Iran J Sci Technol Trans Sci DOI 10.1007/s40995-017-0173-5

RESEARCH PAPER

Development of a Universal Taqman Probe for mRNA Gene Expression Analysis Sadegh Fattahi1 • Galia Amirbozorgi1 • Maryam Lotfi1 • Batoul Amini Navaei1 Saeid Kavoosian1 • Mohsen Asouri1 • Haleh Akhavan-Niaki1,2

•

Received: 6 April 2016 / Accepted: 23 February 2017 Ó Shiraz University 2017

Abstract The detection and monitoring of eukaryotic gene expression have become integral aspects of biological control assessment and diagnosis or treatment of diseases. Taqman probe and SYBR Green I are two most popular fluorescent reporter molecules in gene expression assays, with Taqman probes becoming the preferred choice for real-time PCR as they only detect the targeted product, although a new probe must be synthesized for each target. Here, we present a novel and specific mRNAs quantification method using an attached stem-loop reverse transcriptase universal template and probe. In this method, different target mRNA sequences can be detected employing the same universal probe. In addition, it requires a small region (at least 35 nucleotides) of the gene for primer design, therefore, facilitating the design of primer especially for highly polymorphic regions. The feasibility & Haleh Akhavan-Niaki [email protected]; [email protected] Sadegh Fattahi [email protected] Galia Amirbozorgi [email protected] Maryam Lotfi [email protected] Batoul Amini Navaei [email protected] Saeid Kavoosian [email protected] Mohsen Asouri [email protected]; [email protected] 1

North Research Center-Pasteur Institute of Iran, Amol, Iran

2

Department of Genetics, Faculty of Medicine, Babol University of Medical Sciences, Babol, Iran

and robustness of this approach were studied and compared to SYBR Green I for adenosine deaminase (ADA), ornithine decarboxylase (ODC) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes in MCF-7 cell line treated with Achillea millefolium extract. Results show that ADA and ODC were overexpressed following treatment with different concentrations of Achillea millefolium in universal Taqman assays but not in SYBR Green I assays. Universal Taqman probe assay is an easy, specific and efficient qPCR method allowing effective profiling of many mRNAs without microarray and expensive platforms. Keywords Taqman assay  SYBR Green I  Stem-loop  Adenosine deaminase (ADA)  Ornithine decarboxylase (ODC)  MCF-7

1 Introduction Since 1996, when real-time or quantitative PCR was developed for the first time (Gibson et al. 1996), our knowledge about real-time PCR has been exponentially growing. Today, it becomes a well-established procedure for absolute and relative nucleic acid quantification including RNA expression, copy number variation or genotyping in diagnostic and research laboratories (Wong and Medrano 2005; Liu et al. 2014; Phillips et al. 2014). Contrary to conventional PCR where amplified products are detected by an end-point analysis, real-time PCR allows accumulation of fluorescent reporter molecules that increase as PCR products with each cycle of amplification. Several different types of real-time PCR have been employed to detect amplicons, each with their advantages and disadvantages. Fluorescent reporter

123

Iran J Sci Technol Trans Sci

molecules employed for this purpose include DNA-binding molecules such as SYBR Green, YO-PRO-1, Eva Green, LC Green and BEBO (Ishiguro et al. 1995; Bengtsson et al. 2003; Wittwer et al. 2003) and sequencespecific probes include Taqman, molecular beacons, dual hybridization probes, scorpion PCR primers and iFRET (Piatek et al. 1998; Solinas et al. 2001; Howell et al. 2002). Among fluorescent double-stranded DNA (dsDNA)-specific intercalating dyes, SYBR Green is the most common dye used for real time PCR due to its cost effectiveness and readily availability. The disadvantages of SYBR Green include nonspecific binding to doublestranded DNA (dsDNA) such as non-specific primerdimer which may cause false positive results particularly when the target is rare or absent. It also can inhibit PCR in a concentration-dependent manner, and thus need further optimization condition (Gudnason et al. 2007). Moreover, being not suitable for multiplex qPCR reactions is one major limitation of this dye. In contrast to SYBR Green that binds to each double-strand DNA, Taqman probes can bind specifically to each target, so non-specific products are not detected. Taqman probes become the preferred choice for real-time PCR compared to SYBR Green. The disadvantage of Taqman probes is their cost, as a specific probe must be synthesized for each target. After discovery of microRNAs (miRNAs) a novel quantification method has been developed using stem–loop reverse transcription (RT) primer followed by Taqman PCR analysis (Chen et al. 2005; Busk 2014). In this study, we have developed a novel cost effective and specific mRNAs quantification method using stem-loop RT primer and a universal Taqman probe. In this method, first RT reactions are performed by an mRNA specific stem-loop primer and then the quantification is performed by quantitative real-time PCR using a universal reverse primer and universal probe, as well as mRNA specific forward primer. In recent years, growing attention has been made to use plant and herbal extracts for cancer cure. Plants and herbals have been shown to be effective for anti-proliferation and induction of apoptosis cell death against various malignant tumor cell lines (Machana et al. 2011; Fattahi et al. 2013). Achillea millefolium L. (common yarrow) is an herbaceous perennial plant in the Asteraceae family. It has a variety of uses as a medicine with diverse pharmacological activities (Lakshmi et al. 2011). Adenosine deaminase (ADA) and ornithine decarboxylase (ODC) are two important enzymes in purine metabolism and biosynthesis of polyamines, respectively. They have become promising targets for cancer research. In this study, we developed a new universal Taqman assay and compared this assay with SYBR Green chemistry in their specificity and sensitivity for ADA, ODC and

123

glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene expression in MCF-7 cell line treated with Achillea millefolium L. ethanolic extract.

2 Materials and Methods 2.1 Preparation of Samples Achillea millefolium L. Subsp leaf was harvested in June, 2013 from Polour, Mazandaran, Iran. Dried leaf was powdered and extracted (10 g) with ethanol 85% (v/v) for 72 h in an orbital shaker at room temperature. After filtering through #1 filter paper (Whatman Inc., Hillsboro, OR, USA) followed by centrifugation at 8000 rpm for 15 min, supernatants were again filtered through a 0.2 lm filter under the laminar flow hood. Then, the supernatant was evaporated and dissolved in dimethyl sulfoxide (DMSO) to a final stock concentration of 200 mg/ml. 2.2 Cell Culture and Treatment MCF-7 cell line was purchased from Pasteur institute, Tehran, Iran. The MCF-7 cells were cultured in a 75 cm2 flask in RPMI-1640 medium (PAA, Austria) supplemented with 10% fetal bovine serum and 1% antibiotics penicillin/ streptomycin (Invitrogen, USA) at 37 °C with 5% CO2. After cells had reached 70–80% confluence, they were washed in phosphate-buffered saline (PBS) and then resuspended in 1 ml of the culture medium. The viable cells were then counted using trypan blue. MCF-7 cells were seeded at a density of 1 9 106 cells in a 25 cm2 flask in the presence of 4 ml culture medium in each flask. After 48 h, cells were incubated with two-fold serial dilution 250–31.25 lg/ml (treated 4–1), respectively, of the extract for 24 h. DMSO (the vehicle) was used as negative control (untreated). 2.3 Primer Design For SYBR Green-based real-time assay, ADA1 (NM_00002) and ODC1 (NM_001287188) primer pairs were designed for exon–exon regions using AlleleID 6.0 software. GAPDH primer pair was previously described (Takaoka et al. 2004) (Table 1). For Stem-loop RT-qPCR assay ADA1 (NM_00002), ODC1 (NM_001287188) and GAPDH (NM_001289745) primer pairs were designed for exon–exon regions using AlleleID 6.0 software (Table 2). Stem-loop RT-qPCR primer was designed using miRNA primer designer with slight modification. The modifications included loop replacement by thirty-six nucleotides, to enable a universal Taqman probe recognition as well as an internal reverse primer design. The universal probe and

Iran J Sci Technol Trans Sci Table 1 Sequences of primers used in SYBR Green amplification assays Gene name

Accession number

Forward primer 50 ?30

Reverse primer 50 ?30

ADA 1

NM_000022

CGACAAGCCCAAAGTAGAACTG

TGTCCATGCCAATGACGTTCA

ODC1

NM_001287188

CGATGTTGTTGGTGTCAGCTTC

GAAAGCCACCGCCAATATCAAG

GAPDH

NM_001289745

GGTGGTCTCCTCTGACTTCAACA

GTTGCTGTAGCCAAATTCGTTGT

Table 2 Sequences of primers used in Taqman assays Gene name

Accession number

ADA 1

NM_000022

Primers 50 ?30 Specific forward primer CGACAAGCCCAAAGTAGAACTG RT specific stem-loop primer GTCGTATCCAGTGCTGCGACCGTATGGAT GTGTCTGCGGCGTTTTATCATGCACTGGATACGAC CTCCTGCCATAG

ODC1

NM_001287188

Specific forward primer ACGGGCTCTGATGACGAAGATG RT specific stem-loop primer GTCGTATCCAGTGCTGCGACCGTATGGATGTGTCTGCGGCGTTTTAT CATGCACTGGATACGAC TCAGGCAGGTCA

GAPDH

NM_001289745

Specific forward primer TGGAGTCCACTGGCGTCTTCAC RT specific stem-loop primer GTCGTATCCAGTGCTGCGACCGTATGGATGTGTCTGCGGCG TTTTATCATGCACTGGATACGACAGGCATTGCTGA

reverse primer are able to hybridize, respectively, with the loop and stem part of the initial stem-loop RT-qPCR primer while the melting temperature of the stem part decreases. The sequence of universal Taqman probe is FAM 50 TGGATGTGTCTGCGGCGTTTTATCAT30 BHQ-1 and the sequence of universal reverse primer is 50 GTATCCAGTGCTGCGACCGT30 . Figure 1 shows the structure of the stem-loop RT-qPCR primer and the position of universal Taqman probe and universal reverse primer. 2.4 QPCR Assay Total RNA was isolated from treated and untreated cultures of MCF-7 cells using Tripure isolation reagent (Roche, USA) according to the manufacturer’s instructions. To eliminate genomic DNA contamination, 1 lg of the RNA was initially treated with 1U DNase I (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. For SYBR Green- based real-time PCR, cDNA synthesis was performed using random hexamer primers and RevertAid Reverse Transcriptase (Fermentas, Lithuania). For stem-loop RT assay, RNA samples were

transcribed into cDNA via mRNA specific stem loop-RT primer and RevertAid Reverse Transcriptase (Fermentas, Lithuania). Relative quantitative PCR assay with both universal Taqman probe and SYBR Green I were performed using Step One real-time PCR apparatus (Applied Biosystems, USA). The PCR reagents were all from Qiagen HotStar-Taq reagent set (cat. no. 203205; Qiagen). For the SYRB Green I assay, the final reaction volume was 20 ll consisting of SYBR Green I (1x), 0.5 mM each forward and reverse primers and 1 ll of cDNA. Amplification protocol consisted of an initial denaturation at 95 °C for 5 min followed by 45 cycles, each consisting of denaturation at 95 °C for 45 s, annealing at 62 °C for 1 min and extension at 72 °C for 60 s, and one final cycle of extension at 72 °C for 7 min, followed by a melting analysis procedure. For universal Taqman probe assay, a final reaction volume of 20 ll consisted of 0.5 mM each forward and reverse primers, 0.25 mM universal probe and 1 ll of cDNA. Amplification protocol consisted of an initial denaturation at 95 °C for 5 min, followed by 45 cycles of 95 °C for 30 s and 60 °C for 1 min. The comparative Ct (2-DDCt) method was used to analyze the experimental samples.

123

Iran J Sci Technol Trans Sci Fig. 1 Position of primers for mRNA-specific RT-qPCR. Universal reverse primer (Purpule); universal probe (Yellow); specific RT primer (Green)

Table 3 Expression of ODC and ADA genes by SYBR Green and universal Taqman assays SYBR green assay ADA

p-value

Universal Taqman probe assay ODC

p-value

1

ADA

p-value

p-value

Untreated (control)

1

Treated1 (31 lg/ml)

0.87 ± 0.51

0.6817

1.02 ± 0.48

0.9381

2.86 ± 0.54

0.0040

0.79 ± 0.16

0.0989

Terated2 (62 lg/ml)

1.13 ± 0.19

0.3016

1.23 ± 0.36

0.3238

3.25 ± 0.32

0.0003

1.25 ± 0.13

0.0301

Treated3 (125 lg/ml)

2.7 ± 1.39

0.1015

1.59 ± 0.11

Treated4 (250 lg/ml)

–

1

0.91 ± 0.39

0.7325

6.39 ± 1.22

0.0016

0.87 ± 0.41

0.6148

5.35 ± 0.26

[0.0001

2.5 Statistical Analyzes The results are expressed as the mean and standard deviation (SD) of three independent experiments. Relative gene expression analysis was determined using the 2-DDCT (Livak) method by StepOne Software v2.3. The significant difference between untreated and treated cells was statistically analyzed by paired Student’s t test. A value of p \ 0.05 was considered as statistically significant.

3 Results We previously demonstrated that ethanolic extract of Achillea millefolium L. had a high antioxidant property as well as cytotoxic effect (Amini Navaie et al. 2015). The expression levels of ODC and ADA genes by SYBR Green and universal Taqman assays are shown in Table 3 and Fig. 4. The Achillea millefolium L. extract resulted in an altered expression of ODC gene in SYBR Green I assay. However, there was no significant difference in ODC gene expression between untreated and treated cells in SYBR Green I assay (p [ 0.05). In contrast, with universal Taqman assay, ODC was significantly overexpressed with the increasing of the concentration of Achillea millefolium L. extract, (p \ 0.05) (Table 3). As shown in Table 3, the expression ADA was changed following treatment with different concentrations of Achillea millefolium L. extract both in SYBR Green I and universal Taqman assays. However, there was no significant difference in ADA gene expression by SYBR Green I assay (p [ 0.05). Moreover, ADA gene

123

1

ODC

21.11 ± 1.89

0.0010 [0.0001

expression could not be calculated in cells treated with the highest extract concentration (250 lg/ml) due to absence of signal detected in SYBR Green I assay. In contrast, in the universal Taqman assay, ADA gene expression was significantly increased (p \ 0.05). 3.1 Melting Curve Analysis in SYBR Green I Assay To distinguish primer dimers and/or non-specific amplicons from the specific amplicons in SYBR Green I assays, dissociation curves were analyzed after amplification. The melting curve diagrams revealed a single peak at 85.62, 85.04 and 89.59 °C for ODC, ADA and GAPDH, respectively, (Fig. 2a–c). Figure 2c shows the presence of 2 peaks (primer-dimer and amplicon) corresponding to ADA expression after treatment with 125 lg/ml extract, while a single peak generated by primer-dimer was observed in the presence of 250 lg/ml extract. 3.2 Reproducibility and Sensitivity of Universal Taqman Assays To examine the dynamic range and sensitivity of the mRNA quantification in universal Taqman assay, series of consecutive 10-fold dilutions of untreated RNAs were generated. The cDNA was synthesized by specific stemloop primer followed by real-time PCR amplification with specific forward primer, universal reverse primer and Taqman probe. As seen in Fig. 3, there was a good correlation between Cts obtained and their respective RNA concentrations over four log10 RNA dilutions for three samples (r2 C 0.99) (Fig. 4).

Iran J Sci Technol Trans Sci

Fig. 2 Melting curves from qPCR analysis of GAPDH (a), ODC (b) and ADA (c) genes expression

4 Discussion Plants and herbs are considered among the main sources of anticancer drugs used as a therapeutic agent in the treatment of cancer. Numerous studies have demonstrated the cytotoxic effect of extracts of Achillea millefolium L. against various malignant tumor cell lines (Csupor-Loffler et al. 2009; Ghavami et al. 2010). Extracellular adenosine

plays critical role in regulating several biological functions and ADA is a key enzyme in the regulation of extracellular adenosine levels. The concentration of adenosine increases also in cancer tissues (Spychala 2000; Gessi et al. 2011). Some researchers indicated that adenosine inhibits tumor cell proliferation by inducing G1/S and G2/M cell-cycle arrest (Jia et al. 2010), while others have reported that ADA inhibition lead to significant cell growth inhibition (Barry

123

Iran J Sci Technol Trans Sci

Fig. 3 Standard curve of GAPDH, ODC and ADA after 10-fold dilutions of untreated RNA in the stem-loop RT-qPCR assay with the Ct values plotted against the log of the starting quantity of template for each gene Fig. 4 RT-qPCR analyses of the expression of ODC and ADA genes by SYBR Green I and Universal Taqman assay. The y-axis shows the ratio of specific transcript expression to a housekeeping gene, GAPDH. The X axis represents the expression level of ADA and ODC genes in MCF7 cell line and in the presence of different concentrations of Achillea millefolium L. extract. Treated 1–4 correspond to 31, 62, 125 and 250 lg/ml extract, respectively

and Lind 2000). In contrast, some researchers demonstrated that adenosine promote tumor survival and angiogenesis by a variety of mechanisms such as adhesion of immune cells to the endothelial wall, cytokine synthesis inhibition, exploiting A(2B) adenosine receptor in host immune cells (Ryzhov et al. 2008), downregulation of the cell surface protein CD26 (Tan et al. 2006), or inhibiting the activation of macrophages and lymphocytes (Murphree et al. 2005). ODC, the rate-limiting enzyme in the biosynthesis of polyamines, plays also an essential role in development, grow and cell death. ODC has been found to play both antiapoptotic and pro-apoptotic roles. Some researchers indicated that ODC prevents apoptosis through inhibiting intracellular ROS production (Liu et al. 2005; Wu et al. 2011) while others demonstrated that ODC induces apoptosis through c-Myc (Packham and Cleveland 1994, 1995). Moreover, there are reports indicating that polyamine accumulation triggers apoptosis (Poulin et al. 1995; Tobias

123

and Kahana 1995). In the present study, ADA and ODC genes were shown to be up-regulated in a concentration dependent manner by universal Taqman probe assay. However, in SYBR Green I assay, there was no significant difference in ADA and ODC gene expression between untreated and treated cells.

5 Conclusion The main characteristic of this study is that we used for the first time a specific, cost-effective and simple method for gene expression profiling. The addition of synthetic nucleotides with universal probe has also been reported previously (Rickert et al. 2004) for gene expression analysis. However, the added sunthetic oligonucleotide was linear and was used in the second step of cDNA synthesis, necessitating therefore further optimization efforts and

Iran J Sci Technol Trans Sci

especially forward primers concentration adjustment for each gene expression analysis. In the present method, synthetic stem-loop oligonucleotides are added during the first step of cDNA synthesis, enabling the detection of many genes with a unique universal probe and avoiding further optimization for each new gene. Similar to SYBR Green I, the universal Taqman probe is inexpensive but is more advantageous as it has higher reproducibility and specificity, detects specific amplification products only, and unlike common Taqman probe assay that the synthesis of different probes is required for different sequences, a unique synthesized probe can be used for numerous target sequences. Finally, the most important feature of universal Taqman probe is that contrary to common Taqman probe assay, it requires a small region (at least 35 nucleotides) of the gene for primer design. Therefore, it facilitates the design of primer especially for highly polymorphic regions. The investigation of the expression of other genes using universal Taqman probe in gastric cancer patients also confirmed the specificity of this assay (unpublished data). Taken together, universal Taqman probe assay is an easy, specific and efficient qPCR method allowing gene expression analyzes that not only keep costs to a minimum, but also can permit to effectively profile many mRNAs without microarray and expensive commercial platforms by using only one probe. Acknowledgements This project was financially supported by North research Center-Pasteur Institute of Iran. Compliance with ethical standards Conflict of interest Authors declare no conflict of interest.

References Amini Navaie B, Kavoosian S, Fattahi S, Hajian-Tilaki K, Asouri M, Bishekolaie R et al (2015) Antioxidant and cytotoxic effect of aqueous and hydroalcoholic extracts of the Achillea millefolium L. on MCF-7 Breast Cancer Cell Line. Int Biol Biomed J 1(3):119–125 Barry CP, Lind SE (2000) Adenosine-mediated killing of cultured epithelial cancer cells. Cancer Res 60(7):1887–1894 Bengtsson M, Karlsson HJ, Westman G, Kubista M (2003) A new minor groove binding asymmetric cyanine reporter dye for realtime PCR. Nucleic Acids Res 31(8):e45 Busk PK (2014) A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinform 15:29 Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT et al (2005) Real-time quantification of microRNAs by stem-loop RTPCR. Nucleic Acids Res 33(20):e179 Csupor-Loffler B, Hajdu Z, Zupko I, Rethy B, Falkay G, Forgo P et al (2009) Antiproliferative effect of flavonoids and sesquiterpenoids from Achillea millefolium s.l. on cultured human tumour cell lines. Phytother Res 23(5):672–676 Fattahi S, Ardekani AM, Zabihi E, Abedian Z, Mostafazadeh A, Pourbagher R et al (2013) Antioxidant and apoptotic effects of

an aqueous extract of Urtica dioica on the MCF-7 human breast cancer cell line. Asian Pac J Cancer Prev 14(9):5317–5323 Gessi S, Merighi S, Sacchetto V, Simioni C, Borea PA (2011) Adenosine receptors and cancer. Biochim Biophys Acta 1808(5):1400–1412 Ghavami G, Sardari S, Shokrgozar MA (2010) Anticancerous potentials of Achillea species against selected cell lines. J Med Plants Res 4(22):2411–2417 Gibson UE, Heid CA, Williams PM (1996) A novel method for real time quantitative RT-PCR. Genome Res 6(10):995–1001 Gudnason H, Dufva M, Bang DD, Wolff A (2007) Comparison of multiple DNA dyes for real-time PCR: effects of dye concentration and sequence composition on DNA amplification and melting temperature. Nucleic Acids Res 35(19):e127 Howell WM, Jobs M, Brookes AJ (2002) iFRET: an improved fluorescence system for DNA-melting analysis. Genome Res 12(9):1401–1407 Ishiguro T, Saitoh J, Yawata H, Yamagishi H, Iwasaki S, Mitoma Y (1995) Homogeneous quantitative assay of hepatitis C virus RNA by polymerase chain reaction in the presence of a fluorescent intercalater. Anal Biochem 229(2):207–213 Jia K-Z, Tang B, Yu L, Cheng W, Zhang R, Zhang J-F et al (2010) Adenosine induces G2/M cell-cycle arrest by inhibiting cell mitosis progression. Cell Biol Int 34(1):49–52 Lakshmi T, Geetha R, Roy A, Aravind Kumar S (2011) Yarrow (Achillea millefolium linn.) a herbal medicinal plant with broad therapeutic use - A review. Int J Pharm Sci Rev Res 9(2):136–141 Liu GY, Hung YC, Hsu PC, Liao YF, Chang WH, Tsay GJ et al (2005) Ornithine decarboxylase prevents tumor necrosis factor alpha-induced apoptosis by decreasing intracellular reactive oxygen species. Apoptosis 10(3):569–581 Liu JH, Xun XJ, Pang C, Ma J, Zou H, Chen C et al (2014) Single tube genotyping of CYP2A6 gene deletion based on copy number determination by quantitative real-time PCR. Exp Mol Pathol 97(3):529–534 Machana S, Weerapreeyakul N, Barusrux S, Nonpunya A, Sripanidkulchai B, Thitimetharoch T (2011) Cytotoxic and apoptotic effects of six herbal plants against the human hepatocarcinoma (HepG2) cell line. Chin Med 6(1):39 Murphree LJ, Sullivan GW, Marshall MA, Linden J (2005) Lipopolysaccharide rapidly modifies adenosine receptor transcripts in murine and human macrophages: role of NF-kappaB in A2A adenosine receptor induction. Biochem J 391:575–580 Packham G, Cleveland JL (1994) Ornithine decarboxylase is a mediator of c-Myc-induced apoptosis. Mol Cell Biol 14(9):5741–5747 Packham G, Cleveland J (1995) The role of ornithine decarboxylase in c-Myc-induced apoptosis. Mechanisms in B-Cell Neoplasia 1994, Springer, Berlin, pp 283–290 Phillips NR, Sprouse ML, Roby RK (2014) Simultaneous quantification of mitochondrial DNA copy number and deletion ratio: a multiplex real-time PCR assay. Sci Rep 4:3887 Piatek AS, Tyagi S, Pol AC, Telenti A, Miller LP, Kramer FR et al (1998) Molecular beacon sequence analysis for detecting drug resistance in Mycobacterium tuberculosis. Nat Biotechnol 16(4):359–363 Poulin R, Pelletier G, Pegg A (1995) Induction of apoptosis by excessive polyamine accumulation in ornithine decarboxylaseoverproducing L1210 cells. Biochem J 311:723–727 Rickert AM, Lehrach H, Sperling S (2004) Multiplexed real-time PCR using universal reporters. Clin Chem 50(9):1680–1683 Ryzhov S, Novitskiy SV, Carbone DP, Biaggioni I, Zaynagetdinov R, Goldstein AE et al (2008) Host A2B adenosine receptors promote carcinoma growth. Neoplasia 10(9):987–995 Solinas A, Brown LJ, McKeen C, Mellor JM, Nicol J, Thelwell N et al (2001) Duplex Scorpion primers in SNP analysis and FRET applications. Nucleic Acids Res 29(20):E96

123

Iran J Sci Technol Trans Sci Spychala J (2000) Tumor-promoting functions of adenosine. Pharmacol Ther 87(2–3):161–173 Takaoka M, Harada H, Andl CD, Oyama K, Naomoto Y, Dempsey KL et al (2004) Epidermal growth factor receptor regulates aberrant expression of insulin-like growth factor-binding protein 3. Cancer Res 64(21):7711–7723 Tan EY, Richard CL, Zhang H, Hoskin DW, Blay J (2006) Adenosine downregulates DPPIV on HT-29 colon cancer cells by stimulating protein tyrosine phosphatase (s) and reducing ERK1/2 activity via a novel pathway. Am J Physiol Cell Physiol 291(3):C433–C444 Tobias KE, Kahana C (1995) Exposure to ornithine results in excessive accumulation of putrescine and apoptotic cell death in

123

ornithine decarboxylase overproducing mouse myeloma cells. Cell Growth Differ Mol Biol J Am Assoc Cancer Res 6(10):1279–1285 Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ (2003) High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 49(6 Pt 1):853–860 Wong ML, Medrano JF (2005) Real-time PCR for mRNA quantitation. Biotechniques 39(1):75–85 Wu CL, Liao YF, Hung YC, Lu KH, Hung HC, Liu GY (2011) Ornithine decarboxylase prevents dibenzoylmethane-induced apoptosis through repressing reactive oxygen species generation. J Biochem Mol Toxicol 25(5):312–319