Appl Microbiol Biotechnol (2013) 97:2455–2465 DOI 10.1007/s00253-012-4131-z

BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS

In vitro rapid evolution of fungal immunomodulatory proteins by DNA family shuffling Xue-Fei Wang & Qi-Zhang Li & Ting-Wen Bao & Wei-Ran Cong & Wen-Xia Song & Xuan-Wei Zhou

Received: 21 December 2011 / Revised: 19 April 2012 / Accepted: 22 April 2012 / Published online: 22 May 2012 # Springer-Verlag 2012

Abstract Fungal immunomodulatory proteins (FIPs) found in a wide variety of mushrooms hold significant therapeutic potential. Despite much research, the structural determinants for their immunomodulatory functions remain unknown. In this study, a DNA shuffling technique was used to create two shuffled FIP protein libraries: an intrageneric group containing products of shuffling between FIP-glu (FIP gene isolated from Ganoderma lucidum) and FIP-gsi (FIP gene isolated from Ganoderma sinense) genes and an intergeneric group containing the products of shuffling between FIPglu, FIP-fve (FIP gene isolated from Flammulina velutipes), and FIP-vvo (FIP gene isolated from Volvariella volvacea) genes. The gene shuffling generated 426 and 412 recombinant clones, respectively. Using colony blot analysis, we selected clones that expressed relatively high levels of shuffled gene products recognized by specific polyclonal antibodies. We analyzed the DNA sequences of the selected shuffled genes, and testing of their protein products revealed

that they maintained functional abilities to agglutinate blood cells and induce cytokine production by splenocytes from Kunming mice in vitro. Meanwhile, the relationships between protein structure and the hemagglutination activity and between the changed nucleotide sites and expression levels were explored by bioinformatic analysis. These combined analyses identified the nucleotide changes involved in regulating the expression levels and hemagglutination activities of the FIPs. Therefore, we were able to generate recombinant FIPs with improved biological activities and expression levels by using DNA shuffling, a powerful tool for the generation of novel therapeutic proteins and for their structural and functional studies. Keywords Shuffling . Screen . Colony blot . Hemagglutination . Cytokine

Introduction Xue-Fei Wang and Qi-Zhang Li contributed equally to this work and share first authorship. Electronic supplementary material The online version of this article (doi:10.1007/s00253-012-4131-z) contains supplementary material, which is available to authorized users. X.-F. Wang : Q.-Z. Li : T.-W. Bao : W.-R. Cong : X.-W. Zhou (*) Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, People’s Republic of China e-mail: [email protected] X.-W. Zhou e-mail: [email protected] W.-X. Song Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742, USA

Fungal immunomodulatory proteins (FIPs) are small molecules found in both medicinal and edible macrofungi, such as the medicinal mushrooms of Ganoderma spp. and the edible mushroom Flammulina velutipes. Seven types of FIP genes have been isolated from Ganoderma lucidum (Kino et al. 1989), Ganoderma tsugae (Lin et al. 1997), F. velutipes (Ko et al. 1995), Volvariella volvacea (Hsu et al. 1997), Ganoderma sinensis (Zhou et al. 2009a, b), Ganoderma japonicum (GenBank Accession no.: AY987805), and Ganoderma microsporum (Lin and Qiao 2009). FIPs, including their basic components and structural characteristics, characteristic of diversity, gene cloning and expression, their biological function, etc., have been reviewed in a recent publication (Li et al. 2011b). In traditional Chinese medicine, higher fungi are well recognized for their high

2456

nutritional and medicinal value (Zhou et al. 2005). Thus, research and development on FIPs can provide new ways to effectively utilize mushroom resources to produce functional foods and new protein drugs capable of enhancing the body’s immune system (Zhou et al. 2007). However, the bioactivity and expression levels of FIPs are generally low, and the relationships between their structures and functions are still enigmatic. With the development of molecular technologies, more advanced techniques may be applied to compensate for these deficiencies. Among these techniques, DNA shuffling is a powerful process for directed gene evolution, considered one of the most successfully applied methods in research and industrial protein production (Stemmer 1994, 1995; Crameri et al. 1998). In recent years, several techniques based on the theory of DNA shuffling have been derived, including stagger extension process (Zhao et al. 1998), gene family shuffling (Crameri et al. 1998; Kikuchi et al. 2000), and genome shuffling and chromosome shuffling (Zhang et al. 2002; Sugiyama et al. 2006). Recently, PCR-based DNA shuffling has been used frequently in directed evolution of therapeutic proteins, such as cytokines, enzymes, antibodies, and vaccines (Li et al. 2008). As one of the most powerful tools for developing biologically active proteins with novel functions, DNA shuffling can generate evolved recombinant proteins with increased expression (Jung et al. 1999), improved bioactivity (Chang et al. 1999; Leong et al. 2004; Scaldaferro et al. 2001; Aharoni et al. 2004) and enhanced stability (Powell et al. 2000; Jermutus et al. 2001; Stoop et al. 2001; Kaper et al. 2002; Baik et al. 2003; Hao and Berry 2004). In this study, two shuffled libraries were created. One library contained the intrageneric group of shuffled FIP-glu and FIP-gsi genes, and the mutants were designated as FIPSN. The other library included the intergeneric group of shuffled FIP-glu, FIP-fve, and FIP-vvo genes, and the mutants were designated as FIP-SJ. The expression levels in Escherichia coli as well as in vitro biological activities of the products of the shuffled FIP genes were then investigated. The shuffled gene may lead to the change of production level and immunogenic characteristics. The results of this research provide insights into the relationships between the structure and function of FIPs.

Materials and methods Mice The mice were purchased from Shanghai Xipuer-Bikai Experimental Animal Corporation [Animal No. SCXK (Hu200820026)] and maintained in the Animal Center of Shanghai Jiao Tong University. All mice used were 8 weeks of age. All procedures were performed according to the

Appl Microbiol Biotechnol (2013) 97:2455–2465

Guide for the Care and Use of Laboratory Animals (NRC, USA) and approved by the Committee of Shanghai Jiao Tong University School of Medicine. Construction of gene libraries To efficiently increase the expression in E. coli and the specific bioactivity of FIP towards different substrates, the family DNA shuffling technique was used in this study. Based on E. coli preferred codons (http://www.kazusa.or.jp/codon/), fungal immunomodulatory protein genes—FIP-glu (GenBank Accession no.: M58032.1), FIP-gsi (Zhou et al. 2009b), FIP-fve (GenBank Accession no.: GU388420.1), and FIPvvo (Zhou et al. 2009a)—were optimized by the use of the favored codons (http://phenotype.biosci.umbc.edu/codon/ sgd/index.php). Each optimized FIP gene was divided into eight to ten overlapping sequential oligonucleotides sequentially. Every fragment containing 50–60 bp was synthesized with about 18 bp overlapping the two adjacent fragments (Table 1). Two separate libraries were created by DNA shuffling, an intrageneric group library derived from shuffling two optimized FIP genes (FIP-glu and FIP-gsi) and an intergeneric group library derived from three optimized FIP genes (FIPglu, FIP-fve, and FIP-vvo). For the construction of intrageneric and intergeneric group libraries by DNA shuffling, the synthesized FIP gene fragments were mixed in equal amounts for each group, and shuffling was performed as described previously (Stemmer 1994). The fragments were first assembled by PCR without primers. In each library, the reaction mix contained 0.2 μM of DNA fragments, 1.5 mM of MgSO4 (Toyobo, Japan), 0.2 mM of each dNTP (Takara, Japan), and 1 U of DNA polymerase (Toyobo) in the supplied buffer in a total volume of 50 μL. The mixtures of each group were subjected to 2 min at 94 °C, followed by 20 cycles consisting of 15 s at 94 °C, 15 s at 72 °C, and 25 s at 72 °C. The shuffled products were amplified using the products of PCR without primers diluted by 1:100 as templates and specific primers to produce full-length fragments of shuffled FIP genes. In the intrageneric group, the primers were: 5′-GGCTCTAGAGCCGAGCTCGCGGGATCCAT GAGCGATACCG CGCTGATTTTTCG-3′, where the introduced BamHI restriction site is underlined; and the reverse primer was 5′-CCGGAATTCCGGAACTGCAGAACC CCAAGCTTTTAGTTCCACTGCGCAATAATAAAATC3′, where the introduced HindIII restriction site is underlined. In the intergeneric group, the forward primer were three oligonucleotides, 5′-GGCTCTAGAGCCGAGCTCGCGG GATCCATGAGCGATACCGCGCTGATTTTTCG-3′, 5′G G C T C TA G A G C C G A G C T C G C G G G AT C C AT GAGCGCGACCAGCCTGACC-3′, and 5′-GGCTCTA GAGCCGAGCTCGCGGGATCCATGAGCACCGATCT GACCCAG-3′, mixed in equal amounts, and had the same

Appl Microbiol Biotechnol (2013) 97:2455–2465 Table 1 Sequences of oligonucleotides

2457

Names

Sequences (5′–3′)

hglu-1 hglu-2 hglu-3 hglu-4 hglu-5 hglu-6 hglu-7 hglu-8 hglu-9 hglu-10 hgsi-1 hgsi-2 hgsi-3 hgsi-4

ATGAGCGATACCGCGCTGATTTTTCGCCTGGCGTGGGATGTGAAAAAACT CGCGGCCCCAGTTCGGGGTATAATCAAAGCTCAGTTTTTTCACATCCCAC CCCCGAACTGGGGCCGCGGCAACCCGAACAACTTTATTGATACCGTGACC GTATACGCTTTATCGGTCAGCACTTTCGGAAAGGTCACGGTATCAATAAA GACCGATAAAGCGTATACCTATCGCGTGGCGGTGAGCGGCCGCAACCTGG ATCGCTTTCCACCGCATAGCTCGGTTTCACGCCCAGGTTGCGGCCGCTCA TATGCGGTGGAAAGCGATGGCAGCCAGAAAGTGAACTTTCTGGAATATAA TGGTGTTGGTATCCGCAATGCCATAGCCGCTGTTATATTCCAGAAAGTTC TTGCGGATACCAACACCATTCAGGTGTTTGTGGTGGATCCGGATACCAAC TTAGTTCCACTGCGCAATAATAAAATCGTTGTTGGTATCCGGGTCCAC ATGAGCGATACCGCGCTGATTTTTCGTCTGGCGTGGGATGTGAAAAAACTGAGCTTTG AAACGGCTCGGGTTGCCACGGCCCCAGGTCGGGGTATAATCAAAGCTCAGTTTTTTCA TGGCAACCCGAGCCGTTTTGTGGATAACGTGACCTTTCCGCAGGTGCTGGCGGATAAA CCAGATCACGGCCGCTCACCACCACACGATAGGTATACGCTTTATCCGCCAGCACCTG

hgsi-5 hgsi-6 hgsi-7 hgsi-8 hfve-1 hfve-2 hfve-3 hfve-4 hfve-5 hfve-6 hfve-7 hfve-8 hvvo-1 hvvo-2 hvvo-3 hvvo-4 hvvo-5 hvvo-6

TGAGCGGCCGTGATCTGGGCGTGCGTCCGAGCTATGCGGTGGGCAGCGATGGCAGCCA AATGCCATAGCCCTGGTTATATTCCAGAAAGTTCACTTTCTGGCTGCCATCGCTGCCC AACCAGGGCTATGGCATTGCGGATACCAACACCATTCAGGTGTTTGTGATTGATCCGG TTAGTTCCACTGCGCAATAATAAAATCCGCGCCGGTATCCGGATCAATCACAAACA AGCGCGACCAGCCTGACCTTTCAGCTGGCGTATCTGGTGAAAAAAATTGATTTTGATT ATATAGCTGCTCGGGGTGCCGCGGCCCCAGTTCGGGGTATAATCAAAATCAATTTTTT CACCCCGAGCAGCTATATTGATAACCTGACCTTTCCGAAAGTGCTGACCGATAAAAAA CGCCCAGATCGCTGCCGTTCACCACCACGCGATAGCTATATTTTTTATCGGTCAGCAC ACGGCAGCGATCTGGGCGTGGAAAGCAACTTTGCGGTGACCCCGAGCGGCGGCCAGAC CGCCACGCCATAGCCTTTGTTATACTGCAGAAAGTTAATGGTCTGGCCGCCGCTCGGG AAAGGCTATGGCGTGGCGGATACCAAAACCATTCAGGTGTTTGTGGTGATTCCGGATA TTTTTTCCATTCCGCAATAATATATTCTTCGCTGTTGCCGGTATCCGGAATCACCACAA AGCACCGATCTGACCCAGCTGCTGTTTTTTATTGCGTATAACCTGCAGAAAGTGAACT CTGCTCGGGTTGCCACGCTGCCACTGCGGGGTATAATCAAAGTTCACTTTCTGCAGGT GCGTGGCAACCCGAGCAGCTATATTGATGCGGTGGTGTTTCCGCGTGTGCTGACCAAC GATCTTTATCGCCGGTCACCACACGATACTGATACGCTTTGTTGGTCAGCACACGCGG TGACCGGCGATAAAGATCTGGGCATTAAACCGAGCTATAGCGTGCAGGCGGATGGCAG GCCATAGCCGCCGTTATATTCCAGCAGGTTCACTTTCTGGCTGCCATCCGCCTGCACG

hvvo-7 hvvo-8

TATAACGGCGGCTATGGCGTGGCGGATACCACCACCATTAAAATTTATGTGGTGGATC TTATTTCCACTGCGCAATCAGATACTGGTTGCCGTTGCTCGGGTCCACCACATAAATTT

BamHI restriction site underlined; the reverse primers were three oligonucleotides, 5′-CCGGAATTCCGGAACTG C A G A A C C C C A A G C T T T T A G T T CCACTGCGCAATAATAAAATC-3′, 5′-CCGGAATTCCG GAACTGCAGAACCCCAAGCTTTTTTTTCCATTCCG CAATAATATATTC-3′, and 5′-CCGGAATTCCGGAACT GCAGAACCCCAAGCTTTTATTTCCACTGCGCAAT CAG-3′, mixed in equal amounts, with the same HindIII restriction site underlined. The PCR reaction conditions were as follows: 94 °C denaturation for 2 min; 94 °C, 30 s; 55 °C, 30 s; 72 °C, 40 s for 20 cycles, then 72 °C for 7 min for further extension. PCR products of each group were digested by BamHI (NEB, USA) and HindIII (NEB). The full-length fragments of the shuffled FIP in the intergeneric group were

termed FIP-SN and FIP-SJ in the intrageneric groups. The resulting FIP-SN and FIP-SJ gene libraries were subcloned into the pQE-30 vector and transformed into the E. coli strain M15 for subsequent screening. Preparation of FIP-specific antibodies In order to perform colony-blot analysis, anti-FIPs polyclonal antibodies were prepared. As previously described (Li et al. 2010a, b, 2011a; Zhou et al. 2009a, b), four types of FIPs routinely expressed in bacteria were preserved at the Plant Biotechnology Research Center, Shanghai Jiao Tong University. Four corresponding antisera were prepared using the previously published method to prepare rabbit anti-FIP-gsi

2458

Appl Microbiol Biotechnol (2013) 97:2455–2465

polyclonal antibody (Li et al. 2011c). The specificity of the FIP polyclonal antibodies were examined by western blot.

Screening and sequencing The two libraries were transformed into E. coli strain M15, grown, and replicated on PVDF membranes for screening the mutants containing overexpressed recombinant FIPs (reFIPs). The transformants were grown on Luria–Bertani plates containing 100 mg L−1 ampicillin and 25 mg L−1 kanamycin overnight at 37 °C until the colonies were about 1–2 mm in diameter. After placing on the agar surface in contact with the colonies, 0.2 μm microporous PVDF membranes were transferred (colony side up) to fresh plates containing antibiotic (ampicillin and kanamycin) and IPTG (1 mM). Subsequently, the plates covered by PVDF membranes in contact with the colonies were inverted and incubated for 4 h at 37 °C to induce expression. At the same time, the original master plates were placed in the incubator to allow the colonies to re-grow. After incubation, the membranes were used for the colony-blot analysis, which was performed using the specific polyclonal antibody as the primary antibody at a 1:10,000 or 1:8,000 dilution and goat anti-rabbit IgG (alkaline phosphatase conjugated) (Sigma-Aldrich) as the secondary antibody at a 1:5,000 dilution.

Table 2 Primers used in the detection of gene expression of cytokines

Expression, sequence analysis, and purification of reFIP variants The clones which contained many more shuffled FIPs were selected to measure the relative expression level of the recombinant proteins by IPTG induction. DNA sequence analysis of the parental and evolved FIP genes was carried out by using the software Vector NTI 8.0. The proteins were purified using Ni-NTA column to test bioactivity. The parental FIPs were also expressed and purified using the same procedure as previously reported (Li et al. 2010a, b, 2011a; Zhou et al. 2009a).

Hemagglutination assay Blood was obtained from the hearts of 4 to 8-week-old Kunming mouse. Blood cells were collected by centrifugation at 1,500×g for 5 min, washed three times with phosphate buffered saline (PBS) by centrifugation at 1,500×g for 5 min each time, and then resuspended to 1.5 % (v/v) with PBS. The suspension solution (0.1 mL) was placed in 96well U-bottom microtiter plates. The blood cells were treated with various concentrations (0.10, 0.20, 0.39, 0.78, 1.56, 3.13, 6.25, 12.5, 25, 50, and 100 μg mL−1) of reFIP and then incubated at 37 °C for 1.5 and 24 h before examination of hemagglutination.

Names

Sequences

References

IL-1α F IL-1α R IL-2 F IL-2 R IL-3 F IL-3 R IL-4 F IL-4 R IL-5 F IL-5 R IL-6 F IL-6 R IFN-γ F IFN-γ R TNF-α F TNF-α R LT F LT R

CTCTAGAGCACCATGCTACAGAC TGGAATCCAGGGGAAACACTG TTCAAGCTCCACTTCAAGCTCTACAGCGGAAG GACAGAAGGCTATCCATCTCCTCAGAAAGTCC GAAGTGGATCCTGAGGACAGATACG GACCATGGGCCATGAGGAACATTC ATGGGTCTCAACCCCCAGCTAGT GCTCTTTAGGCTTTCCAGGAAGTC ATGACTGTGCCTCTGTGCCTGGAGC CTGTTTTTCCTGGAGTAAACTGGGG TGGAGTCACAGAAGGAGTGGCTAAG TCTGACCACAGTGAGGAATGTCCAC TGAACGCTACACACTGCATCTTGG CGACTCCTTTTCCGCTTCCTGAG ATGAGCACAGAAAGCATGATCCGC CCAAAGTAGACCTGCCCGGACTC TGGCTGGGAACAGGGGAAGGTTGAC CGTGCTTTCTTCTAGAACCCCTTGG

Lomedico et al. (1984)

IL-2R F IL-2R R β-actin F β-actin R

ACTGTGAATGCAAGAGAGGTTTCCG AGCAGGACCTCTCTGTAGAGCCTTG GTGGGCCGCTCTAGGCACCAA CTCTTTGATGTCACGCACGATTTC

Kashima et al. (1985) Fung et al. (1984) Otsuka et al. (1987) Kinashi et al. (1986) Snick et al. (1988) Gray and Goeddel (1983) Pennica et al. (1985) Turetskaya et al. (1992) Miller et al. (1985) Alonso et al. (1986)

Appl Microbiol Biotechnol (2013) 97:2455–2465

2459

Fig. 1 Titer of FIP polyclonal antibodies

Induction of cytokine expression Spleens were removed under sterile conditions from Kunming mice sacrificed by cervical dislocation, and the prepared splenocytes were resuspended in RPMI 1640 medium (Sangon, China) supplemented with 100 mg L−1 ampicillin and 25 mg L−1 kanamycin at 107 cells/well (24-well plate). The induction of cytokines and RT-PCR analysis were carried out using previously described methods (Li et al. 2010a, b, 2011a). All primers used in RT-PCR amplifications to detect gene expression of cytokines (β-actin was used as an internal control) were designed according to the references (Table 2) and synthesized (Shanghai, China).

restriction sites for cloning. The target bands in the final products were approximately 350 bp in length (Fig. SI-2). Preparation of anti-FIP polyclonal antibodies As determined by indirect enzyme-linked immunosorbent assay, the antiserum titers of FIP-glu, FIP-gsi, FIP-fve, and FIP-vvo were greater than 1:625,000 (Fig. 1). Positivity in the assay was indicated by an optical density (OD) value greater than 0.1 and the OD ratio of the positive and negative controls was greater than 2.1. The polyclonal antibodies against FIPs were also detected by western blot, which showed reactivity against bands of 14 kDa, indicating that the prepared anti-FIPs could efficiently detect the target proteins (Fig. 2).

Results DNA shuffling

Screening, expression, and sequence analysis of reFIP variants

The fragments of the intrageneric group were tested by PCR without primers for initial optimization. After 20 PCR cycles, the length of the reassembled fragments covered the full length of the parental FIP gene (Fig. SI-1). The amplification product of the non-primer PCR was used as template for a subsequent PCR with primers synthesized based on the 5′ and 3′ end of parental FIP genes including

The expression levels of FIPs in E. coli cells were detected by colony-blot analysis with the prepared specific polyclonal antibodies used initially. Results of the colony in situ hybridization are represented in Fig. 3, and darker points could be seen in the original membrane blots (Fig. SI-3). A total of 426 FIP-SN clones and 412 FIP-SJ clones were screened to obtain target reFIPs. Shuffled FIPs which were

Fig. 2 Detection of recombinant FIP polyclonal antibodies by western blot analysis. Lane 1, FIP-glu polyclonal antibody; lane 2, FIP-gsi polyclonal antibody; lane 3, FIP-fve polyclonal antibody; lane 4, FIP-vvo polyclonal antibody

2460

Appl Microbiol Biotechnol (2013) 97:2455–2465

Fig. 3 Representation of colony-blot analysis. A–C Screening of FIP-SN shuffled between FIP-glu and FIP-gsi. The primary antibody, including anti-FIP-glu polyclonal antibody and anti-FIP-gsi polyclonal antibody, was hybridized at a 1:10,000 dilution. D–F Screening of FIP-SJ shuffled between FIP-glu, FIP-fve, and FIP-vvo. The primary antibody, including anti-FIP-glu polyclonal antibody, anti-FIP-fve polyclonal antibody, and anti-FIP-vvo polyclonal antibody, was hybridized at a 1:8,000 dilution

filtered through screening were induced by IPTG and analyzed by SDS-PAGE, then sequenced according to the relative expression levels in order to determine whether shuffling affected sequence and expression. The overall cDNA length of FIP-SN15 and FIP-SN72 did not change (336 bp), but the cDNA length of FIPSJ75 was 9 bp longer. In analyzing the genes encoding the shuffled FIPs, FIP-SN15 and FIP-SN72 were confirmed to be chimeras of the parental FIP-glu and FIPgsi genes, and FIP-SJ75 was a chimera of the FIP-glu, FIP-fve, and FIP-vvo genes. FIP-SN15 was 89.3 % identical to FIP-glu and 96.4 % identical to FIP-gsi; FIP-SN72 was 86.6 % identical to the G. lucidum FIP sequence and 91.1 % identical to the G. sinensis FIP sequence; and FIP-SJ75 exhibited similarities of 52.6 % to FIP-glu, 47.4 % to FIP-fve, and 79.3 % to FIP-vvo (Fig. 4). The amino acid sequence analysis showed that the overall protein length of FIP-SN15 (112 amino acids) did not change as a result of shuffling, which had the primary sequence of FIP-glu with shuffling at positions 24, 31, 32, 34, 36, 38, 41, 44, 53, 58, 62, 68, 82, 97, 102, and 103, mostly non-consecutive locations. Similarly, FIP-SN72, containing 112 amino acids, had shuffled amino acids at positions 24, 31, 32, 34, 38, 41, 44, 53, 58, 62, 68, 82, 97, 102, and 103 compared with FIP-glu. Additionally, there were random mutations at positions 36, 64, 65, 66, and 67 of FIP-SN72. FIP-SJ75, a 115 amino acid protein, achieved multi-site recombination at sites 15, 79, 84, and 88, with 15 traditional random point mutations (Fig. SI-4). These results demonstrated the successful shuffling between FIP genes (Fig. 5). Nine FIP-SN shuffling clones and one FIP-SJ shuffling clone, which were selected for further study, showed that the relative expression levels were significantly higher than

those of other strains among their own group. The relative expression levels were quantified using software BandScan V 5.0. The results showed that the expression level of FIPSN72 was the highest among the FIP-SN clones and was 147.36 and 180.58 % higher than that of FIP-glu and FIPgsi, respectively (Fig. 4a). In the intergeneric group, the expression levels of FIP-SJ75 were 126.42, 176.02, and 115.36 % greater than the amounts of FIP-glu, FIP-fve, and FIP-vvo, respectively (Fig. 4b). Hemagglutination assay FIP-SN15 was capable of agglutinating mouse red blood cells at concentrations greater than 0.20 μg mL−1. The minimum hemagglutination concentration of FIP-SN72 was 3.13 μg mL−1, similar to that of the parental FIPs at 3.13 and 1.56 μg mL−1. Meanwhile, FIP-SJ75 showed hemagglutination activity as well, presenting better bioactivity than the control at concentrations greater than 1.56 μg mL−1. The hemagglutination activities of FIP-glu, FIP-gsi, FIP-fve, and FIP-vvo were apparent at concentrations greater than 3.13 μg mL−1 (Fig. 6). Induction of cytokine expression by recombinant FIPs RT-PCR analysis of induced cytokine levels in mouse splenocytes showed that FIP-SN15 and FIP-SJ75 significantly enhanced the expression of IL-2, IL-4, IFN-γ, IL-2R, and LT in a dose-dependent fashion (Figs. 7 and 8). In contrast, the recombinant protein could increase the expression of IL-2, IL-4, IFN-γ, TNF-α, LT, and IL-2R based on our previous reports (Li et al. 2011a). Therefore, the shuffled FIPs still maintained the abilities to induce cytokine expression in immune cells.

Appl Microbiol Biotechnol (2013) 97:2455–2465

2461

Fig. 4 Comparison of expression levels between parental and shuffled FIPs. a Comparison of the expression levels among FIP-glu, FIP-gsi, and FIP-SN. b Comparison of the expression levels among FIP-glu, FIP-fve, FIP-vvo, and FIP-SJ

Discussion In this study, family gene shuffling was utilized to evolve FIPs with increased expression and enhanced bioactivity. Unlike the traditional DNA shuffling procedure using enzyme-treated gene fragments (Stemmer 1994), artificially synthesized DNA fragments were adopted in the present study. Although the chimeric DNA produced by shuffling artificially synthesized DNA fragments may show reduced randomicity, this method also has some advantages. It is well known from the traditional DNA shuffling process that the initial non-primer PCR is the core step. Synthetic DNA fragments increased the concentration of gene fragments, which is higher than in traditional DNA shuffling, in order to achieve efficient genetic recombination. Indeed, the rate of positive mutation in the genetic recombination library was improved greatly with the artificial fragments, increasing the efficiency of the subsequent colony in situ hybridization. In sequencing of randomly chosen clones from each

library, the read-through rate of the predicted genes was more than 50 % (i.e., more than 50 % of the clones had full-length sequences of about 350 bp nucleotides) in the intrageneric group, and this rate was more than 10 % in the intergeneric group. Thus, the artificial gene fragments provided a more efficient follow-up screening process. Screening for valuable genes from shuffled gene libraries was a key step. With colony in situ hybridization technology, specific shuffled FIPs were selected. The fast, highefficiency and high-throughput colony-blot analysis was performed with specific polyclonal antibodies as the primary antibody and an alkaline phosphatase-conjugated secondary antibody. The relative expression levels of those recombinant FIPs whose epitopes targeted by the FIPspecific antibodies could be determined effectively based on the darkness of the developed spots. A number of colonial bacterial strains with darker signals were selected for SDS-PAGE and sequencing, and these target proteins were induced by IPTG. The shuffling process either caused silent

2462

Appl Microbiol Biotechnol (2013) 97:2455–2465

Fig. 5 Strategy of shuffling of FIPs. Amino acids marked by gray indicate random mutations

mutations or altered amino acids that could result in structural changes of the protein. The fact that these recombinant FIPs by shuffling could be recognized by the antibodies suggested that reFIP structures were not changed greatly in functional sites, which are involved in immunological recognition. Quantification of recombinant FIP proteins was measured by densitometry for subsequent biologic assays. After sequencing and BLAST analysis (Fig. SI-4), several

Fig. 6 Hemagglutination assays with FIPs. Hemagglutination by A FIP-SN15, B FIP-SN72, C FIP-SJ75, D FIP-glu, E FIP-gsi, F FIP-fve, G FIP-vvo, and H ConA. Concentrations of FIPs were 0.10, 0.20, 0.39, 0.78, 1.56, 3.13, 6.25, 12.5, 25, 50, and 100 μg mL−1

amino acid regions, such as 1–23, 45–52, 69–78, 83–96, 87–96, and 104–111 which also exist in FIP-glu, FIP-gsi, FIP-fve, and FIP-vvo, were also found preserved. Some amino acid sites were recombined effectively, such as 24, 34, 36, and 62. At the nucleotide level, except for several regions, such as 1–26, 34–70, 72–80, 110–120, 133–152, 159–170, 175–183, 207–235, 260–289, and 311–337, which were preserved, multiple nucleotide sites such as 27, 33, 71, 77, 81, 83, 92, 96, and 97 were changed. These changes may have led to the change of expression levels, but further analysis will be necessary to determine the contribution of the individual residues. However, the yields of some shuffled FIPs seemed lower than expected in the colony-blot screen. The specific reason is not clear now, but it may be related to the decreased activity of the colony when grown in a larger culture or the change in the gene’s internal structure. A recent study by Kudla et al. suggested that synonymous mutations that do not alter the encoded protein can influence gene expression (Kudla et al. 2009). The authors found that the lower efficiency genes produce tightened folding of mRNA molecules near the ribosomal binding site, which can possibly lower the efficiency of the protein translation machinery. Thus, the change of stability of mRNA folding near the ribosomal binding site due to the synonymous mutations may result in altered expression levels. The hemagglutination activity of FIPs is different using red blood cells from different species (Kino et al. 1989; Hsu et al. 1997). However, FIP-fve has demonstrated such

Appl Microbiol Biotechnol (2013) 97:2455–2465

2463

Fig. 7 Induction of cytokine gene expression by FIP-SN15. Lane M DNA marker DL 2,000. Induction of IL-2 (a), IFN-γ (b), IL-2R (c), LT (d), and IL-4 (e) gene expression by recombinant FIP in mouse spleen cells. The amplified fragments and β-actin used to confirm the equal amount of DNA are shown. The concentrations of FIP-SN15 were 0, 0.5, 1, 2, and 3 μg mL−1 as indicated

activity towards human red blood cells (A, B, AB, and O types) (Ko et al. 1995). With red blood cells from Wistar rats, Balb/c mice, and rabbits, the minimal concentrations of FIP-vvo required for hemagglutination have been found to differ at 0.52, 1.11, and 0.13 μg mL−1, respectively (Hsu et al. 1997). In this study, FIP-gsi showed hemagglutination activity toward Kunming mice red blood cells. In order to compare the bioactivity of FIPs before and after shuffling, the same red blood cells were used in the experiment. The Fig. 8 Induction of cytokine gene expression by FIP-SJ75. Lane M DNA marker DL 2,000. Induction of IL-2 (a), IFN-γ (b), IL-2R (c), LT (d), and IL-4 (e) gene expression by recombinant FIP in mouse spleen cells. The amplified fragments and β-actin used to confirm the equal amount of DNA are shown. The concentrations of FIP-SJ75 were 0, 0.5, 1, 2, and 3 μg mL−1 as indicated

results showed that the hemagglutination activity of shuffled FIPs was similar to parental FIPs. In other words, the shuffled FIPs which increased expression levels maintained their hemagglutination bioactivity. Although the shuffled FIPs demonstrated similar activity to the parental FIPs, there were differences in the activity of evolved FIPs, especially FIP-SN15 and FIP-SN72, recombined from FIP-glu and FIP-gsi. The differences in these amino acids may be related to the different observed

2464

hemagglutination activities of these proteins. Furthermore, the 1–23, 45–52, 69–81, and 87–111 regions of FIP-SJ15 were consistent with FIP-SN15 and FIP-SN72 (Fig. S4), maybe suggesting some relevance to their maintenance of hemagglutination activity. Cytokines are proteins or short peptides that function by transferring information between cells and an immunomodulator T helper (Th) cells, including Th1 and Th2 cells that secrete different functional cytokines (Maggi et al. 1991; Romagnani 1992; Rengarajan et al. 2000). In this study, shuffled FIPs exhibited some similar abilities as the parental FIPs to induce the mRNA expression of the cytokines IL-2, IL-4, IFN-γ, IL-2R, and LT in mouse splenocytes. However, the shuffled FIPs did not show the same activity towards TNF-α, which has been shown to be induced by FIP-glu, FIP-gsi, FIP-fve, and FIP-vvo (Ko et al. 1995; Hsu et al. 1997; Li et al. 2010a, b, 2011a; Haak-Frendscho et al. 1993). It is supposed that the difference results from some slight structural change in shuffling. According to a previous report (Lin et al. 1997), FIP’s activity is determined by its dimerization, and the first α-helix formed by ten amino acids within the 13 amino acids in the N-terminus is the key structure responsible for dimer formation. Thus, the PCR primers cloning FIPs previously were preserved in this study for retaining shuffled FIPs’ activity maximally (Li et al. 2010a, b, 2011a; Zhou et al. 2009a, b). Since the amino acids of the evolved FIPs changed during the DNA shuffling process and did not influence the active sites, both FIP-SN and FIP-SJ clones showed similar abilities to induce cytokine expression. Because these fungal proteins have remarkable pharmacological functions, especially on inhibiting cancer cell proliferation, many researchers focused their attention in developing and utilizing these proteins for human health. However, obtaining large amounts of target proteins by evoluting new genes and developing expression systems will also be a new research direction for industrial production, because the natural yield of FIPs is low in fruit bodies and mycelia. Accordingly, our study demonstrated that it was effective to generate bioactive proteins with increased expression levels by DNA gene shuffling. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (No. 30771500), the Shanghai Science and Technology Committee, and the Shanghai Leading Academic Discipline Project (Project Number: B209).

References Aharoni A, Gaidukov L, Yagur S, Toker L, Silman I, Tawfik DS (2004) Directed evolution of mammalian paraoxonases PON1 and PON3 for bacterial expression and catalytic specialization. Proc Natl Acad Sci USA 101:482–487. doi:10.1073/pnas.2536901100

Appl Microbiol Biotechnol (2013) 97:2455–2465 Alonso S, Minty A, Bourlet Y, Buckingham M (1986) Comparison of three actin-coding sequences in the mouse; evolutionary relationships between the actin genes of warm-blooded vertebrates. J Mol Evol 23:11–22. doi:10.1007/BF02100994 Baik SH, Ide T, Yoshida H, Kagami O, Harayama S (2003) Significantly enhanced stability of glucose dehydrogenase by directed evolution. Appl Microbiol Biotechnol 61:329–335. doi:10.1007/ s00253-002-1215-1 Chang CCJ, Chen TT, Cox BW, Dawes GN, Stemmer WPC, Punnonen J, Patten PA (1999) Evolution of a cytokine using DNA family shuffling. Nat Biotechnol 17:793–797. doi:10.1038/11737 Crameri A, Raillard SA, Bermudez E, Stemmer WPC (1998) DNA shuffling of a family of genes from diverse species accelerates directed evolution. Nature 391:288–291. doi:10.1038/34663 Fung MC, Hapel AJ, Ymer S, Cohen DR, Johnson RM, Campbell HD, Young IG (1984) Molecular cloning of cDNA for murine interleukin-3. Nature 307:233–237. doi:10.1038/307233a0 Gray PW, Goeddel DV (1983) Cloning and expression of murine immune interferon cDNA. Proc Natl Acad Sci USA 80:5842– 5846. doi:10.1073/pnas.80.19.5842 Haak-Frendscho M, Kino K, Sone T, Jardieu P (1993) Ling Zhi-8: a novel T cell mitogen induces cytokine production and upregulation of ICAM-1 expression. Cell Immunol 105:101–113. doi:10.1006/cimm.1993.1182 Hao J, Berry A (2004) A thermostable variant of fructose bisphosphate aldolase constructed by directed evolution also shows increased stability in organic solvents. Protein Eng Des Sel 17:689–697. doi:10.1093/protein/gzh081 Hsu HC, Hsu CI, Lin RH, Kao CL, Lin JY (1997) Fip-vvo, a new fungal immunomodulatory protein isolated from Volvariella volvacea. J Biol Chem 323:557–565 Jermutus L, Honegger A, Schwesinger F, Hanes J, Plückthun A (2001) Tailoring in vitro evolution for protein affinity or stability. Proc Natl Acad Sci USA 98:75–80. doi:10.1073/pnas.011311398 Jung S, Honegger A, Plückthun A (1999) Selection for improved protein stability by phage display. J Mol Biol 294:163–180. doi:10.1006/jmbi.1999.3196 Kaper T, Brouns SJJ, Geerling ACM, De Vos WM, Van der Oost J (2002) DNA family shuffling of hyperthermostable betaglycosidases. Biochem J 368:461–470. doi:10.1042/BJ20020726 Kashima N, Nishi-Takaoka C, Fujita T, Taki S, Yamada G, Hamuro J, Taniguchi T (1985) Unique structure of murine interleukin-2 as deduced from cloned cDNAs. Nature 313:402–404. doi:10.1038/ 313402a0 Kikuchi M, Ohnishi K, Harayama S (2000) An effective family shuffling method using single-stranded DNA. Gene 243:133–137. doi:10.1016/S0378-1119(99)00547-8 Kinashi T, Harada N, Severinson E, Tanabe T, Sideras P, Konishi M, Azuma C, Tominaga A, Bergstedt-Lindqvist S, Takahashi M (1986) Cloning of complementary DNA encoding T-cell replacing factor and identity with B-cell growth factor II. Nature 324:70–73. doi:10.1038/324070a0 Kino K, Yamashita A, Yamaoka K, Watanabe J, Tanaka S, Ko K, Shimizu K, Tsunoo H (1989) Isolated and characterization of a new immunomodulatory protein Ling Zhi-8 (LZ-8), from Ganoderma lucidium. J Biol Chem 264:472–478 Ko JL, Hsu CI, Lin RH, Kao CL, Lin JY (1995) A new fungal immunomodulatory protein, FIP-fve isolated from the edible mushroom, Flammulina velutipes and its complete amino acid sequence. Eur J Biochem 228:244–249. doi:10.1111/j.14321033.1995.0244n.x Kudla G, Murray AW, Tollervey D, Plotkin JB (2009) Codingsequence determinants of gene expression in Escherichia coli. Science 324:255–258. doi:10.1126/science.1170160 Leong SR, Chang JC, Ong R, Dawes G, Stemmer WPC, Punnonen J (2004) Optimized expression and specific activity of IL-12 by

Appl Microbiol Biotechnol (2013) 97:2455–2465 directed molecular evolution. Proc Natl Acad Sci USA 100:1163– 1168. doi:10.1073/pnas.0237327100 Li QZ, Huang L, Zhou XW, Tang KX (2008) Principle and application of DNA shuffling technology in directed evolution of therapeutic protein. Chin Remedies Clin 8:589–593 (in Chinese) Li QZ, Wang XF, Bao TW, Ran L, Lin J, Zhou XW (2010a) In vitro synthesis of a recombinant fungal immunomodulatory protein from Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W. Curt.: Fr.) P. Karst. (Aphyllophoromycetideae) and analysis of its immunomodulatory activity. Int J Med Mushrooms 12:347–358. doi:10.1615/IntJMedMushr.v12.i4.20 Li QZ, Wang XF, Chen YY, Lin J, Zhou XW (2010b) Cytokines expression induced by Ganoderma sinensis fungal immunomodulatory proteins (FIP-gsi) in mouse spleen cells. Appl Biochem Biotechnol 162:1403–1413. doi:10.1007/s12010-010-8916-1 Li QZ, Huang L, Wang XF, Li XS, Wu SQ, Zhou XW (2011a) Fungal immunomodulatory protein from Flammulina velutipes induces cytokine gene expression in mouse spleen cells. Curr Top Nutraceut Res 9:111–118 Li QZ, Wang XF, Zhou XW (2011b) Recent status and prospects of the fungal immunomodulatory protein family. Crit Rev Biotechnol 31:365–375. doi:10.3109/07388551.2010.543967 Li QZ, Zheng SB, Wang XF, Bao TW, Zhou XW (2011c) Preparation of rabbit anti-Ganoderma sinensis immunomodulatory protein polyclonal antibody. Afr J Microbiol Res 5:1562–1564 Lin TL, Qiao B (2009) Immunomodulatory protein cloned from Ganoderma microsporum. US patent no. 7601808 B2 Lin WH, Hung CH, Hsu CI, Lin JY (1997) Dimerization of the Nterminal amphipathic a-helix domain of the fungal immunomodulatory protein from Ganoderma tsugae (fip-gts) defined by a yeast two-hybrid system and site-directed mutagenesis. J Biol Chem 272:20044–20048. doi:10.1074/jbc.272.32.20044 Lomedico PT, Gubler U, Hellmann CP, Dukovich M, Giri JG, Pan YCE, Collier K, Semionow R, Chua AO, Mizel SB (1984) Cloning and expression of murine interleukin-1 cDNA in Escherichia coli. Nature 312:458–462. doi:10.1038/312458a0 Maggi E, Biswas P, Del Prete G, Parronchi P, Macchia D, Simonelli C, Emmi L, De Carli M, Tiri A, Ricci M (1991) Accumulation of Th2-like helper T cells in the conjunctiva of patients with vernal conjunctivitis. J Immunol 146:1169–1174 Miller J, Malek TR, Leonard WJ, Greene WC, Shevach EM, Germain RN (1985) Nucleotide sequence and expression of a mouse interleukin 2 receptor cDNA. J Immunol 134:4212–4217 Otsuka T, Villaret D, Yokota T, Takebe Y, Lee F, Arai N, Arai K (1987) Structural analysis of the mouse chromosomal gene encoding interleukin 4 which expresses B cell, T cell and mast cell stimulating activities. Nucleic Acids Res 15:333–344. doi:10.1093/nar/ 15.1.333 Pennica D, Hayflick JS, Bringman TS, Palladino MA, Goeddel DV (1985) Cloning and expression in Escherichia coli of the cDNA for murine tumor necrosis factor. Proc Natl Acad Sci USA 82:6060–6064. doi:10.1073/pnas.82.18.6060 Powell SK, Kaloss MA, Pinkstaff A, McKee R, Burimski I, Pensiero M, Otto E, Stemmer WPC, Soong NW (2000) Breeding of

2465 retroviruses by DNA shuffling for improved stability and processing yields. Nat Biotechnol 18:1279–1282. doi:10.1038/82391 Rengarajan J, Szabo SJ, Glimcher LH (2000) Transcriptional regulation of Th1/Th2 polarization. Immunol Today 21:479–483. doi:10.1016/S0167-5699(00)01712-6 Romagnani S (1992) Induction of TH1 and TH2 responses: a key role for the ‘natural’ immune response? Immunol Today 13:379–381. doi:10.1016/0167-5699(92)90083-JDOI:dx.doi.org Scaldaferro S, Tinelli S, Borgnetto ME, Azzini A, Capranico G (2001) Directed evolution to increase camptothecin sensitivity of human DNA topoisomerase I. Chem Biol 8:871–881. doi:10.1016/ S1074-5521(01)00059-X Snick JV, Cayphas S, Szikora JP, Renauld JC, Roost EV, Boon T, Sirnpson RJ (1988) cDNA cloning of murine interleukin-HP1: homology with human interleukin 6. Eur J Immunol 18:193–197. doi:10.1002/eji.1830180202 Stemmer WPC (1994) DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution. Proc Natl Acad Sci USA 91:10747–10751. doi:10.1073/pnas.91.22.10747 Stemmer WPC (1995) Searching sequence space. Nat Biotechnol 13:549–553. doi:10.1038/nbt0695-549 Stoop AA, Eldering E, Dafforn TR, Read RJ, Pannekoek H (2001) Different structural requirements for plasminogen activator inhibitor 1 (PAI-1) during latency transition and proteinase inhibition as evidenced by phage-displayed hypermutated PAI-1 libraries. J Mol Biol 305:773–783 Sugiyama M, Yamamoto E, Mukai Y, Kaneko Y, Nishizawa M, Harashima S (2006) Chromosome-shuffling technique for selected chromosomal segments in Saccharomyces cerevisiae. Appl Microbiol Biotechnol 72:947–952. doi:10.1007/s00253-006-0342-5 Turetskaya R, Fashena SJ, Paul NL, Ruddle NH (1992) In: Aggarwal BB, Vilcek J (eds) Tumor necrosis factors: structure, function and mechanism of action. Marcel Dekker, New York, pp 35–60 Zhang YX, Perry K, Vinci VA, Powell K, Stemmer WPC, del Cardayré SB (2002) Genome shuffling leads to rapid phenotypic improvement in bacteria. Nature 415:644–646. doi:10.1038/415644a Zhao H, Giver L, Shao Z, Affholter JA, Arnold FH (1998) Molecular evolution by staggered extension process (StEP) in vitro recombination. Nat Biotechnol 16:258–261. doi:10.1038/nbt0398-258 Zhou XW, Chen WQ, Deng BW, Wang Z, Peng H, Lin J (2005) Application of biotechnology to exploitation and preservation of medicinal fungi. Chin Tradit Herb Drugs 36:451–455 (in Chinese) Zhou XW, Lin J, Li QZ, Yin YZ, Sun XF, Tang KX (2007) Study progress on bioactive proteins from Ganoderma spp. Nat Prod Res Dev 19:916–924 (in Chinese) Zhou XW, Li QZ, Lin J (2009a) The nucleotide sequence coding fungal immunomodulatory protein from Volvaria volvacea. Chinese patent. Application No. 200910047782.3. (in Chinese) Zhou XW, Xie MQ, Hong F, Li QZ, Lin J (2009b) Genomic cloning and characterization of a FIP-gsi gene encoding a fungal immunomodulatory protein from Ganoderma sinensis Zhao et al (Aphyllophoromycetideae). Int J Med Mushrooms 11:77–86. doi:10.1615/IntJMedMushr.v11.i1.90