Appl Microbiol Biotechnol (2010) 85:1551–1563 DOI 10.1007/s00253-009-2174-6
APPLIED MICROBIAL AND CELL PHYSIOLOGY
Inhibition of Candida albicans growth by brominated furanones Miao Duo & Mi Zhang & Yan-Yeung Luk & Dacheng Ren
Received: 16 April 2009 / Revised: 22 July 2009 / Accepted: 29 July 2009 / Published online: 16 September 2009 # Springer-Verlag 2009
Abstract Candida albicans is the most virulent Candida species of medical importance, which presents a great threat to immunocompromised individuals such as HIV patients. Currently, there are only four classes of antifungal agents available for treating fungal infections: azoles, polyenes, pyrimidines, and echinocandins. The fast spread of multidrug resistant C. albicans strains has increased the demand for new antifungal drugs. In this study, we demonstrate the antifungal activity of brominated furanones on C. albicans. Studying the structure and activity of this class of furanones reveals that the exocyclic vinyl bromide conjugated with the carbonyl group is the most important structural element for fungal inhibition. Furthermore, gene expression analysis using DNA microarrays showed that 3 μg/mL of 4-bromo-5Z-(bromomethylene)-3-butylfuran-2M. Duo Department of Civil and Environmental Engineering, Syracuse University, Syracuse, NY 13244, USA M. Zhang Department of Biomedical & Chemical Engineering, Syracuse Biomaterials Institute, Syracuse University, Syracuse, NY 13244, USA Y.-Y. Luk (*) Departments of Chemistry, and Biomedical and Chemical Engineering, Syracuse Biomaterials Institute, Syracuse University, Syracuse, NY 13244, USA e-mail:
[email protected] D. Ren (*) Departments of Biomedical and Chemical Engineering, Civil and Environmental Engineering, and Biology, Syracuse Biomaterials Institute, Syracuse University, Syracuse, NY 13244, USA email:
[email protected]
one (BF1) upregulated 32 C. albicans genes with functions of stress response, NADPH dehydrogenation, and smallmolecule transport, and repressed 21 genes involved mainly in cell-wall maintenance. Interestingly, only a small overlap is observed between the gene expression changes caused by the representative brominated furanone (BF1) in this study and other antifungal drugs reported in literature. This result suggests that brominated furanones and other antifungal drugs may target different fungal proteins or genes. The existence of such new targets provides an opportunity for developing new agents to control fungal pathogens which are resistant to currently available drugs. Keywords Brominated furanone . Candida albicans . Growth inhibition . DNA microarray
Introduction Candida species are primary human fungal pathogens and are the forth most common class of microbes causing bloodstream infections. In particular, Candida albicans is responsible for 53.2% of all infections caused by Candida species in the USA (Edmond et al. 1999). According to the Surveillance and Control of Pathogens of Epidemiologic Importance surveillance system of nosocomial bloodstream infections in US hospitals, the mortality rate associated with nosocomial candidemia is 40% (Wenzel and Edmond 2001). Such infections present a serious threat to public health, especially to immunocompromised HIV patients (Law et al. 1994; White et al. 1998), since 60% of this population carries C. albicans (Sangeorzan et al. 1994). Despite the serious problems of fungal infections, only four classes of antifungal agents: azoles, polyenes, pyrimidines, and echinocandins are currently available for treating
1552
Candida-related infections. In general, most antifungal agents inhibit fungal growth or cause death of the fungi by compromising cell walls or membranes (Akins 2005). The azole antifungals, such as fluconazole, are the most widely used antifungal drugs, which inhibit ergosterol synthesis in fungi and consequently cause the accumulation of toxic intermediates (Akins 2005). Polyenes kill fungi by forming channels through their membranes, which lead to leakage of intracellular components (White et al. 1998). The pyrimidines interfere with RNA synthesis and DNA replication in fungi (Akins 2005). Echinocandins are a relatively new class of antifungal drugs compared to the other three classes; they target the 1,3-β glucan synthase involved in the synthesis of cell-wall components (Akins 2005). Fungal drug resistance has developed rapidly in the last two decades (Odds 1993). For instance, a study conducted in 1990s showed 33% of late-stage AIDS patients carried drugresistant C. albicans strains (Law et al. 1994). Multiple factors have been known to contribute to C. albicans drug resistance, including the extrusion of toxic compounds by efflux pumps, reduction of membrane permeability to drug molecules, modification of drug targets, overexpression of drug-binding proteins, degradation or modification of drug molecules, and modification of the enzymes involved in the drug-targeted pathway (White et al. 1998). In addition to these intracellular strategies, C. albicans can also develop resistance by forming multicellular sessile communities on solid surfaces, known as biofilms (Douglas 2003). Several studies have demonstrated that, like bacterial biofilms, C. albicans biofilms are up to 1,000 times more resistant to antimicrobials, e.g., fluconazole, than their planktonic counterparts (Uppuluri et al. 2008). To understand the mechanism of stress response and drug resistance in C. albicans, a number of studies using DNA microarrays have been conducted to investigate the global gene expression profiles of C. albicans in response to oxidative stress (Wang et al. 2006), estrogen (Cheng et al. 2006), nitric oxide (Hromatka et al. 2005), and various antifungal drugs (Liu et al. 2005; Xu et al. 2007). Liu et al. (2005) investigated the gene expression profiles of C. albicans in response to four representative antifungal drugs, one from each of the four classes mentioned above. The results showed that exposure to 19 μg/mL ketoconazole increased the expression of genes involved in azole resistance and metabolism of lipid, fatty acid, and sterol. Amphotericin B, at 0.029 μg/mL, upregulated genes involved in small-molecule transport and stress response. Caspofungin, at 0.0075 μg/mL, induced the genes involved in cell-wall maintenance. Flucytosine, at 0.098 μg/mL, increased the expression of genes involved in purine and pyrimidine biosynthesis (Liu et al. 2005). The increasing problem of multidrug-resistant fungal infections has increased the demand for new antifungal
Appl Microbiol Biotechnol (2010) 85:1551–1563
drugs. Recent research has shown that brominated furanones, produced as secondary metabolites by the marine red macro alga Delisea pulchra, have strong antifouling activities and are able to inhibit biofilm formation and quorum sensing (cell-to-cell communication that regulates gene expression by sensing and responding to cell density (Waters and Bassler 2005)) of Gram-negative bacteria (Ren et al. 2001, 2004a). Brominated furanones have been shown to inhibit quorum sensing based on either acylated homoserine lactone (Manefield et al. 1999) or furanosyl borate diester (AI-2) (Ren et al. 2001). Interestingly, although the furanones do not affect the growth of Gram-negative bacteria at the concentrations which inhibit quorum sensing, these agents inhibit the growth of Gram-positive bacteria, such as Bacillus subtilis, at concentrations (up to 150 μg/mL) nontoxic to mammalian cells (Kjelleberg et al. 1999; Ren et al. 2004a). A recent patent has also described some antifungal activities of brominated furanones (Holmstrom and Kjelleberg 2001). To effectively control fungal pathogens with this promising class of inhibitors, it is important to understand the mechanism of inhibition and identify the critical structural elements of brominated furanones. In this study, we report the antifungal activities of brominated furanones on C. albicans. A series of furanones was tested including seven BFs and three non-brominated furanones (NFs). The BFs and NFs were selected with systematic changes in structure so that their effects could be rigorously correlated with their structures. Furthermore, DNA microarrays were used to obtain the C. albicans gene expression profiles in the presence or absence of the representative 4-bromo-5Z(bromomethylene)-3-butylfuran-2-one (BF1) to help understand the mechanism of inhibition. To our best knowledge, this is the first report of antifungal activities of five novel furanones. It is also the first study to explore the differential gene expression in C. albicans in response to brominated furanones.
Materials and methods C. albicans strain and growth media The clinical isolate C. albicans SC5314 was routinely grown at 30°C with shaking at 200 rpm in a synthetic dextrose (SD) medium (Liu et al. 2005), containing 0.67% (w/v) yeast nitrogen base without amino acids and 2% (w/v) dextrose, which was buffered with 0.165 M morpholinepropanesulfonic acid (Sigma, St. Louis, MO), and the pH was adjusted to 7.0 with solid NaOH. All the brominated furanones used in this study were synthesized as described previously (Han et al. 2008; Ren and Wood 2004). NF1 and NF2 were obtained from Sigma (St. Louis, MO). NF3
Appl Microbiol Biotechnol (2010) 85:1551–1563
1553
was obtained by treating α-methyllevulic acid with phosphoric acid (H3PO 4) at 140–150°C. All of the synthetic molecules were purified by column chromatography to obtain a purity of at least 95%. All molecules were characterized by proton and carbon 13 nuclear magnetic resonance spectroscopy and high resolution mass spectroscopy. The furanone structures are shown in Fig. 1. BF10 was dissolved in methanol to a concentration of 20 mg/mL. All other BFs and NFs were dissolved in ethanol to a concentration of 20 mg/mL.
Fungicidal effects of furanones on C. albicans The overnight culture of C. albicans was subcultured in 100 mL of SD medium to an OD600 of 0.005 and was grown for 24 h. The cells were then harvested by centrifugation at 4,500 rpm for 5 min at room temperature and washed twice with 0.85% NaCl buffer. Then, the cell pellets were resuspended in 0.85% NaCl buffer, supplemented with 0 or 60 μg/mL BF1, 8, 9, 10, 11, 12, or 14 to an OD600 of 2.0, using 17×100-mm polystyrene test tubes (Fisher Scientific Inc., Pittsburg, PA). After incubation at 30°C for 6 h with shaking at 200 rpm, the treated cells were spread on yeast extract peptone dextrose plates (Sambrook and Russell 2001) containing 20 g/L peptone, 10 g/L yeast extract, 20 g/L dextrose, and 15 g/L agar. The colony-forming units (CFUs) on the plates were counted after 24 h of incubation at 30°C to evaluate the killing of C. albicans by furanones. Duplicate samples for each furanone were tested and five agar plates were counted for each sample.
Growth of C. albicans in the presence and absence of furanones C. albicans was first grown overnight in SD medium at 30°C with shaking at 200 rpm. The overnight culture was then used to inoculate 25 mL of fresh SD medium to an optical density at 600 nm (OD600) of 0.005 and grown until the OD600 reached 1.0. The OD600 values were measured using a Spectronic GNESYS 5 UV-Vis spectrophotometer (Thermo Fisher Scientific Inc, Waltham, MA). This culture was used to inoculate sterile 96-well plates (Costar® No. 9017, Corning Inc, Corning, NY) containing SD medium supplemented with furanones at different concentrations (0, 2.5, 5, 10, 20 μg/mL) to an OD600 of 0.06 with at least two replicates. The amounts of methanol and ethanol were adjusted to be the same for each sample to eliminate the effects of solvents. The samples were incubated at 30°C with shaking at 200 rpm, and the OD600 in each well was measured at 0, 4, 7, 17, and 42 h after inoculation, using an ELx808™ Absorbance Microplate Reader (BioTek Instruments Inc., Winooski, VT).
Br O
O Br
BF1
Br
Br O
O
O
H 3C O
O
Br Br
O
BF8
O
O
Br
O
BF14
Fig. 1 Structures of brominated (BF) and nonbrominated (NF) furanones used in this study. BF1 4-bromo-5Z-(bromomethylene)3-butylfuran-2-one; BF8 4-bromo-5Z-(bromomethylene)-3-methylfuran-2-one; BF9 5-(dibromomethylene)-3-methylfuran-2-one; BF10 3-(dibromomethyl)-5-(dibromomethylene)furan-2-one; BF11 3-(bro-
O
NF1
Br
O Br
BF11 H3C
H3CO O
O
BF10
H 3C Br
O
Br
O Br
BF9
Br
H3C
Br
Br
Br
Br
BF12
To help understand the mechanism of fungal inhibition by brominated furanones and compare with other antifungal drugs, DNA microarrays were used to identify the C. albicans genes affected by the representative furanone BF1. The overnight culture of C. albicans in SD medium was subcultured in 100 mL of the same medium to an OD600 of 0.005 and grown until the OD600 reached 1.0. The culture was then diluted with fresh SD medium to a volume of 100 mL with an initial OD600 of 0.6, and it was grown until the OD600 reached 1.0, which took approximately 2 h. Then, the culture was split into 10
Br
Br
H 3C
DNA microarray analysis
O
NF2
O
O
O
CH3
NF3
momethyl)-5-(dibromomethylene)furan-2-one. BF12 4-bromo-3(bromomethyl)-5Z-(bromomethylene)furan-2-one; BF14 4-bromo-5(dibromomethyl)-3-methylfuran-2(5H)-one. NF1 Citraconic anhydride; IUPAC 3-methyl-2,5-furandione; NF2 4-methoxy-2(5H)-furanone; IUPAC 4-methoxy-2(5H)-furanone; NF3 3,5-dimethylfuran-2(5H)-one
1554
aliquots equally and supplemented with either 1.5 μL of BF1 (20 mg/mL in ethanol) or 1.5 μL ethanol (control). BF1 at the sublethal concentration of 3 μg/mL was chosen to avoid significant cell lysis and ensure the integrity of RNA. After 45 min of incubation with furanone BF1, the cells were harvested by centrifugation at 13,200 rpm for 30 s at 4°C and stored at −80°C until RNA isolation. To lyse the cells, 1.5 mL of Trizol reagent (Invitrogen Co., Carlsbad, CA), and 0.5 mL of 0.5-mm glass beads were added to each frozen tube containing C. albicans cell pellet. The tubes were closed tightly and beaten for 30 s at 4,800 oscillations/min using a mini-bead beater (Biospec Products Inc., Bartlesville, OK). The total RNA was extracted using Trizol reagent by following the manufacture’s protocol. The extracted RNA was further cleaned up using an RNeasy mini-kit (QIAGEN Inc., Valencia, CA) including on-column DNA digestion with RNase-free DNase I. The RNA samples were sent to the DNA Microarray Lab at the Biotechnology Research Institute of the National Research Council of Canada (Montreal, Canada) for microarray hybridization. RNA from a control sample and that from a furanone-treated sample were hybridized to each array. A total of four DNA microarrays were used and four biological replicates were tested. The data were analyzed using Genespring GX version 7.3 (Agilent Technologies, Santa Clara CA). A gene was considered differentially expressed if it was induced/ repressed more than 1.5-fold and had a t test p value less than 0.05. Gene functions were annotated by searching the Candida Genome Database at www.candidagenome.org. RNA dot blotting To corroborate the microarray results, four genes were also checked with RNA dot blotting for their expression levels under the same conditions tested in microarray analysis including orf19.5604 (MDR1), orf19.2175 (CPD1), orf19.2896 (SOU1), and orf19.5565. First, the total RNA of a control sample (no furanone) was used to synthesize complementary DNA (cDNA) using OneStep RT-PCR Kit (QIAGEN Inc., Valencia, CA) by following the manufacture’s protocol. The annealing temperature was optimized based on the primers and was performed at 50°C for 1 min in each cycle. The primer sequences are listed in Table 3. The length of the template cDNA was 457, 364, 455, and 423 bp for orf19.5604 (MDR1), orf19.2175 (CPD1), orf19.2896 (SOU1), and orf19.5565, respectively. The DNA probes labeled with Digoxigenin (DIG)-dUTP were then generated using the same primer sets and PCR DIG Probe Synthesis Kit (Roche Applied Science, Mannheim, Germany) by following the manufacture’s protocol except that the annealing temperature was 48°C for orf19.2175 and orf19.5565 and 51°C for orf19.2896 and orf19.5604. Total RNA was isolated from cultures treated
Appl Microbiol Biotechnol (2010) 85:1551–1563
under the same conditions as in DNA microarray experiments. To conduct dot blotting, each RNA sample was loaded in duplicate (1.5 and 0.5 μg, respectively) on a blotting membrane (Boehringer Ingelheim, Ridgefield, CT) using a Bio-Dot Microfiltration Apparatus (Bio-Rad, Richmond, CA). The loaded RNA was fixed to the membrane by drying at 80°C for 2 h. Then, the DIGlabeled DNA probes were denatured (100°C water bath, 5 min) and hybridized to the RNA samples at 50°C overnight. The membranes were then washed by following the protocol for DIG labeling and detection (Roche Applied Science). To detect the signal, disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2-(5-chloro)tricycle [3.3.1.1,7] decan}-4yl) phenyl phosphate (Roche Applied Science) was used as a substrate to generate chemiluminescence. The light signal was recorded using Biomax X-ray films from Kodak (Rochester, NY).
Results Brominated furanones inhibited the growth of C. albicans To evaluate the effects of furanones on C. albicans growth, C. albicans was grown in SD medium supplemented with 0, 2.5, 5, 10, or 20 μg/mL of each furanone using 96well plates, and the OD600 of each sample was measured at 0, 4, 7, 17, and 42 h after inoculation. Figures 2 and 3 show the growth curves in the presence and absence of BFs and NFs, respectively. BF11 and BF12 exhibited the strongest inhibitory effects, causing significant reduction of cell growth. At 17 h after inoculation, the growth yield of the samples with 2.5 μg/mL of either furanone was less than 20% of that without furanone (Fig. 2). In a recent study, we also found that furanones BF11 and BF 12 can significantly inhibit the growth of Escherichia coli (Han et al. 2008). These findings suggest that the monosubstituted bromides on an exocyclic methyl group can lead to high toxicity to microbes. BF 8 also has strong activities since it reduced the growth of C. albicans at concentrations as low as 5 μg/mL. BF1, BF 9, BF10, and BF 14 exhibited significant growth inhibition at a concentration of 20 μg/mL. At 7 h after inoculation, for example, the growth yield of C. albicans with any one of these furanones was less
Fig. 2 C. albicans growth curves in the presence of brominatedb furanones at 0, 2.5, 5, 10, or 20 μg/mL. The cultures grown in SD medium at 30°C to an OD600 of 1.0 were used to inoculate 96-well plates containing SD medium supplemented with furanones to an OD600 of 0.06 with at least two replicates. The concentration of ethanol or methanol was adjusted to be the same for all the samples to eliminate solvent effects
Appl Microbiol Biotechnol (2010) 85:1551–1563
1555 The effect of BF8 on C. albican growth
The effect of BF1 on C.albicans growth 1.4
1.4
1.2
1.2 1
0.8
Control 2.5 µg/ml 5 µg/ml 10 µg/m
0.6 0.4 0.2
OD 600
OD600
1
Control 2.5 µg/ml 5 µg/ml 10 µg/m 20 µg/ml
0.8 0.6 0.4 0.2
20 µg/ml
0
0 0
10
20 30 Time (hrs)
40
0
50
20
30
40
The effect of BF10 on C. albicans growth
1.4
1.4
1.2
1.2 1 0.8
Control
0.6
2.5 µg/ml
Control 2.5 µg/ml 5 µg/ml
0.6
OD600
1 0.8
0.4
5 µg/ml
0.4
10 µg/m
10 µg/ml 0.2
0.2
20 µg/ml
20 µg/ml
0
0 0
10
20
30
40
0
50
10
Time(hrs)
30
40
50
The effect of BF12 on C. albicans growth
1.4
1.4
1.2
1.2
1
1
0.8
Control 2.5 µg/ml
0.6
5 µg/ml 0.4 0.2
OD 600
OD600
20
Time (hrs)
The effect of BF11 on C. albicans growth
Control 2.5 µg/ml
0.8 0.6
5 µg/ml
10 µg/m
0.4
10 µg/ml
20 µg/ml
0.2
20 µg/ml
0
0
0
10
20
30
40
50
Time (hrs) The effect of BF14 on C. albicans growth
1.2 1 0.8
Control
0.6
2.5 µg/ml
0.4
5 µg/ml 10 µg/m
0.2
20 µg/ml
0 0
10
20
30
Time (hrs)
0
10
20
30
Time (hrs)
1.4
OD600
50
Time (hrs)
The effect of BF9 on C. albicans growth
OD600
10
40
50
40
50
1556
Appl Microbiol Biotechnol (2010) 85:1551–1563 The effect of NF1 on C. albicans growth
The effect of NF2 on C. albicans growth 1.4
1.4 1.2
1.2
1
Control
0.8
2.5 µg/ml 0.6
OD600
OD 600
1
Control 2.5 µg/ml
0.8 0.6
5 µg/ml 10 µg/m
5 µg/ml
0.4 0.2
10 µg/m
0.4
20 µg/ml
0.2
20 µg/ml
0
0 0
10
20
30
40
0
50
10
20
Time (hrs)
30
50
40
Time (hrs)
The effect of NF3 on C. albicans growth 1.4 1.2
OD600
1 0.8 0.6
Control 2.5 µg/ml
0.4
5 µg/ml 10 µg/m
0.2
20 µg/ml
0 0
10
20
30
40
50
Time (hrs)
Fig. 3 C. albicans growth curves in the presence of non-brominated furanones at 0, 2.5, 5, 10, or 20 μg/mL. The experiments were conducted in the same way as described for brominated furanones in Fig. 2
Furanones altered gene expression in C. albicans To help understand the mechanism of inhibition and compare
120% 100% 80% 60% 40% 20%
4 BF 1
12 BF
11 BF
9 BF
BF 8
BF
BF 10
on
tr
ol
1
0%
C
Brominated furanones are fungicidal to C. albicans To understand whether the BFs are cidal or static agents to C. albicans, all the BFs were tested in a viability assay based on CFU count. All BFs were found to reduce CFU significantly; e.g., after treatment with 60 μg/mL of BF8 and BF10 for 6 h in 0.85% NaCl buffer, the CFU of C. albicans was reduced by 50% and 100%, respectively (Fig. 4). This finding suggests that BFs are fungicidal to C. albicans.
140%
Survival rate
than 60% of that without furanone (Fig. 2). In comparison, none of the NFs inhibited cell growth (Fig. 3), which suggests that the bromide group is necessary for growth inhibition. Examining the structures of BF8 and BF14, it can be seen that BF8 bears an exocyclic vinyl bromide conjugated with the carbonyl group, while BF14 does not, suggesting this bromide group is important for the inhibition of C. albicans. To our best knowledge, this is the first report of antifungal activities of BF8, BF10, BF11, BF12, and BF14.
Fig. 4 Fungicidal effects of brominated furanones on C. albicans. C. albicans was treated by 0 and 60 μg/mL of brominated furanones (BF1, BF8–12, BF14) for 6 h. The number of viable cells was determined by counting CFUs. The CFU treated with solvent alone (negative control) was normalized as 100% for comparison
Appl Microbiol Biotechnol (2010) 85:1551–1563
with other currently available antifungal drugs, DNA microarrays were used to analyze the gene expression profiles of C. albicans SC5341 in the presence and absence of 3 μg/mL BF1. This furanone is one of the best studied furanones, and its influence on bacterial gene expression has been studied using DNA microarrays (Ren et al. 2004a, b). Thus, the mechanism of fungal inhibition can be better explored by comparing the gene expression data of the same furanone on different organisms. C. albicans cells at the mid-exponential phase (OD600 of 1.0) were treated with and without 3 μg/mL BF1 for 45 min. The same amount of ethanol was added to the furanonefree samples to eliminate the effect of ethanol. By treating cells with a sublethal concentration of BF1, we expected to identify the genes specifically affected by BF1. A total of 54 genes were found to be significantly modulated (P≤0.05) under this condition. Among them, 32 genes were induced (Table 1), and 21 (Table 2) were repressed by 3 μg/mL BF1 by at least 1.5-fold. The largest group of genes being upregulated are those of unknown functions (28%), followed by the genes involved in the stress response (25%), NADPH dehydrogenase activity (16%), the transport of small molecules (13%), cell cycling and DNA processing (6%), cell wall maintenance (3%), and other functions (9%). In comparison, the largest categories of repressed genes are of unknown functions (33%), followed by the ones associated with cell-wall maintenance (24%), transport of small molecules (19%), and other functions (14%). Genes upregulated by BF1 Nine stress-response genes were induced by BF1 (Table 1). Among them, orf19.2175 was also found recently to be induced by nitric oxide, an antimicrobial compound produced by the innate immune system of mammals (Hromatka et al. 2005). According to BLAST search results, orf19.2175 shares 42% identities and 63% positives with AIF1 of Saccharomyces cerevisiae, which is involved in NADH or NADPH oxidoreductase activity (Hromatka et al. 2005). There were five genes in the NADPH dehydrogenase group (OYE2, OYE22, OYE23, OYE32, and EBP1) induced by BF1 (3.3–20-fold, Table 1). OYE23, EBP1, and OYE32 have been shown to be induced by nitric oxide or benomyl via CAP1, while OYE2 was only induced by nitric oxide (Hromatka et al. 2005). The induction of these genes is consistent with the fungicidal effects of BF1. In addition to orf19.2175, seven other induced genes (MDR1, SOD2, IFR2, CIP1, orf19.2262, YHB1, and TTR2) are also involved in oxidative stress response. The first five of them are regulated via CAP1, which encodes a transcriptional activator involved in oxidative stress response (Wang et al. 2006). Another induced gene, GCS1, encoding gamma-glutamylcysteine synthetase, is also induced by H2O2 (Enjalbert et al. 2006).
1557
BF1 induced four small molecule transport genes, including MDR1, RTA3, HIP1, and YOR1. MDR1 is listed in the category of Stress Response in Table 1, but it is also a member of the multidrug resistance (MDR) family belonging to the major facilitator transporter superfamily. It has been shown to confer resistance to benomyl, methotrexate, 4nitroquinoline-N-oxide, cycloheximide, sulfometuron methyl, benztriazoles, and fluconazole in C. albicans (Ben-Yaacov et al. 1994; Gupta et al. 1998; Wirsching et al. 2000). Our data suggest that MDR1 may also play a role in the stress response to brominated furanones. RTA3, involved in fatty acid transport, was also previously found to be induced by caspfungin, estradiol, and ketoconazole (Bruno and Mitchell 2005; de Micheli et al. 2002; Liu et al. 2005). The overexpression of its homolog RTA1 in S. cerevisiae leads to significant resistance to the strong inhibitor 7aminocholesterol (Soustre et al. 1996). The YOR1 sequence in C. albicans shares 48% identities and 66% positives with S. cerevisiae Yor1p, encoding a membrane transporter of the ABC family involved in the resistance to oligomycin, reveromycin, and aureobasidin A (Katzmann et al. 1995; Ogawa et al. 1998). The induction of YOR1 suggests that it is also involved in stress response to brominated furanones. The genes white-opaque regulator 2 (WOR2) and orf19.2693, related to cell cycling, were also induced by BF1. Orf19.2693, like several genes described above, can also be induced by nitric oxide and benomyl (Hromatka et al. 2005; Karababa et al. 2004). In addition, increased transcription of orf19.2693 has been found after exposure of C. albicans to fluconazole for multiple generations, indicating that orf19.2693 could be involved in the cells’ adaptation to fluconazole (Cowen et al. 2002). WOR2 plays a key role in white-opaque switching and the stability of the opaque state. Opaque state is considered to be sensitive to temperature, resistant to the formation of hyphae, and necessary for mating (Lachke et al. 2003; Slutsky et al. 1987; Zordan et al. 2007). The induction of WOR2 by BF1 suggests that it could also be involved in stress response. Genes repressed by BF1 Five genes (ALS2, ENG1, CHT3, DSE1, and orf19.5267) related to cell-wall maintenance were repressed by BF1. ENG1 and orf19.5267 have also been found to be downregulated in response to caspofungin, one of the echinocandins targeting cell wall maintenance (Liu et al. 2005). orf19.5267 is also repressed by ketoconazole (Liu et al. 2005). CHT3 is required for chitinase activity and normal cell separation in C. albicans. Its deletion can result in unseparated mother and daughter cells (Dunkler et al. 2005). The genes TPO3, ENA21, ESBP6, and orf19.2959.1, involved in transport of small molecules, were also repressed by BF1. Interestingly, ENA21 was previously found to be induced by flucytosine, amphotericin B, and ketoconazole (Liu et al. 2005).
1558
Appl Microbiol Biotechnol (2010) 85:1551–1563
Table 1 C. albicans genes induced by 3 μg/mL BF1 Systematic name
Standard name
Stress response orf19.3340 orf19.6059 orf19.5059 orf19.2396 orf19.3707 orf19.2262 orf19.113
SOD2 TTR2 GCS1 IFR2 YHB1 – CIP1
orf19.5604 MDR1 orf19.2175 – NADPH dehydrogenase activity orf19.3433 OYE23 orf19.125 EBP1 orf19.3131 OYE32 orf19.3234 OYE22 orf19.3443 OYE2 Small molecule transport orf19.1783 YOR1 orf19.4940 HIP1 orf19.23 RTA3 Other functions orf19.1421 DAL3 orf19.1167 – orf19.1237 ARO9 Cell cycling and DNA processing orf19.5992 WOR2 orf19.2693 Cell wall maintenance orf19.896 CHK1 Unknown functions orf19.3139 – orf19.1286 – orf19.93 – orf19.2825 DRE2 orf19.6275 – orf19.7531 – orf19.7306 – orf19.6869 orf19.320
–
Expression ratio (with BF1/no BF1)
1.72 1.80 1.96 2.05 2.65 2.68 3.17
Functions
Manganese-superoxide dismutase Glutaredoxin Gamma-glutamylcysteine synthetase Alcohol dehydrogenase Flavohemoglobin; dihydropteridine reductase Probable quinone oxidoreductase Cadmium-induced protein
5.36 10.94
Benomyl/methotrexate resistance protein Oxidoreductase similar to mammalian apoptosis-inducing factor
20.04 13.87 12.89 4.00 3.30
NAPDH dehydrogenase (old yellow enzyme), isoform 2 NADH:flavin oxidoreductase (old yellow enzyme) NADPH dehydrogenase NADPH dehydrogenase NAPDH dehydrogenase (old yellow enzyme)
1.78 2.57 5.01
Oligomycin resistance ATP-dependent permease Histidine permease Putative transporter or flippase transmembrane protein
1.58 1.65 1.87
Ureidoglycolate hydrolase Sulfonate dioxygenase Aromatic amino acid aminotransferase II
1.54 3.97
Transcriptional regulator of white-opaque switching Transcription corepressor
1.54
Histidine kinase osmosensor; two-component signal transducer
8.82 1.97 1.53 1.69 1.94 2.53 2.87
Conserved hypothetical Hypothetical protein Conserved hypothetical Conserved hypothetical Hypothetical protein Conserved hypothetical Conserved hypothetical
4.21 14.98
Corroborate DNA microarray results with RNA dot blotting To verify the DNA microarray data, the expression levels of orf5604 (MDR1), orf19.2175 (CPD1), orf19.2896 (SOU1), and orf19.5565 were also analyzed using RNA dot blotting. The RNA samples used for dot blotting were isolated from independent cultures treated under the same
protein protein protein protein protein
Conserved hypothetical protein Hypothetical protein
conditions as in microarray experiments. As shown in Table 3, blotting results of all the four genes are consistent with the microarray data (induced or repressed). For example, gene CPD1 was induced 12.94- and 10-fold in DNA microarray and RNA dot blotting experiments, respectively. The blotting results indicate that the micro-
Appl Microbiol Biotechnol (2010) 85:1551–1563
1559
Table 2 C. albicans genes repressed by 3 μg/mL BF1 Systematic name
Standard name
Small molecule transport orf19.4737 TPO3 orf19.5170 ENA21 orf19.2959.1 – orf19.4337 ESBP6 Others orf19.6073 HMX1 orf19.742 ALD6 orf19.2896 SOU1 Cell cycling and DNA processing orf19.3794 CSR1 Cell wall maintenance orf19.1097 ALS2 orf19.5267 orf19.3066 orf19.7586 orf19.3629 Unknown functions orf19.6245 orf19.7502 orf19.1344 orf19.6077 orf19.716 orf19.270 orf19.5565 Response to stress orf19.5193
Expression ratio (with BF1/no BF1)
Functions
0.60 0.61 0.64 0.65
Membrane transporter of the MFS-MDR family P-type ATPase involved in Na+efflux Conserved hypothetical protein Monocarboxylate permease
0.59 0.33 0.60
Heme binding protein Mitochondrial aldehyde dehydrogenase Peroxisomal 2,4-dienoyl-CoA reductase and sorbitol utilization protein
0.60
Putative zinc-finger transcription factor involved in zinc homeostasis
0.42
Agglutinin-like protein ALS2 fragment
– ENG1 CHT3 DSE1
0.56 0.57 0.66 0.66
Hypothetical protein endo-1,3-beta-glucanase chitinase 3 precursor Predicted cell-wall protein
– – – – – – –
0.67 0.67 0.60 0.51 0.51 0.47 0.43
Hypothetical protein Hypothetical protein Hypothetical protein Conserved hypothetical protein Similar to pore-forming bacterial Septicolysin Hypothetical protein Homologous to 3-hydroxyisobutyrate dehydrogenase
FMA1
0.61
Fluconazole and membrane-associated protein
array data are valid and helpful for understanding the effects of brominated furanones on C. albicans.
Discussion In this study, seven BFs and three NFs were explored for their inhibitory effects on C. albicans growth. BF11 and BF12 significantly inhibited cell growth at 2.5 μg/mL and are the two most potent furanones. Five micrograms per milliliter of BF8 exhibited inhibitory activity, while the lowest active concentration of BF1, BF9, BF10, and BF14, was 20 μg/mL. BFs were also found to be fungicidal to C. albicans. The inhibitory activities of furanones are comparable to other antifungals. For example, fluconazole, the most widely used antifungal drug, has MICs between 0.25 and 64 μg/mL for several clinical isolates of C. albicans
strains (Clancy et al. 2005). Amphotericin B and 6-Chloro5-nitropyrimidine derivatives have MICs between 25 and 100 μg/mL to C. albicans (McChesney and GonzalezSierra 1985). In comparison to the strong antifungal activities of brominated furanones, none of the NFs inhibited C. albicans growth at concentrations up to 20 μg/mL. The difference in activities between BFs and NFs suggests that the bromide group is required for inhibitory activities. The monosubstituted bromides on an exocyclic methyl group, which is present only in BF11 and BF12, led to strong inhibition of C. albicans. Considering that BF8 was active at 5 μg/mL and BF14 at 20 μg/mL, the exocyclic vinyl bromide conjugated with the carbonyl group likely has a major contribution to the growth inhibition. The antifungal activities of brominated furanones found in this study, along with the inhibitory effects of furanones on the growth of Gram-positive bacteria and on the multicellular behaviors of Gram-negative bacteria,
1560
Appl Microbiol Biotechnol (2010) 85:1551–1563
Table 3 Confirmation of C. albicans gene expression affected by 3 μg/mL BF1 with RNA dot blotting Gene
orf19.5604 (MDR1) orf19.2175 (CPD1) orf19.2896 (SOU1) orf19.5565
Effect of BF1 3 μg/mL
Primers used for cDNA and probe synthesis
5′- TGGTGGTGCTAGTGTTGC -3′ 5′- AACGGTGATTTCTAATGGTC -3′ 5′-TCACCAAATGATTCAGGGTA-3′ 5′-ATGAGGGCAAAGGTCTTG-3′ 5′-CATTTACAAATCCTGCTTTAGG-3′ 5′-TTGTCCCACGGTATGAGC-3′ 5′-TTTCCCATGTGGTGCTAC-3′ 5′-AAATCACCCAACCATTCA-3′
indicate that brominated furanones could potentially be developed as wide-spectrum antimicrobial agents for medical and industrial applications. Furanone BF1 has been found to repress the genes of chemotaxis, motility, and flagellar synthesis in E. coli (Ren et al. 2004b). The inhibitory effects of furanone BF1 on the growth of B. subtilis and its mechanism have also been explored previously (Ren et al. 2002, 2004a). Furanone BF1 was found to induce the genes of stress responses, fatty acid biosynthesis, lichenan degradation, transport, and metabolism in B. subtilis (Ren et al. 2004a). Here, the gene expression pattern of C. albicans under BF1 treatment was identified using DNA microarrays for the first time. The concentration used in microarray analysis (3 μg/mL) is comparable to other studies, e.g., 2 μg/mL fluconazole (Copping et al. 2005), 10 μg/mL fluphenazine (Karababa et al. 2004), and 25 μg/mL benomyl (Karababa et al. 2004). The microarray data in the present study indicate that treatment with BF1 at a sublethal concentration (3 μg/mL) can lead to the induction of 32 genes involved in stress response, NADPH dehydrogenation, and small-molecule
Expression ratio (microarray)
Expression ratio (dot blot)
5.36 12.94 0.60 0.43
4 10 0.5 0.2
transport, and repression of 21 genes involved mainly in cell wall maintenance. These data suggest that brominated furanones target different biomolecules for inhibition in Gram-negative bacteria, Gram-positive bacteria, and fungi. Interestingly, although several genes (MDR1, SOD2, IFR2, CIP1, and orf19.2262) also respond to oxidative stress via CAP1, the expression level of CAP1 remained the same with and without BF1. In a previous study, CAP1 was found to be induced at 10 and 30 min after H2O2 treatment, but not at 50 min (Enjalbert et al. 2006). In addition, 76 out of 89 genes, expressed differentially with H2O2 treatment, showed CAP1-dependent expression (Wang et al. 2006). These data suggest that CAP1 is a transcription regulator for oxidative stress response genes, which is only induced at the early stage of stress exposure. Further microarray studies at different time points after treatment may help identify its roles in response to brominated furanones. Among the genes repressed by BF1, the cell-wall maintenance genes CHT3 and DSE1 are regulated by ACE2, a transcription factor involved in the regulation of
Table 4 The C. albicans genes differentially expressed in response to BF1 (this study) and other selected antifungal compounds (Copping et al. 2005; Hromatka et al. 2005; Karababa et al. 2004; Liu et al. 2005; Rogers and Barker 2002) Antifungal compounds
Benomyl
Nitric oxide
Azole
Caspofungin
Amphotericin B
Overlapping genes
MDR1 TTR2 IFR2 OYE23 OYE32 EBP1 orf19.3139 orf19.7531 orf19.7306 orf19.2262
YHB1 OYE23 EBP1 OYE32 OYE2 orf19.2693 orf19.2262 orf19.2175
MDR1 orf19.7306 orf19.2694 orf19.1344a ENA21a FMA1a
RTA3 orf19.7531 ENG1 orf19.5267
SOD2 OYE32
The genes in bold represent the genes repressed by both furanone BF1 and caspofungin. All the other genes were induced by both furanone BF1 and the antifungal compounds indicated in the corresponding column. a
Genes repressed by furanone BF1 but confer azole resistance.
Appl Microbiol Biotechnol (2010) 85:1551–1563
morphogenesis. The depletion of ACE2 can lead to cell division failure, loss of virulence, and decrease in cell adherence to plastic surfaces (Kelly et al. 2004). Since ACE2 null mutation results in great repression of DSE1 and completely abolished CHT3 expression, it would be interesting to study the response of ACE2 null mutant to brominated furanones. The cell-wall maintenance gene ALS2 was previously found to be involved in adhesion between fungal cells, adhesion to host cells, hyphal growth, and biofilm formation (Hoyer et al. 1998; Zhao et al. 2005). Hence, the repression of ALS2 can potentially inhibit biofilm formation and the development of drug resistance. Interestingly, FMA1, the only downregulated stress response gene, was previously found to be upregulated by ciclopirox olamine and to be involved in the clinical development of fluconazole resistance (Lee et al. 2005; Rogers and Barker 2003). Repression of FMA1 by BF1 could possibly reduce the chance of drug resistance development. Interestingly, CSR1 was found to be repressed by BF1. The deletion of CSR1 causes defects in hyphal growth and severe cell growth defects under zinc-limited conditions (Kim et al. 2008). Since C. albicans virulence is directly correlated with its ability to switch between yeast and hyphal growth (Whiteway and Bachewich 2007), the inhibition of CSR1 by BF1 suggests that BF1 can possibly repress the virulence of C. albicans. In summary, BF1 induced a number of genes involved in stress response and transport of small molecules which have previously been shown to confer multidrug resistance. BF1 also repressed several cell-wall-maintenance genes, which are important to cell growth. The common genes affected by BF1 (in the present study) and other antifungal agents (in literature) were compared and are summarized in Table 4. Among the genes affected by BF1, 10 of them overlapped with those affected by benomyl (Karababa et al. 2004), one of the benzimidazole fungicides. Eight genes affected by BF1 were also induced by nitric oxide (Wang et al. 2006). As for the antifungal drugs currently available, four genes overlapped with those included by azole-class drugs (Karababa et al. 2004). Only two genes were induced by both BF1 and amphotericin B or caspofungin (Bruno et al. 2006; Liu et al. 2005). Among all of the 21 repressed genes, two (ENG1 and orf19.5267) overlapped with genes downregulated by caspofungin (Liu et al. 2005). Interestingly, orf19.1344 (Copping et al. 2005), ENA21 (Liu et al. 2005), and FMA1 (Rogers and Barker 2003) were found to be related to azole resistance, and orf19.6245 was previously found to be upregulated under oxidative stress (H2O2) (Enjalbert et al. 2006). Further genomic and proteomic studies involving additional furanones at different concentrations will help understand the mechanism of inhibition and design more potent structures of brominated furanones
1561
As shown in Table 4, the overlap in genes affected by BF1 and other antifungal drugs is relatively small. The difference in gene expression patterns suggests that BF1 inhibits C. albicans growth through an alternative mechanism with different cellular targets. Thus, BFs may be effective in controlling fungal pathogens resistant to currently available antifungal agents. Although the exact mechanism of inhibition by BFs remains unknown, the induction of oxidative stress response genes and the repression of cell-wall-maintenance genes suggest that BF1 could possibly cause the intracellular generation of high-level reactive oxygen species and consequently cell death. Meanwhile, BFs could potentially damage the cell wall by inhibiting the genes involved in cell-wall maintenance and lead to cell lysis. These data shed new light on the search for novel antifungal drugs. Acknowledgements The authors are grateful to Syracuse University and Syracuse Center of Excellence (under the EPA grant X-832325010) for financial support. We also thank Dr. Sean Palecek (University of Wisconsin-Madison) for the strain of C. albicans SC3415, and Dr. Andre Nantel (National Research Council of Canada) for helping with DNA microarray analysis. We appreciate Drs. James H. Henderson and Shelley Kummer (Syracuse University) for suggestions on reverse transcription as well as Dr. Michael S. Cosgrove (Syracuse University) for access to a dark room.
References Akins RA (2005) An update on antifungal targets and mechanisms of resistance in Candida albicans. Med Mycol 43:285–318 Ben-Yaacov R, Knoller S, Caldwell GA, Becker JM, Koltin Y (1994) Candida albicans gene encoding resistance to benomyl and methotrexate is a multidrug resistance gene. Antimicrob Agents Chemother 38:648–652 Bruno VM, Mitchell AP (2005) Regulation of azole drug susceptibility by Candida albicans protein kinase CK2. Mol Microbiol 56:559–573 Bruno VM, Kalachikov S, Subaran R, Nobile CJ, Kyratsous C, Mitchell AP (2006) Control of the C. albicans cell wall damage response by transcriptional regulator Cas5. PLoS Pathog 2:e21 Cheng G, Yeater KM, Hoyer LL (2006) Cellular and molecular biology of Candida albicans estrogen response. Eukaryot Cell 5:180–191 Clancy CJ, Yu VL, Morris AJ, Snydman DR, Nguyen MH (2005) Fluconazole MIC and the fluconazole dose/MIC ratio correlate with therapeutic response among patients with candidemia. Antimicrob Agents Chemother 49:3171–3177 Copping VM, Barelle CJ, Hube B, Gow NA, Brown AJ, Odds FC (2005) Exposure of Candida albicans to antifungal agents affects expression of SAP2 and SAP9 secreted proteinase genes. J Antimicrob Chemother 55:645–654 Cowen LE, Nantel A, Whiteway MS, Thomas DY, Tessier DC, Kohn LM, Anderson JB (2002) Population genomics of drug resistance in Candida albicans. Proc Natl Acad Sci U S A 99:9284–9289 de Micheli M, Bille J, Schueller C, Sanglard D (2002) A common drugresponsive element mediates the upregulation of the Candida
1562 albicans ABC transporters CDR1 and CDR2, two genes involved in antifungal drug resistance. Mol Microbiol 43:1197–1214 Douglas LJ (2003) Candida biofilms and their role in infection. Trends Microbiol 11:30–36 Dunkler A, Walther A, Specht CA, Wendland J (2005) Candida albicans CHT3 encodes the functional homolog of the Cts1 chitinase of Saccharomyces cerevisiae. Fungal Genet Biol 42:935–947 Edmond MB, Wallace SE, McClish DK, Pfaller MA, Jones RN, Wenzel RP (1999) Nosocomial bloodstream infections in United States hospitals: a three-year analysis. Clin Infect Dis 29:239–244 Enjalbert B, Smith DA, Cornell MJ, Alam I, Nicholls S, Brown AJ, Quinn J (2006) Role of the Hog1 stress-activated protein kinase in the global transcriptional response to stress in the fungal pathogen Candida albicans. Mol Biol Cell 17:1018–1032 Gupta V, Kohli A, Krishnamurthy S, Puri N, Aalamgeer SA, Panwar S, Prasad R (1998) Identification of polymorphic mutant alleles of CaMDR1, a major facilitator of Candida albicans which confers multidrug resistance, and its in vitro transcriptional activation. Curr Genet 34:192–199 Han Y, Hou S, Simon KA, Ren D, Luk YY (2008) Identifying the important structural elements of brominated furanones for inhibiting biofilm formation by Escherichia coli. Bioorg Med Chem Lett 18:1006–1010 Holmstrom GPC, Kjelleberg S (2001) Inhibition of fungi. WO/2001/ 068091 Hoyer LL, Payne TL, Hecht JE (1998) Identification of Candida albicans ALS2 and ALS4 and localization of Als proteins to the fungal cell surface. J Bacteriol 180:5334–5343 Hromatka BS, Noble SM, Johnson AD (2005) Transcriptional response of Candida albicans to nitric oxide and the role of the YHB1 gene in nitrosative stress and virulence. Mol Biol Cell 16:4814–4826 Karababa M, Coste AT, Rognon B, Bille J, Sanglard D (2004) Comparison of gene expression profiles of Candida albicans azole-resistant clinical isolates and laboratory strains exposed to drugs inducing multidrug transporters. Antimicrob Agents Chemother 48:3064–3079 Katzmann DJ, Hallstrom TC, Voet M, Wysock W, Golin J, Volckaert G, Moye-Rowley WS (1995) Expression of an ATP-binding cassette transporter-encoding gene (YOR1) is required for oligomycin resistance in Saccharomyces cerevisiae. Mol Cell Biol 15:6875–6883 Kelly MT, MacCallum DM, Clancy SD, Odds FC, Brown AJ, Butler G (2004) The Candida albicans CaACE2 gene affects morphogenesis, adherence and virulence. Mol Microbiol 53:969–983 Kim MJ, Kil M, Jung JH, Kim J (2008) Roles of Zinc-responsive transcription factor Csr1 in filamentous growth of the pathogenic Yeast Candida albicans. J Microbiol Biotechnol 18:242–247 Kjelleberg S, Steinberg PD, Holmstrom C, Back A (1999) Inhibition of Gram-positive bacteria. Patent WO 99/53915 Lachke SA, Lockhart SR, Daniels KJ, Soll DR (2003) Skin facilitates Candida albicans mating. Infect Immun 71:4970–4976 Law D, Moore CB, Wardle HM, Ganguli LA, Keaney MG, Denning DW (1994) High prevalence of antifungal resistance in Candida spp. from patients with AIDS. J Antimicrob Chemother 34:659–668 Lee RE, Liu TT, Barker KS, Lee RE, Rogers PD (2005) Genome-wide expression profiling of the response to ciclopirox olamine in Candida albicans. J Antimicrob Chemother 55:655–662 Liu TT, Lee RE, Barker KS, Lee RE, Wei L, Homayouni R, Rogers PD (2005) Genome-wide expression profiling of the response to azole, polyene, echinocandin, and pyrimidine antifungal agents in Candida albicans. Antimicrob Agents Chemother 49:2226–2236 Manefield M, de Nys R, Kumar N, Read R, Givskov M, Steinberg P, Kjelleberg S (1999) Evidence that halogenated furanones from
Appl Microbiol Biotechnol (2010) 85:1551–1563 Delisea pulchra inhibit acylated homoserine lactone (AHL)mediated gene expression by displacing the AHL signal from its receptor protein. Microbiology 145:283–291 McChesney JD, Gonzalez-Sierra M (1985) Antifungal activity of some substituted pyrimidines. Pharm Res 3:146–147 Odds FC (1993) Resistance of yeasts to azole-derivative antifungals. J Antimicrob Chemother 31:463–471 Ogawa A, Hashida-Okado T, Endo M, Yoshioka H, Tsuruo T, Takesako K, Kato I (1998) Role of ABC transporters in aureobasidin A resistance. Antimicrob Agents Chemother 42:755–761 Ren D, Wood TK (2004) (5Z)-4-Bromo-5-(Bromomethylene)-3Butyl-2(5H)-Furanone Reduces Corrosion from Desulfotomaculum orientis. Environ Microbiol 6:535–540 Ren D, Sims JJ, Wood TK (2001) Inhibition of biofilm formation and swarming of Escherichia coli by (5Z)-4-Bromo-5-(Bromomethylene)-3-Butyl-2(5H)-Furanone. Environ Microbiol 3:731–736 Ren D, Sims JJ, Wood TK (2002) Inhibition of biofilm formation and swarming of Bacillus subtilis by (5Z)-4-Bromo-5-(Bromomethylene)-3-Butyl-2(5H)-Furanone. Lett Appl Microbiol 34:293–299 Ren D, Bedzyk LA, Setlow P, Thomas S, Ye RW, Wood TK (2004a) Differential gene expression to investigate the effect of (5Z)-4bromo-5-(bromomethylene)-3-butyl-2(5H)-furanone on Bacillus subtilis. Appl Environ Microbiol 70:4941–4949 Ren D, Bedzyk LA, Ye RW, Thomas SM, Wood TK (2004b) Differential gene expression shows natural brominated furanones interfere with the autoinducer-2 bacterial signaling system of Escherichia coli. Biotech Bioeng 88:630–642 Rogers PD, Barker KS (2002) Evaluation of differential gene expression in fluconazole-susceptible and -resistant isolates of Candida albicans by cDNA microarray analysis. Antimicrob Agents Chemother 46:3412–3417 Rogers PD, Barker KS (2003) Genome-wide expression profile analysis reveals coordinately regulated genes associated with stepwise acquisition of azole resistance in Candida albicans clinical isolates. Antimicrob Agents Chemother 47:1220–1227 Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor Sangeorzan JA, Bradley SF, He X, Zarins LT, Ridenour GL, Tiballi RN, Kauffman CA (1994) Epidemiology of oral candidiasis in HIV-infected patients: colonization, infection, treatment, and emergence of fluconazole resistance. Am J Med 97:339–346 Slutsky B, Staebell M, Anderson J, Risen L, Pfaller M, Soll DR (1987) "White-opaque transition": a second high-frequency switching system in Candida albicans. J Bacteriol 169:189–197 Soustre I, Letourneux Y, Karst F (1996) Characterization of the Saccharomyces cerevisiae RTA1 gene involved in 7-aminocholesterol resistance. Curr Genet 30:121–125 Uppuluri P, Nett J, Heitman J, Andes D (2008) Synergistic effect of calcineurin inhibitors and fluconazole against Candida albicans biofilms. Antimicrob Agents Chemother 52:1127–1132 Wang Y, Cao YY, Jia XM, Cao YB, Gao PH, Fu XP, Ying K, Chen WS, Jiang YY (2006) Cap1p is involved in multiple pathways of oxidative stress response in Candida albicans. Free Radic Biol Med 40:1201–1209 Waters CM, Bassler BL (2005) Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol 21:319–346 Wenzel RP, Edmond MB (2001) The impact of hospital-acquired bloodstream infections. Emerg Infect Dis 7:174–177 White TC, Marr KA, Bowden RA (1998) Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin Microbiol Rev 11:382–402
Appl Microbiol Biotechnol (2010) 85:1551–1563 Whiteway M, Bachewich C (2007) Morphogenesis in Candida albicans. Annu Rev Microbiol 61:529–553 Wirsching S, Michel S, Kohler G, Morschhauser J (2000) Activation of the multiple drug resistance gene MDR1 in fluconazole-resistant, clinical Candida albicans strains is caused by mutations in a trans-regulatory factor. J Bacteriol 182:400–404 Xu D, Jiang B, Ketela T, Lemieux S, Veillette K, Martel N, Davison J, Sillaots S, Trosok S, Bachewich C et al (2007) Genome-wide
1563 fitness test and mechanism-of-action studies of inhibitory compounds in Candida albicans. PLoS Pathog 3:e92 Zhao X, Oh SH, Yeater KM, Hoyer LL (2005) Analysis of the Candida albicans Als2p and Als4p adhesins suggests the potential for compensatory function within the Als family. Microbiology 151:1619–1630 Zordan RE, Miller MG, Galgoczy DJ, Tuch BB, Johnson AD (2007) Interlocking transcriptional feedback loops control white-opaque switching in Candida albicans. PLoS Biol 5:e256