the correct deletion strains. Using PCR-based gene targeting methods, detailed structure–function analyses are possible and reduce the time required to construct the desired strains. Thus, larger scale approaches can be undertaken also in C. albicans (Noble and Johnson 2005). Our study of three previously uncharacterized C. albicans genes, therefore, adds to the repository of functional analysis information for this human fungal pathogen. Acknowledgments We thank Alexander Johnson, Suzanne Noble, and Aaron Mitchell for generously providing reagents used in this study; Sidsel Ehlers for providing technical assistance and Andrea Walther for support on microscopy. This study was funded by the EUMarie Curie Research Training Network “Penelope” and we thank members of this consortium for discussions.

References am Busch MS, Mignon D, Simonson T (2009) Computational protein design as a tool for fold recognition. Proteins 77:139–158 Barelle CJ, Richard ML, Gaillardin C, Gow NA, Brown AJ (2006) Candida albicans VAC8 is required for vacuolar inheritance and normal hyphal branching. Eukaryot Cell 5:359–367 Bassilana M, Blyth J, Arkowitz RA (2003) Cdc24, the GDP-GTP exchange factor for Cdc42, is required for invasive hyphal growth of Candida albicans. Eukaryot Cell 2:9–18 Bauer J, Wendland J (2007) Candida albicans SX1 suppresses Xocculation and Wlamentation. Eukaryot Cell 6:1736–1744 Berman J, Sudbery PE (2002) Candida albicans: a molecular revolution built on lessons from budding yeast. Nat Rev Genet 3:918–930 Calderone RA, Fonzi WA (2001) Virulence factors of Candida albicans. Trends Microbiol 9:327–335 Care RS, Trevethick J, Binley KM, Sudbery PE (1999) The MET3 promoter: a new tool for Candida albicans molecular genetics. Mol Microbiol 34:792–798 Court H, Sudbery P (2007) Regulation of Cdc42 GTPase activity in the formation of hyphae in Candida albicans. Mol Biol Cell 18:265– 281 Enloe B, Diamond A, Mitchell AP (2000) A single-transformation gene function test in diploid Candida albicans. J Bacteriol 182:5730–5736 Epp JA, Chant J (1997) An IQGAP-related protein controls actin-ring formation and cytokinesis in yeast. Curr Biol 7:921–929 Gillum AM, Tsay EY, Kirsch DR (1984) Isolation of the Candida albicans gene for orotidine-5⬘-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198:179–182 Gola S, Martin R, Walther A, Dunkler A, Wendland J (2003) New modules for PCR-based gene targeting in Candida albicans: rapid

123

Curr Genet (2010) 56:309–319 and eYcient gene targeting using 100 bp of Xanking homology region. Yeast 20:1339–1347 Karkkainen S, Hiipakka M, Wang JH, Kleino I, Vaha-Jaakkola M, Renkema GH, Liss M, Wagner R, Saksela K (2006) IdentiWcation of preferred protein interactions by phage-display of the human Src homology-3 proteome. EMBO Rep 7:186–191 Korinek WS, Bi E, Epp JA, Wang L, Ho J, Chant J (2000) Cyk3, a novel SH3-domain protein, aVects cytokinesis in yeast. Curr Biol 10:947–950 Kumamoto CA, Vinces MD (2005) Contributions of hyphae and hypha-co-regulated genes to Candida albicans virulence. Cell Microbiol 7:1546–1554 Martin R, Hellwig D, Schaub Y, Bauer J, Walther A, Wendland J (2007) Functional analysis of Candida albicans genes whose Saccharomyces cerevisiae homologues are involved in endocytosis. Yeast 24:511–522 Mayer BJ (2001) SH3 domains: complexity in moderation. J Cell Sci 114:1253–1263 Michel S, Ushinsky S, Klebl B, Leberer E, Thomas D, Whiteway M, Morschhauser J (2002) Generation of conditional lethal Candida albicans mutants by inducible deletion of essential genes. Mol Microbiol 46:269–280 Nobile CJ, Mitchell AP (2009) Large-scale gene disruption using the UAU1 cassette. Methods Mol Biol 499:175–194 Noble SM, Johnson AD (2005) Strains and strategies for large-scale gene deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot Cell 4:298–309 Oberholzer U, Marcil A, Leberer E, Thomas DY, Whiteway M (2002) Myosin I is required for hypha formation in Candida albicans. Eukaryot Cell 1:213–228 Odds FC (1994) Pathogenesis of Candida infections. J Am Acad Dermatol 31:S2–S5 Ohkuni K, Okuda A, Kikuchi A (2003) Yeast Nap1-binding protein Nbp2p is required for mitotic growth at high temperatures and for cell wall integrity. Genetics 165:517–529 Pruyne D, Bretscher A (2000a) Polarization of cell growth in yeast. J Cell Sci 113:571–585 Pruyne D, Bretscher A (2000b) Polarization of cell growth in yeast. I. Establishment and maintenance of polarity states. J Cell Sci 113:365–375 Schaub Y, Dunkler A, Walther A, Wendland J (2006) New pFA-cassettes for PCR-based gene manipulation in Candida albicans. J Basic Microbiol 46:416–429 Sudbery P, Gow N, Berman J (2004) The distinct morphogenic states of Candida albicans. Trends Microbiol 12:317–324 Tang HY, Xu J, Cai M (2000) Pan1p, End3p, and S1a1p, three yeast proteins required for normal cortical actin cytoskeleton organization, associate with each other and play essential roles in cell wall morphogenesis. Mol Cell Biol 20:12–25 Veses V, Gow NA (2008) Vacuolar dynamics during the morphogenetic transition in Candida albicans. FEMS Yeast Res 8:1339– 1348 Veses V, Richards A, Gow NA (2009) Vacuole inheritance regulates cell size and branching frequency of Candida albicans hyphae. Mol Microbiol 71:505–519 Walther A, Wendland J (2003) An improved transformation protocol for the human fungal pathogen Candida albicans. Curr Genet 42:339–343 Walther A, Wendland J (2004a) Apical localization of actin patches and vacuolar dynamics in Ashbya gossypii depend on the WASP homolog Wal1p. J Cell Sci 117:4947–4958 Walther A, Wendland J (2004b) Polarized hyphal growth in Candida albicans requires the Wiskott–Aldrich Syndrome protein homolog Wal1p. Eukaryot Cell 3:471–482 Walther A, Wendland J (2008) PCR-based gene targeting in Candida albicans. Nat Protoc 3:1414–1421

Curr Genet (2010) 56:309–319 Warren DT, Andrews PD, Gourlay CW, Ayscough KR (2002) Sla1p couples the yeast endocytic machinery to proteins regulating actin dynamics. J Cell Sci 115:1703–1715 Weisman LS, Bacallao R, Wickner W (1987) Multiple methods of visualizing the yeast vacuole permit evaluation of its morphology and inheritance during the cell cycle. J Cell Biol 105:1539–1547 Wendland J (2001) Comparison of morphogenetic networks of Wlamentous fungi and yeast. Fungal Genet Biol 34:63–82 Wendland J, Philippsen P (2002) An IQGAP-related protein, encoded by AgCYK1, is required for septation in the Wlamentous fungus Ashbya gossypii. Fungal Genet Biol 37:81–88 Winzeler EA, Shoemaker DD, AstromoV A, Liang H, Anderson K, Andre B, Bangham R, Benito R, Boeke JD, Bussey H, Chu AM,

319 Connelly C, Davis K, Dietrich F, Dow SW, El Bakkoury M, Foury F, Friend SH, Gentalen E, Giaever G, Hegemann JH, Jones T, Laub M, Liao H, Liebundguth N, Lockhart DJ, Lucau-Danila A, Lussier M, M’Rabet N, Menard P, Mittmann M, Pai C, Rebischung C, Revuelta JL, Riles L, Roberts CJ, Ross-MacDonald P, Scherens B, Snyder M, Sookhai-Mahadeo S, Storms RK, Veronneau S, Voet M, Volckaert G, Ward TR, Wysocki R, Yen GS, Yu K, Zimmermann K, Philippsen P, Johnston M, Davis RW (1999) Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285:901–906 Zheng XD, Lee RT, Wang YM, Lin QS, Wang Y (2007) Phosphorylation of Rga2, a Cdc42 GAP, by CDK/Hgc1 is crucial for Candida albicans hyphal growth. EMBO J 26:3760–3769

123