J Soils Sediments (2016) 16:1754–1763 DOI 10.1007/s11368-016-1404-7

SOILS, SEC 2 • GLOBAL CHANGE, ENVIRON RISK ASSESS, SUSTAINABLE LAND USE • RESEARCH ARTICLE

Cumulative effects of repeated chlorothalonil application on soil microbial activity and community in contrasting soils Manyun Zhang 1,2,3 & Ying Teng 1 & Zhihong Xu 3 & Jun Wang 1 & Peter Christie 1 & Yongming Luo 1

Received: 23 October 2015 / Accepted: 15 March 2016 / Published online: 25 April 2016 # Springer-Verlag Berlin Heidelberg 2016

Abstract Purpose Chlorothalonil (CTN) has received much attention due to its broad-spectrum antifungal function and repeated applications in agriculture production practice. An incubation experiment was conducted to study the accumulating effects of CTN repeated application on soil microbial activities, biomass, and community and to contrast the discrepancy of effects in contrasting soils. Materials and methods Different dosage CTN (5 mg kg−1, T1, and 25 mg kg−1, T5) was applied into two contrasting soils at 7-day intervals. Soil samples were taken 7 days after each application to assess soil enzyme activities and gene abundances. At the end of incubation, the soil samples were also taken to analyze microbial communities in the two test soils. Results and discussion Soil fluorescein diacetate hydrolysis (FDAH) and urease activities were inhibited by CTN repeated applications. After 28 days of incubation, bacterial 16S rRNA gene abundances in T1 and T5 treatments were significantly lower than those in the CK treatments (46.4 and 36.6 % of the CK treatment in acidic red soil, 53.6 and 37.9 % of the CK Responsible editor: Hailong Wang * Ying Teng [email protected]

1

Key Laboratory of Soil Environment and Pollution Remediation, Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, China

2

University of the Chinese Academy of Sciences, Beijing 100049, China

3

Environmental Futures Research Institute, School of Natural Sciences, Griffith University, Nathan, Brisbane, Queensland 4111, Australia

treatment in paddy soil). Archaeal 16S rRNA gene abundances of T1 and T5 treatments were observed the similar trends (56.1 and 40.8 % of the CK treatment in acidic red soil, 45.6 and 43.7 % of the CK treatment in paddy soil). Repeated applications at 25 mg kg−1 exerted significantly negative effects on the Shannon-Weaver, Simpson and McIntosh indices. Conclusions Microbial activity, biomass, and functional diversity were significantly inhibited by repeated CTN application at the higher dosage (25 mg kg−1), but the inhibitory effects by the application at the recommended dosage (5 mg kg−1) were erratic. More emphasis needs to be placed on the soil type and cumulative toxicity from repeated CTN application when assessing environmental risk. Keywords Chlorothalonil . Cumulative effects . Repeated application . Soil microorganisms . Soil type

1 Introduction Chlorothalonil (2, 4, 5, 6-tetrachloroisophthalonitrile, CTN) is the second most popular broad-spectrum fungicide for disease control in the agricultural production. According to the PAN Pesticide Use Statistics (http://pesticideinfo.org/Detail_ ChemUse.jsp), the annual yield of CTN in the USA is approximately 5000 t, and in China, the total annual application is more than 8000 t (Liang et al. 2010). CTN is a moderately persistent fungicide with a half-life ranging from 4 days to 6 months in soils and up to 1 year after repeated applications (Motonaga et al. 1998). The typical application dosage of CTN in intensive agriculture is 3000–15,000 g of active ingredient per hectare, and the application cycle is 7 days (Wu et al. 2012). As a consequence, considerable amounts of CTN residues have already been detected in soils (Potter et al. 2001; Zhang et al. 2014).

J Soils Sediments (2016) 16:1754–1763

Once in the soil, CTN and its degradation metabolites may lead to harmful consequences for soil microorganisms and generate adverse effects on the soil environment (Tu 1993; Chaves et al. 2008). Soil microorganisms play key roles in sustaining soil ecosystem services, nutrient cycling, pollutant degradation, and soil remediation. Parameters related to soil microorganisms (soil enzyme activities, 16S rRNA gene abundances, and microbial community diversity) have been used to assess the impacts of disturbance (likely contamination) on soil quality (Duran et al. 2015; Torres et al. 2015). Combinations of these parameters allow more effective assessment of the comprehensive effects of CTN application on soil microorganisms, which might be a helpful signal of adverse alterations in the soil environment. The US Environmental Protection Agency (USEPA) and the International Agency for Research on Cancer (IARC) have already categorized CTN as a Bprobable human carcinogen^ because of its toxicity (Cox 1997). There has been increasing interest regarding the impacts of CTN on soil environmental safety, especially CTN is repeatedly applied to intensive agricultural soil. Although some researches elucidate the impacts of CTN application (Tu 1993; Wu et al. 2012; Jin et al. 2014), a large knowledge gap still exists. Previous studies have paid attention to either the single application or the impact of CTN application at a single microbial level. On the other hand, CTN is widely applied into contrasting agriculture soils, and the soil type is a key factor affecting the fungicide degradation rate (Singh et al. 2003; Wang et al. 2011). However, the researches about CTN mainly focused on a single soil type and paid little attention to the discrepancy of CTN eco-effects in different soils. Further research is therefore required to study the comprehensive effects of repeated CTN application on soil microorganism, especially at the different levels (microbial activities, biomass, and communities) in contrasting soils. The aims of the present study were to assess the effects of repeated CTN application on microbial activity, biomass, and community of two contrasting soils. Fungicide CTN at the recommended dosage and five times recommended dosage were repeatedly applied into two typical soils in South China (acidic red soil and paddy soil) at 7-day intervals. Impacts of repeated CTN application on the non-target microbial biomass and soil microbial community diversity were assessed using real time PCR (RT-PCR) and Biolog-ECO plates, respectively. Soil microbial activities were evaluated in terms of soil fluorescein diacetate hydrolysis (FDAH) and urease activities. Soil FDAH and urease were selected because they are usually considered to reflect the whole microbial activity (Adam and Duncan 2001; Moreno et al. 2001; Taylor et al. 2002). The fluorogenic substrate can be taken up by active cells and then transformed by FDAH, and the FDAH activity has often been used as a sensor and functional indicator of soil health (Adam and Duncan 2001). Soil urease generated predominantly from soil microorganisms can reflect

1755

the contribution of both intracellular and extracellular enzyme activities (Moreno et al. 2001; Guo et al. 2012).

2 Materials and methods 2.1 Chemicals and soil samples The commercial formulation of CTN (75 % active ingredient, Suzhou, China) was used for soil treatments. Acidic red soil samples were collected from farmland (28°15′ N, 116°55′ E) located in Jiangxi Province, and paddy soil samples were collected from farmland (31°53′ N, 120°68′ E) located in Jiangsu Province, China. The two sampling sites were not subjected to any applications of pesticides or fungicides for the previous 5 years. Four surface soil samples (0–20 cm) were taken from four different directions of the farmland with the stainless steel spade and then mixed. The soil samples were air-dried at room temperature, mixed thoroughly, sieved (2-mm mesh), and stored at room temperature prior to use. The properties of the acidic red soil were as follows: soil pH (in water), 4.54; organic matter content, 5.76 g kg−1; total nitrogen (N), 0.39 g kg−1; available phosphorus (P), 0.86 mg kg−1; available potassium (K), 50.11 mg kg−1; cationic exchange capacity (CEC), 8.74 cmol kg−1. The properties of the paddy soil were as follows: soil pH, 7.31; organic matter content, 18.95 g kg−1; total N, 0.92 g kg−1; available P, 9.71 mg kg−1; available K, 64.02 mg kg−1; CEC, 19.53 cmol kg−1. 2.2 Experimental design The commercial formulation of CTN dissolved in double distilled water (ddH2O) was applied into the test soil to give the final concentration of 5 mg kg−1 dry soil (T1), corresponding to the recommended dosage, and 25 mg kg−1 dry soil (T5), corresponding to the highest dosage given during intensive agricultural production. Soil samples were mixed thoroughly to distribute the CTN evenly and transferred to the toughened glass box (220 × 190 × 135 mm). The soil water content was adjusted to 60 % of maximum water holding capacity (WHC) and was adjusted daily by the addition of sterile ddH2O. The boxes were then incubated at 28 °C in the dark. During the incubation, the same dosage of CTN was applied into the test soil at 7-day intervals and re-treated three times to give a total of four applications. Soil samples with sterile ddH2O were used as the blank control (CK), and all treatments were performed in triplicate. During the incubation period, the test soil was sampled to determine soil enzyme activity, microbial biomass, and community diversity after various time intervals. DNA extractions of each sample were performed immediately after sampling. Table 1 shows the time of the CTN applications and soil sampling for each treatment during the experimental period.

1756

J Soils Sediments (2016) 16:1754–1763

Table 1 CTN applications and soil sampling time for each treatment during the experimental period Incubation time (days)

Action

0

The first application then soil sampling

7

Soil sampling then the second application

14 21

Soil sampling then the third application Soil sampling then the fourth application

28

Soil sampling

2.3 Soil enzyme activities FDAH enzyme activity was determined according to the methods of Adam and Duncan (2001). Five-gram soil samples was transferred to 50-ml Erlenmeyer flasks and mixed with 15-ml phosphate buffer. Then, 0.2-ml fluorescein diacetate (1.0 g l−1) was added to each sample. Soil FDAH induced fluorescein diacetate to generate yellow fluorescein. After incubation, the fluorescein was extracted, and the concentration of fluorescein was measured with a spectrophotometer at 490 nm. The results were expressed as μg fluorescein h−1 g−1 dry soil. Soil urease activity was assessed with the method described by Guo et al. (2012). Five-gram soil samples was transferred to 50-ml Erlenmeyer flasks and mixed with 2-ml toluene for 15 min. They were mixed with 10-ml urea and 20-ml citrate buffer (pH 6.7) and kept at 37 °C for 24 h. Then, the mixtures were immediately filtered and analyzed for urease activity. The concentration of NH 4+-N generated from urea hydrolysis was determined with a spectrophotometer at 578 nm. The activity was expressed as mg NH 4+-N g−1 dry soil.

2.4 Soil DNA extraction and gene abundance quantification DNA from soil samples was extracted from 0.5-g test soil with a Fast DNA SPIN Kit for Soil (MP Biomedicals, Cleveland OH, USA). The extraction was performed according to the manufacturer’s protocol. In the final step, the total amount of DNA was quantified with a NanoDrop ND-1000 UV–Vis Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and stored at −20 °C for further analysis. RT-PCR was conducted to assess the abundances of bacterial and archaeal 16S rRNA genes with the CFX96 Optical Table 2 Primers used for PCR and the amplification efficiencies of target genes

Real-Time Detection System (Bio-Rad Laboratories, Inc. Hercules, CA, USA). All samples were run in triplicate. Single RT-PCR reactions were prepared in a total volume of 20.0 μl containing 10.0 μl SYBR® Premix Ex Taq™ (TaKaRa Biotech, Dalian, China), 0.2-μl forward and 0.2-μl reverse primers (Sangon Biotech, Shanghai, China), 2.0-μl template DNA and 7.6-μl sterile ddH2O. A negative control was run with sterile ddH2O as the template instead of soil DNA. The PCR primers of target genes are listed in Table 2 and the amplification efficiencies were 90.3–96.2 %, with an R2 > 0.992. 2.5 Community level physiology profiles After 28 days of incubation, soil samples were taken to assess soil microbial community level physiology profiles (CLPPs) using the method of Schutter and Dick (2001) with some modifications. Briefly, soil samples (equivalent to 10-g dry soil) were added to 100-ml sterile 0.85 % NaCl (w/v) in 250ml flasks and shaken for 30 min. Tenfold serial dilutions were prepared and the 10−3 dilutions were added to a Biolog Eco plate ™ (Biolog, Hayward, CA, USA). The plates were incubated at 25 °C and the color development in each well was recorded as optical density (OD) at 590 nm at 24-h intervals. The Biolog data were expressed with the following parameters: (1) average well color development (AWCD), for substrate utilization of soil microbial community; (2) ShannonWeaver index (H), for the species richness; (3) Simpson index (D), for the most common species in the community; and (4) McIntosh index (U), reflecting the species evenness. Those parameters were calculated according to the description of Zhong et al. (2010). . X AWCD ¼ ODi 31 where ODi is the optical density value of each substrate, corrected by subtracting the value of blank well. The Shannon-Weaver index, Simpson index, and McIntosh index were calculated as follows: H¼−

X

pi ðlnpi Þ X D ¼ 1− ðpi Þ 2 . X 1 2 U¼ N2i

Target genes

Primer

Primer sequence 5′–3′

Amplification efficiency

Bacterial 16S rRNA

515F 907 R 364F 934R

GTGCCAGCMGCCGCGG CCGTCAATTCMTTTRAGTTT CGGGGYGCASCAGGCGCGAA GTGCTCCCCCGCCAATTCCT

96.2 %

Archaea 16S rRNA

90.3 %

J Soils Sediments (2016) 16:1754–1763

1757

and T5 treatments were 69.8 and 35.2 % of their CK counterpart. In paddy soil, the soil FDAH activity of the T1 and T5 treatments were 55.2 and 36.3 % of the data obtained from the CK treatment. Repeated CTN applications also inhibited soil urease activities in two types of soil (Fig. 2). In acidic red soil, higher urease activities were observed after the first CTN application, with significant enhancement (P < 0.05) in the T1 and T5 treatments (0.90 ± 0.03 and 1.32 ± 0.09 mg NH 4+-N g−1 dry soil). However, in paddy soil, both T1 and T5 treatments were present in lower numbers in the plots (Fig. 2). Soil urease activities of T1 and T5 treatments gradually dropped with repeated CTN applications. At 28 days, soil urease activities of acidic red were 0.76 ± 0.05, 0.35 ± 0.01, and 0.22 ± 0.02 mg NH 4+-N g−1 dry soil for the CK, T1, and T5 treatment, respectively. In paddy soil, soil urease activities in T1 and T5 treatments were 13.2 and 8.6 % of that measured in the CK treatment.

where pi is the ratio of activity of each substrate to the sum of all substrates; Ni is the activity on each substrate. 2.6 Statistical analysis All statistical analyses were performed using the SPSS v. 17.0 software package and Duncan’s multiple range test was used to compare pairs of mean values at the 5 % level. Soil enzyme activities and bacterial and archaeal 16S rRNA gene abundances were analyzed by the multi-way analysis of variance (multi-ANOVA). The parameters related with microbial communities were assessed via the two-way analysis of variance (two-way ANOVA). Principal component analysis (PCA) was also used to further distinguish the extent of differentiation of different treatments with regard to soil microbial community carbon utilization profiles. The extraction of components was made by means of the eigenvalues greater than one, and the variances were maximized via the orthogonal factor rotation.

3.2 Effects of repeated chlorothalonil application on bacterial and archaeal 16S rRNA gene abundances

3 Results The bacterial 16S rRNA gene abundances of the CK treatments demonstrated stable up-trends during the whole incubation (Fig. 3). In the acidic red soil, bacterial 16S rRNA gene abundance in the T1 and T5 treatments gradually declined with CTN applications (46.6 and 36.6 % of the CK treatment after 28 days of incubation). The same trends were also observed in the T1 and T5 treatments of paddy soil (53.6 and 37.9 % of the CK treatment after 28 days of incubation). Repeated CTN applications resulted in the reduction of archaeal 16S rRNA gene abundance in the two types of soil, and the inhibited magnitudes of T5 were greater than those of T1 in the two contrasting soils (Fig. 4). By the end of experiment, the archaeal 16S rRNA gene abundances of the three

3.1 Effects of repeated chlorothalonil application on soil enzyme activities During 28 days of incubation, the FDAH activities in the CK treatments showed slow and steady increases (acidic red soil rising from 70.3 ± 2.0 to 77.0 ± 0.1 μg fluorescein h−1 g−1 dry soil and paddy soil from 148.2 ± 6.5 to 172.3 ± 12.9 μg fluorescein h−1 g−1 dry soil). However, in the CTN treatments, the soil FDAH activities gradually declined by CTN applications (Fig. 1). Both the incubation time and application dosage significantly affected soil FDAH activities (Table 4). At the end of incubation, in acidic red soil, the soil FDAH activities of T1

B

A 120

240 CK T1 T5

90

a

a

a

a

a a a

b b

60

b

b

b

c c c

30

0

FDAH activity (μg fluorescein h-1 g-1 dry soil)

FDAH activity (μg fluorescein h-1 g-1 dry soil)

Fig. 1 Effects of repeated CTN application on soil fluorescein diacetate hydrolysis at 7-day intervals. a Acidic red soil, b paddy soil. Values are means ± SD of triplicate measurements. Significant differences between treatments at the P = 0.05 level are indicated by different letters

CK T1 T5

a 180

a a a a

a

a b

b

120

c

b

b

c c c 60

0 0

7

14

21

Incubation time (d)

28

0

7

14

21

Incubation time (d)

28

1758

B

2.0

12

CK T1 T5

1.5

Urease activity (mg NH4+-N g-1 dry soil)

A

Urease activity (mg NH4+-N g-1 dry soil)

Fig. 2 Effects of repeated CTN application on soil urease activity at 7-day intervals. a Acidic red soil, b paddy soil. Values are means ± SD of triplicate measurements. Significant differences between treatments at the P = 0.05 level are indicated by different letters

J Soils Sediments (2016) 16:1754–1763

a

b

1.0

a aa

a

c

a

a ab b

b 0.5

c

b c

CK T1 T5

a

a

a aa

9

a

a

b 6

b

c 3

b c c

b b

0.0 0

7

14

21

0

28

0

Incubation time (d)

treatments in acidic red soil were 1.23 × 109, 6.90 × 108, and 5.02 × 108 copy numbers g −1 dry soil (in the sequence CK>T1>T5) and the corresponding values in the paddy soil were 2.14 × 109, 9.96 × 108, and 9.36 × 108 copy numbers g−1 dry soil, respectively.

In acidic red soil, the T1 treatment showed the highest AWCD, and the AWCD in T5 treatment was significantly lower than those obtained from the CK and T1 treatments (P < 0.05) (Fig. 5). In contrast, the highest AWCD of the paddy soil occurred in the CK treatment and repeated CTN applications exerted significant negative effects on AWCD, especially at the higher application dosage. Table 3 reveals

A

21

28

B 10

10

3.00x10

4x10

CK T1 T5

CK T1 T5

a 10

10

aa

a a

3x10

a

a ab b b

10

b

1.50x10

c

b c b

7.50x10

9

Copy numbers ·g-1 dry soil

2.25x10

-1 Copy numbers ·g dry soil

14

Incubation time (d)

variations in the Shannon-Weaver index, Simpson index, and McIntosh index in the different treatments. For Simpson index and McIntosh index, the CK and T1 treatment in acidic red soil were significantly higher than T5 treatment (P < 0.05). In paddy soil, the two indices of T5 treatment were the lowest in the three treatments. An overall PCA demonstrates the substrate utilization patterns of all soil treatments. In the acidic red soil, the first and second principal components (PC1 and PC2) explained 40.0 and 22.2 % of the variance in the data. And, the twodimensional PCA plot of the paddy soil explained 57.5 % of the total variance and PC1 had a greater power of separation (accounting for 37.5 %). The analyses of the two-dimensional graph (Fig. 6) and data shown in Table 5 reveal that both the application rate and the soil type were indeed factors influencing the responses of the soil microbial community to repeated

3.3 Effects of repeated chlorothalonil application on soil microbial community

Fig. 3 Effects of repeated CTN application on soil bacterial 16S rRNA gene abundances at 7-day intervals. a Acidic red soil, b paddy soil. Values are means ± SD of triplicate measurements. Significant differences between treatments at the P = 0.05 level are indicated by different letters

7

aa a

a

a

a a ab b

b

b b

10

2x10

b

b

c 10

1x10

0.00

0 0

7

14

21

Incubation time (d)

28

0

7

14

21

Incubation time (d)

28

J Soils Sediments (2016) 16:1754–1763

B

A 1.6x10

9

3.00x10

9

CK

CK T1

T1

a

T5

a

a 9

2.25x10

a a a

b b

8

bb

b c

4.0x10

9

8

a

a ab

bb

9

b b

b

7.50x10

8

7

14

21

28

0

7

Incubation time (d)

CTN applications. The CK treatments were all located toward the positive side of PC1 and the samples from the T5 treatment were situated toward the negative side of PC1. In contrast, T1treated samples of two contrasting soils distributed to the opposite direction of the PC1 (acidic red soil in positive, paddy soil in negative).

4 Discussion CTN applications could exert adverse effects on soil microbial activity, biomass, and community via different pathways. On one hand, as soil xenobiotics with toxicity, CTN has the potential to directly kill or inhibit soil microorganisms. Previous studies have also demonstrated that the principal CTN degradation metabolite 4-hydroxy-2, 5, 6-trichloroisophthalonitrile (HIT) is more toxic and persistent than the parent compound (Sato and Tanaka 1987; Cox 1997; Jin et al. 2014). Therefore, applied CTN and its degradation products could directly affect soil microbial activity, biomass, and community structure. On

14

21

28

Incubation time (d)

the other hand, CTN is a broad-spectrum fungicide and may negatively affect soilborne fungal activity and community, which can also generate indirect impacts on soil microorganisms (Sigler and Turco 2002; Zhang et al. 2016). Consequently, the effects of CTN application on soil microorganisms and soil quality are difficult to assess with a single parameter as indicator. However, the conjunction of soil microbial activities, biomass, and CLPPs as a multiple parameter approach may be useful to better understand the comprehensive effects of CTN applications. Soil microorganisms are involved in organic pollutant biodegradation because of their enzyme pools, and soil enzyme activity is a key parameter describing soil contamination (Margesin and Schinner 1997; Mench et al. 2006; Kotroczó et al. 2014). Fungicides can affect soil enzyme activity via different pathways: (1) by lowering the production of enzymes through inhibitory effects on soil microorganisms, (2) by combining with the active sites of enzymes, (3) through the complexation of substrates, and (4) via reaction with the enzyme– substrate complexes (Wang et al. 2009). In the present study,

A

B 1.0

2.0

CK

CK T1

0.8

T1

1.6

T5

T5 1.2

AWCD

0.6

0.4

0.2

0.8

0.4

0.0

0.0 0

b

0.00 0

AWCD

a b

1.50x10

0.0

Fig. 5 Variation in average well color development (AWCD) for soil samples from the different treatments after four repeated CTN applications at 7-day intervals. a Acidic red soil, b paddy soil. Values are means ± SD of triplicate measurements

a

a

a a

b b

8.0x10

T5

a

Copy numbers ·g -1 dry soil

1.2x10

Copy numbers ·g -1 dry soil

Fig. 4 Effects of repeated CTN application on soil archaeal 16S rRNA gene abundances at 7-day intervals. a Acidic red soil, b paddy soil. Values are means ± SD of triplicate measurements. Significant differences between treatments at the P = 0.05 level are indicated by different letters

1759

24

48

72

96

120

Incubation time (h)

144

168

0

24

48

72

96

120

144

Incubation time (h)

168

1760 Table 3

J Soils Sediments (2016) 16:1754–1763 The functional diversity of soil microbial communities after four repeated CTN applications at 7-day intervals

Treatment

CK 5 mg kg−1 25 mg kg−1

Acid red soil

Paddy soil

Shannon-Weaver

Simpson

McIntosh

Shannon-Weaver

Simpson

McIntosh

2.850 ± 0.033ab 2.939 ± 0.039b 2.809 ± 0.048a

0.933 ± 0.001a 0.938 ± 0.004a 0.924 ± 0.004b

5.465 ± 0.059a 5.257 ± 0.372a 4.323 ± 0.379b

3.179 ± 0.020a 3.179 ± 0.031a 3.053 ± 0.011b

0.955 ± 0.001a 0.953 ± 0.002a 0.944 ± 0.001b

7.264 ± 0.186a 6.374 ± 0.160b 5.668 ± 0.053c

Values are means ± SD of triplicate measurements. Significant differences between treatments at the 5 % level are indicated by different letters

the soil FDAH activities were significantly suppressed by CTN applications, both at the normal and higher application rates, and repeated applications enhanced the inhibition. We hypothesized that applied CTN directly affected these microorganisms and the enzymes they produce. And, this hypothesis is supported by the results that there were clear decline trends of 16S rRNA gene abundances in CTN treatments (Figs. 3 and 4). Although Tu (1993) revealed that CTN application had no negative effects on soil urease activities, our result showed that the urease activities of two contrasting soils were significantly depressed at the end of the incubation period, a result which is more in line with the findings of Piotrowska-Seget et al. (2008), who found that fungicides decline soil urease activities in the case of repeated application. The explanation for the above phenomenon might be that repeated fungicide applications result in the accumulation of fungicide residues and degradation metabolites which can directly inhibit soil microbial activity, including soil urease activity. Ecophysiological indices, bacterial and archaeal 16S rRNA gene abundances have been used as rapid indicators of contamination stress on soil health and quality (Lovley and Anderson 2000; Röling et al. 2004; Mench et al. 2006; Stauffert et al. 2014). Therefore, the direct measurement of 16S rRNA gene abundance is likely to provide more information to identify the negative impacts of CTN applications. We Fig. 6 Principal component analysis of carbon utilization profiles from soil samples after four repeated CTN applications at 7-day intervals. a Acidic red soil, b paddy soil

found that repeated CTN applications exerted adverse effects on soil bacterial and archaeal biomass. This result is consistent with previous studies that in addition to direct inhibitory effects on soil fungi, CTN could also adversely affect non-target microorganisms (Sigler and Turco 2002; Zhang et al. 2016). It is also interesting to note that, as a whole, the decreased magnitudes of bacterial 16S rRNA gene abundance were greater than those of archaea. This might be explained by discrepancies in cell characteristics between archaea and bacteria (Albers and Meyer 2011; Koonin and Mulkidjanian 2013). Archaeal cell walls are mostly composed of pseudomurein, and the archaeal cell envelope consists of multiple polymers including methanochondroitin and additional S layer proteins (Albers and Meyer 2011; Visweswaran et al. 2011). What is more, in contrast to bacterial cytomembrane lipids, archaeal cytomembrane lipids consist of two phytanyl chains which are linked to glycerol and other alcohols. The acyl chains of lipids are usually saturated isoprenoids and this reduces the permeability of archaeal cytomembranes (Konings et al. 2002). As a result, the archaea are more resistant to CTN applications than their bacterial counterparts. Understanding the changes in soil microbial CLPPs is widely recognized as a useful tool for monitoring the soil environment because this reveals the capability of soil microorganisms to respond quickly to soil pollutants (Xu et al. 2008; Chen et al. 2013; Chen et al. 2015). The PCA of

J Soils Sediments (2016) 16:1754–1763 Table 4 Multi-ANOVA for soil microbial activities as affected by soil type, incubation time, CTN application dosage, and their interactions when CTN was repeatedly applied to soil at 7-day intervals

1761

Factor

Soil FDAH activity

Soil urease activity

Bacterial 16S rDNA

Archaeal 16S rDNA

Soil type Incubation time

1699.40*** 21.47***

3514.04*** 100.03***

280.40*** 17.15***

498.66*** 11.26***

Application dosage Soil type × incubation time

592.39*** 0.11

997.48*** 47.21***

233.17*** 1.65

163.55*** 1.13

Soil type × application dosage

102.11***

935.35***

2.43

3.79

15.94*** 4.98***

32.55*** 20.38***

17.01 0.42

Incubation time × application dosage Soil type × incubation time × application dosage

7.30*** 2.35

The categorical factors were soil type (acidic red soil and paddy soil), incubation time (0, 7, 14, 21, and 28 days), and application dosage (CK, 5 and 25 mg kg−1 ). Presented are the F values with the level of significance Significant differences are accepted at *P < 0.05; **P < 0.01; ***P < 0.001

CLPPs in our study demonstrated that repeated CTN applications significantly changed soil microbial metabolic diversity. In acidic red soil, although microbial activities and biomass of T1 treatment significantly declined after 28 days of incubation (Figs. 1a, 2a and 5a), this treatment had a higher AWCD and higher H and D indices. The explanation might be that repeated CTN applications at the recommended dosage increased in soil heterotrophic bacteria as a result of (1) reduced competition with soil fungi for essential nutrients, (2) lack of antagonistic inhibition generated by soil fungi, and (3) release of substrates from the dead fungi (Sigler and Turco 2002; Muñoz-Leoz et al. 2011). The opposite trends in the soil microbial activities and the Biolog data have also been observed previously. Muñoz-Leoz et al. (2011) found that observations on soil microbial activities and biomass were in conflict with data obtained from the Biolog method in soil treated with tebuconazole. The analyses performed using soil enzyme activities, microbial biomass, and Biolog data of the higher dosage CTN treatments in the two contrasting soils are mainly consistent, suggesting that CTN repeated application at the higher dosage (25 mg kg−1) did generate adverse impacts on soil microbial activities, biomass, and functional diversity. The result is in line with that of Kumar et al. (2002) who found that the overall activity of soil microorganisms could be negatively affected when the CTN concentration in the soil is greater than 10 mg kg−1. According to the multi-ANOVA and two-way ANOVA, soil type is a key factor determining the impacts of CTN on Table 5 Two-way ANOVA for soil microbial functional diversity as affected by soil type, CTN application dosage, and their interactions after four repeated applications at 7-day intervals

various microbial parameters (Tables 4 and 5). In the current study, the organic matter content of the acidic red soil was relatively low and the initially applied CTN may have stimulated soil urease production. In contrast, due to the cumulative toxicity arising from repeated applications (even at the recommended application rate), both the acidic red soil and the paddy soil showed declines in soil microbial activities and biomass. Also, no recoveries of two contrasting soil health were observed during the 28 days of incubation (as the data of soil microbial prosperities assessed). These results highlight the importance of taking into account the soil type and the cumulative toxicity generated from repeated applications when assessing the environmental impacts and non-target effects of CTN applications on soil microorganisms and, hence, soil quality.

5 Conclusions Our results indicate that, in both the acidic red soil and the paddy soil, repeated CTN applications (at both 5 and 25 mg kg−1 application dosages) inhibited soil FDAH and urease activities and exerted adverse effects on soil bacterial and archaeal 16S rRNA gene abundances. The negative effects of CTN applications on soil microbial activities and biomass in the two contrasting soil types could be accumulating via repeated applications. The responses of the soil microbial community to repeated CTN applications were inconsistent

Factor

Shannon-Weaver

Simpson

McIntosh

Soil type Application dosage Soil type × application dosage

310.02*** 23.77*** 3.56

175.31*** 22.31*** 1.96

156.05*** 48.98*** 3.11

The categorical factors were soil type (acidic red soil and paddy soil) and application dosage (CK, 5 and 25 mg kg−1 ). Presented are the F values with the level of significance Significant differences are accepted at *P < 0.05; **P < 0.01; ***P < 0.001

1762

between the two contrasting soils. Although CTN repeated applications at a rate of 5 mg kg−1 tended to enhance the Shannon-Weaver index and Simpson index of the acidic red soil, the repeated applications at 25 mg kg−1 did generate fungicide-induced and adverse impacts on microbial functional diversity in the two contrasting soils. More emphasis needs to be applied to the cumulative ecological toxicity of CTN to soil microorganisms under management conditions that include repeated applications. Acknowledgments This work was supported by the Public Service Special Project of the Environmental Protection Ministry of China (No.201109018) and Aspheric Enterprise Developing Co., Ltd., Shanghai, China.

References Adam G, Duncan H (2001) Development of a sensitive and rapid method for the measurement of total microbial activity using fluorescein diacetate (FDA) in a range of soils. Soil Biol Biochem 33:943–951 Albers SV, Meyer BH (2011) The archaeal cell envelope. Nat Rev Microbiol 9:414–426 Chaves A, Shea D, Danehower D (2008) Analysis of chlorothalonil and degradation products in soil and water by GC/MS and LC/MS. Chemosphere 71:629–638 Chen F, Zheng H, Zhang K, Ouyang Z, Wu Y, Shi Q, Li H (2013) Nonlinear impacts of Eucalyptus plantation stand age on soil microbial metabolic diversity. J Soils Sediments 13:887–894 Chen X, Li Z, Liu M, Jiang C, Che Y (2015) Microbial community and functional diversity associated with different aggregate fractions of a paddy soil fertilized with organic manure and/or NPK fertilizer for 20 years. J Soils Sediments 15:292–301 Cox C (1997) No guarantee of safety. J Pestic Reform 17:2–9 Duran R, Bonin P, Jezequel R, Dubosc K, Gassie C, Terrisse F, Abella J, Cagnon C, Militon C, Michotey V (2015) Effect of physical sediments reworking on hydrocarbon degradation and bacterial community structure in marine coastal sediments. Environ Sci Pollut Res 22:15248–15259 Guo H, Yao J, Cai M, Qian Y, Guo Y, Richnow HH, Blake RE, Doni S, Ceccanti B (2012) Effects of petroleum contamination on soil microbial numbers, metabolic activity and urease activity. Chemosphere 87:1273–1280 Jin X, Cui N, Zhou W, Khorram M, Wang D, Yu Y (2014) Soil genotoxicity induced by successive applications of chlorothalonil under greenhouse conditions. Environ Toxicol Chem 33:1043–1047 Konings WN, Albers SV, Koning S, Driessen AJ (2002) The cell membrane plays a crucial role in survival of bacteria and archaea in extreme environments. Antonie Van Leeuwenhoek 81:61–72 Koonin EV, Mulkidjanian AY (2013) Evolution of cell division from shear mechanics to complex molecular machineries. Cell 152:942– 944 Kotroczó Z, Veres Z, Fekete I, Krakomperger Z, Tóth JA, Lajtha K, Tóthmérész B (2014) Soil enzyme activity in response to longterm organic matter manipulation. Soil Biol Biochem 70:237–243 Kumar SB, Walker A, Wright D (2002) Persistence of chlorpyrifos, fenamiphos, chlorothalonil, and pendimethalin in soil and their effects on soil microbial characteristics. B Environ Contam Tox 69: 181–188 Liang B, Li R, Jiang D, Sun J, Qiu J, Zhao Y, Li S, Jiang J (2010) Hydrolytic dechlorination of chlorothalonil by Ochrobactrum sp.

J Soils Sediments (2016) 16:1754–1763 CTN-11 isolated from a chlorothalonil-contaminated soil. Curr Microbiol 61:226–233 Lovley D, Anderson RT (2000) Hexadecane decay by methanogenesis. Nature 404:722–723 Margesin R, Schinner F (1997) Efficiency of indigenous and inoculated cold-adapted soil microorganisms for biodegradation of diesel oil in alpine soils. Appl Environ Microb 63:2660–2664 Mench M, Renella G, Gelsomino A, Landi L, Nannipieri P (2006) Biochemical parameters and bacterial species richness in soils contaminated by sludge-borne metals and remediated with inorganic soil amendments. Environ Pollut 144:24–31 Moreno J, Garcıa C, Landi L, Falchini L, Pietramellara G, Nannipieri P (2001) The ecological dose value (ED50) for assessing Cd toxicity on ATP content and dehydrogenase and urease activities of soil. Soil Biol Biochem 33:483–489 Motonaga K, Takagi K, Matumoto S (1998) Suppression of chlorothalonil degradation in soil after repeated application. Environ Toxicol Chem 17:1469–1472 Muñoz-Leoz B, Ruiz-Romera E, Antigüedad I, Garbisu C (2011) Tebuconazole application decreases soil microbial biomass and activity. Soil Biol Biochem 43:2176–2183 PAN Pesticide Database. Pesticide Action Network, San Francisco. Available online at http://pesticideinfo.org/Detail_ChemUse.jsp Piotrowska-Seget Z, Engel R, Nowak E, Kozdrój J (2008) Successive soil treatment with captan or oxytetracycline affects non-target microorganisms. World J Microb Biot 24:2843–2848 Potter TL, Wauchope RD, Culbreath AK (2001) Accumulation and decay of chlorothalonil and selected metabolites in surface soil following foliar application to peanuts. Environ Sci Technol 35:2634–2639 Röling WF, de Brito IRC, Swannell RP, Head IM (2004) Response of archaeal communities in beach sediments to spilled oil and bioremediation. Appl Environ Microb 70:2614–2620 Sato K, Tanaka H (1987) Degradation and metabolism of a fungicide, 2, 4, 5, 6-tetra-chloroisophthalonitrile (TPN) in soil. Biol Fert Soils 3: 205–209 Schutter M, Dick R (2001) Shifts in substrate utilization potential and structure of soil microbial communities in response to carbon substrates. Soil Biol Biochem 33:1481–1491 Sigler WV, Turco RF (2002) The impact of chlorothalonil application on soil bacterial and fungal populations as assessed by denaturing gradient gel electrophoresis. Appl Soil Ecol 21:107–118 Singh B, Walker A, Morgan J, Wright D (2003) Role of soil pH in the development of enhanced biodegradation of fenamiphos. Appl Environ Microb 69:7035–7043 Stauffert M, Duran R, Gassie C, Cravo-Laureau C (2014) Response of archaeal communities to oil spill in bioturbated mudflat sediments. Microb Ecol 67:108–119 Taylor JP, Wilson B, Mills MS, Burns RG (2002) Comparison of microbial numbers and enzymatic activities in surface soils and subsoils using various techniques. Soil Biol Biochem 34:387–401 Torres I, Bastida F, Hernández T, García C (2015) The effects of fresh and stabilized pruning wastes on the biomass, structure and activity of the soil microbial community in a semiarid climate. Appl Soil Ecol 89:1–9 Tu C (1993) Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Heal Part B 28:67–80 Visweswaran GRR, Dijkstra BW, Kok J (2011) Murein and pseudomurein cell wall binding domains of bacteria and archaea-a comparative view. Appl Microbiol Biot 92:921–928 Wang QY, Zhou DM, Cang L (2009) Microbial and enzyme properties of apple orchard soil as affected by long-term application of copper fungicide. Soil Biol Biochem 41:1504–1509 Wang H, Wang C, Chen F, Wang X (2011) Anaerobic degradation of chlorothalonil in four paddy soils. Ecotox Environ Safe 74:1000– 1005

J Soils Sediments (2016) 16:1754–1763 Wu X, Cheng L, Cao Z, Yu Y (2012) Accumulation of chlorothalonil successively applied to soil and its effect on microbial activity in soil. Ecotox Environ Safe 81:65–69 Xu Q, Jiang P, Xu Z (2008) Soil microbial functional diversity under intensively managed bamboo plantations in southern China. J Soils Sediment 8:177–183 Zhang M, Teng Y, Zhu Y, Wang J, Luo YM, Christie P, Udeigwe TK (2014) Isolation and characterization of chlorothalonil-degrading

1763 bacterial strain H4 and its potential for remediation of contaminated soil. Pedosphere 24:799–807 Zhang M, Xu Z, Teng Y, Christie P, Wang J, Ren W, Luo Y, Li Z (2016) Non-target effects of repeated chlorothalonil application on soil nitrogen cycling: the key functional gene study. Sci Total Environ 543: 636–643 Zhong W, Gu T, Wang W, Zhang B, Lin X, Huang Q, Shen W (2010) The effects of mineral fertilizer and organic manure on soil microbial community and diversity. Plant Soil 326:511–522