Protoplasma DOI 10.1007/s00709-013-0497-8

ORIGINAL PAPER

Involvement of phospholipase D-related signal transduction in chemical-induced programmed cell death in tomato cell cultures Elena T. Iakimova & Rina Michaeli & Ernst J. Woltering

Received: 27 November 2012 / Accepted: 27 February 2013 # Springer-Verlag Wien 2013

Abstract Phospholipase D (PLD) and its product phosphatidic acid (PA) are incorporated in a complex metabolic network in which the individual PLD isoforms are suggested to regulate specific developmental and stress responses, including plant programmed cell death (PCD). Despite the accumulating knowledge, the mechanisms through which PLD/PA operate during PCD are still poorly understood. In this work, the role of PLDα1 in PCD and the associated caspase-like proteolysis, ethylene and hydrogen peroxide (H2O2) synthesis in tomato suspension cells was studied. Wild-type (WT) and PLDα1-silenced cell lines were exposed to the cell death-inducing chemicals camptothecin (CPT), fumonisin B1 (FB1) and CdSO4. A range of caspase inhibitors effectively suppressed CPTinduced PCD in WT cells, but failed to alleviate cell death in PLDα1-deficient cells. Compared to WT, in CPT-treated PLDα1 mutant cells, reduced cell death and decreased production of H2O2 were observed. Application of ethylene significantly enhanced CPT-induced cell death both in WT and PLDα1 mutants. Treatments with the PA derivative lyso-phosphatidic acid and mastoparan (agonist of PLD/PLC signalling downstream of G proteins) caused severe cell death. Inhibitors, specific to PLD and PLC, remarkably decreased the chemical-induced cell death. Handling Editor: Heiti Paves E. T. Iakimova : E. J. Woltering Plant Sciences Group, Horticultural Supply Chains, Wageningen University, P.O. Box 630, 6700 AP Wageningen, The Netherlands R. Michaeli : E. J. Woltering (*) Food and Biobased Research, Wageningen University, P.O. Box 17, 6700 AA Wageningen, The Netherlands e-mail: [email protected] E. T. Iakimova Institute of Ornamental Plants, Negovan, 1222 Sofia, Bulgaria

Taken together with our previous findings, the results suggest that PLDα1 contributes to caspase-like-dependent cell death possibly communicated through PA, reactive oxygen species and ethylene. The dead cells expressed morphological features of PCD such as protoplast shrinkage and nucleus compaction. The presented findings reveal novel elements of PLD/PA-mediated cell death response and suggest that PLDα1 is an important factor in chemical-induced PCD signal transduction. Keywords Cell death . Tomato cell cultures . PLD/PLC/PA . Ethylene . Caspase-like enzymes . Hydrogen peroxide

Introduction Programmed cell death (PCD) is a process of cellular suicide that is indispensable for development and survival of eukaryotic organisms. In plants, it is involved in, for example, xylogenesis, aerenchyma formation, organ shaping, reproductive events, leaf and petal senescence and endosperm degradation. Furthermore, PCD is an essential response to a variety of environmental factors, including pathogen attack and a variety of abiotic stresses such as heat shock, toxic chemicals, ozone exposure, UV radiation, drought, salinity and hypoxia (van Doorn and Woltering 2005). The PCD machinery operates in a complicated network of metabolic pathways and messenger molecules finally leading to controlled dismantling of the cell. A number of reports show that, in plant systems, the cell death cascade might employ proteases that are functional homologues of animal caspases (cysteinylaspartic proteases) and express a caspase-like preference for specific (evolutionarily conserved) substrates (Woltering et al. 2002). In developmental and biotic stress circumstances, the vacuolar processing enzyme (VPE), a plant asparaginylspecific cysteine protease, was identified as one of the plant

E.T. Iakimova et al.

targets of human caspase-1 inhibitors; the proteasome β1 subunit was demonstrated as a target of a caspase-3 inhibitor at plant–bacteria and plant–virus interactions, and caspaselike activity has been established for subtilisin-like serine proteases (saspases) expressed in response to the fungal toxin victorin (reviewed in Woltering et al. 2002; Woltering 2010). Depending on the plant system and cell death trigger, plant PCD could also proceed through caspase-like-independent routes or engage concerted caspase-like and non-caspaselike proteolysis (Woltering et al. 2002; van Doorn and Woltering 2005; Woltering 2010 and references therein). Other established key players in cell death signalling are, among others, reactive oxygen species (ROS), calcium, nitric oxide (NO), mitochondrial factors and hormonal regulators such as ethylene, salicylic, jasmonic and abscisic acids (ABA), phosphorylation and defence mechanisms such as expression of anti-apoptotic factors and pathogenesis related proteins (Neill et al. 2002; Hoeberichts and Woltering 2003; Mur et al. 2008). Lipid-derived signals are other suggested components in the regulation of plant PCD. Membrane lipids produce different classes of messenger molecules, including phosphatidic acid (PA), diacylglycerol, DAG-pyrophosphate, lysophospholipids, free fatty acids, oxylipins, phosphoinositides and inositol polyphosphates. The production of these mediators is controlled by phospholipases A2, C and D (PLA2, PLC and PLD), lipid kinases and/or phosphatases (Meijer and Munnik 2003; Wang 2005). PLD (EC 3.1.4.4) catalyzes the hydrolysis of structural phospholipids to generate PA and a free head group such as choline. PA can be also synthesised through PLC/diacylglycerol kinase pathways (Testerink and Munnik 2005, 2011). In Arabidopsis thaliana, 12 PLD isotypes of six groups (α, β, γ, δ, ε and ζ), differing in their requirements for Ca2+, lipid substrate preference, sub-cellular distribution and physiological functions have been classified (Wang 2005; Li et al. 2009 and references therein). The various isoforms of PLD are found to mediate different plant stress and developmental responses (Munnik et al. 1995; Meijer and Munnik 2003; Testerink and Munnik 2005; Hong et al. 2010). PLD isoforms were reported to contribute to plant tolerance to, e.g. pathogen attack (Yamaguchi et al. 2003; 2009; Laxalt et al. 2001; de Jong et al. 2004), wounding (Lee et al. 2001; Bargmann et al. 2009), water deficit (Sang et al. 2001), heat stress (Mishkind et al. 2009), oxidative stress (Yamaguchi et al. 2003), drought and salinity (Hong et al. 2010; Peng et al. 2010), Nod factor (den Hartog et al. 2003), heavy metals (Jakubowicz et al. 2010) and ABA treatment (Fan et al. 1997; Jacob et al. 1999). PLD product PA was shown to mediate ABA and ethylene effects during senescence (Lee et al. 1998; Hong et al. 2009). Some of PA targets in plants were identified (van der Luit et al. 2000; Lee et al. 2001; de Jong et al. 2004; Testerink and Munnik 2005; Laxalt et al. 2007; Testerink et al. 2007; Li et al. 2009; Mishkind et al. 2009; Hong et al. 2010). Among

them, a protein kinase thought to be involved in oxidative stress responses, a protein phosphatase 2C that is a negative regulator of ABA signalling and of CTR1 (constitutive triple response 1) MAP-kinase, which is the plant homologue to mammalian Raf-1 kinase (Leung et al. 1994; Meyer et al. 1994; Zhang et al. 2004; Testerink et al. 2007, 2008; Testerink and Munnik 2011). Implication of PLDs in PCD was shown during starvationinduced cell death (Lee et al. 1998), during the hypersensitive response (HR, a form of PCD related to plant resistance to pathogens) induced in rice leaves by fungal (Pyricularia grisea) and bacterial (Xanthomonas oryzae pv. oryzae) pathogens (Yamaguchi et al. 2009) and in ROS-mediated signalling in N-acetylchitooligosaccharide elicited rice suspension cells (Yamaguchi and Minami 2003). Furthermore, in xylanase-elicited cultured tomato cells, the PLD/PLC pathways and accumulation of phosphatidylinositol 4-phosphate were found to mediate NO-triggered PA formation, ROS production and cell death (Laxalt et al. 2007; Gonorazki et al. 2008). PA derived from different PLD isoforms might play different roles in stress and cell death responses. For example, the xylanase-induced cell response was attributed to PLDβ derived PA (Laxalt et al. 2001; Bargmann et al. 2006b). The wounding-stimulated PA generation in Arabidopsis leaves has been assigned mainly to PLDα, but PA production from other PLD isoforms is also suggested (Zien et al. 2001). Using PLDa1, RNAi-silenced mutants Shen et al. (2011) have established a protective effect of PLDα1 against NaClinduced cell death in rice suspension cells. Cell death is also suggested to engage PLC-related signalling. Using SLPLC4and SlPLC6-silenced tomato plants cv. Money Maker, Vossen et al. (2010) demonstrated that different PLC isoforms are required for the HR induced by the fungal pathogens Cladospotum fulvum and Verticillium dahliae. Cumulatively, the finding suggest that PLD/PLC/PA form a complex network, which, depending on the model under study, the type and severity of applied stress and the expressed enzyme isoforms, might result in PCD protecting or PCD stimulating effects. The knowledge on the interplay of PLD/PLC/PA with other cell death regulators in plant cells is still incomplete. The present work was undertaken to elucidate the possible interaction of PLD/PA with ethylene, ROS and caspase-like signalling during chemical-induced PCD in tomato suspension cells. Experiments were performed with wild-type (WT) and PLDα1 antisense cell lines. Cells were treated with a range of cell death inducers and inhibitors targeting caspaselike proteases, PLD, PLC and ethylene. Cell death and associated ethylene and hydrogen peroxide (H2O2) production were analysed. The obtained results provide novel information suggesting that, in tomato suspension cells, PLDα1 contributes to caspase-dependent cell death signalling requiring low levels of ethylene and ROS.

Phospholipase D-related PCD signalling in tomato cells

Materials and methods Chemicals Ac-Tyr-Val-Ala-Asp-chloromethylketone (Ac-YVAD-CMK), Ac-Tyr-Val-Ala-Asp-aldehyde (Ac-YVAD-CHO), aminoethoxyvinylglycine (AVG), biotinyl-Asp-Glu-ValAspartin-1-aldehyde (biotin-DEVD-CHO), biotinyl-Tyr-ValAla-Asp-chloromethylketone (biotinyl-YVAD-CMK), Z-Asp2,6-dichlorobenzoyloxymethylketone (Z-Asp-CH2-DCB) and N-methoxysuccinyl-Ala-Ala-Pro-Val-chloromethylketone (MeOSuc-AAPV-CMK) were purchased from Bachem AG (Bubendorf, Switzerland), hydrogen peroxide (H2O2) from MERCK (Darmstadt, Germany), 1-[6-([17β)-3-metoxyestra1,3,5(10)-trien-17-yl] amino)hexyl]-1H-pyrrole-2,5,-dione (U73122) and N-biotin-Asp-Glu-Val-Asp-CHO (Biotin-DEVDCHO) from Enzo Life Sciences BVBA, Zandhoven, Belgium), lysophosphatidylethanolamine (L-PEA) and L-αlysophosphatidic acid (L-PA) from Cayman Chemical Company (Bio-Connect, The Netherlands) and Murashige– Skoog medium with vitamins from Dushefa (Haarlem, The Netherlands). All other chemicals were from Sigma-Aldrich (Zwijndrecht, The Netherlands). Camptothecin (CPT), Fumonisin B1 (FB1), Mastoparan (MP), U-73122, L-PEA and L-PA, MeOSuc-AAPV-CMK and the caspase inhibitors were dissolved in dimethyl sulfoxide (DMSO) (final solvent concentration in the cell culture 0.1 %v/v), fluorescein diacetate (FDA) was dissolved in 80 % acetone, and the other chemicals were dissolved in water. DMSO and acetone were tested alone, and, at the indicated final concentration, no effect on cell viability was detected. Cell cultures The experiments were conducted with tomato (Solanum lycopersicum L.) suspension cells, cv. Money Maker (WT, line Msk8) and two independent PLDα1-silenced cell lines (PLD3 and PLD5) with greatly reduced PLDα1 gene expression and protein levels. The cells were grown in a liquid Murashige–Skoog medium, supplemented with 5 μM αnaphthalene acetic acid, 1 μM 6-benzyladenine, 3 % (w/v) sucrose and vitamins, sub-cultured every 7 days by 1:4 dilution with fresh medium and grown in 100-ml sterile flasks with aluminium caps, on a horizontal rotary shaker (100 rpm) at 25 °C, in the dark (de Jong et al. 2000). The two PLDα1-silenced (PLD3 and PLD5) cell lines and an empty vector transformed cell line were created and kindly provided to us by the research team of Dr. Teun Munnik at the University of Amsterdam, The Netherlands. The detailed procedure for transformation has been described in Bargmann et al. (2006a, b) In short, silencing of LePLDα1 was achieved using inverted repeats of the tomato 3″ PLDα1 cDNA. For the LePLDα1-RNAi construct, an inverted repeat

specific for LePLDα1 was generated targeting the gene’s 3′ untranslated region. PCR amplification of LePLDα1 cDNA cloned by Laxalt et al. (2001) was performed with the oligonucleotides: (1) 5′ CGGGATCCCCATCGTxCAGTCAA TTAAAGCATCTC-3′ (reverse) with a BamHI and a ClaI restriction site; (2) 5′-CCGGAATTCCCCCGACACCAA GG-3′ (forward) with an EcoRI restriction site, and (3) 5′CCGGAATTCCATCCAGAAAGTGAGG 3′ (forward) with an EcoRI restriction site. The PCR products resulting from primer combinations 1–2 and 1–3 were ligated in a 1–2/3–1 orientation into pGreen1K, which was modified to contain the 35S-Tnos cassette from pMON999 (Bargmann et al. 2006a). The LePLDα1-RNAi construct was transferred to Agrobacterium tumefaciens strain EHA105 carrying the pJIC.SaRep plasmid. Transfection was achieved by cocultivating 8 ml of 4-day-old Msk8 cells for 3 days at 23 °C in a Petri dish with 200 μl of an overnight A. tumefaciens culture carrying the appropriate vector, in the presence of 0.2 mM acetosyringon. The cells were then plated on filters in Petri dishes with supplemented MS/agar containing 250 μg ml−1 carbenicilin and 40 μg ml−1 kanamycin. Pieces of independently transformed calli were transferred to liquid MS medium and cultured as described in Bargmann et al. 2006b). Chemical treatments A previously established approach for induction of PCD with chemical cell-death inducers and its inhibition by specific inhibitors was applied (de Jong et al. 2000; Yakimova et al. 2006; Iakimova et al. 2008). For treatments, the cells were used 5 days after sub-culture. The chemicals were added to 5 ml of suspension culture in 30-ml flasks with gas-tight screw caps. Cell cultures were exposed to treatments with the cell death inducers CPT (an alkaloid from Camptotheca acuminata), FB1 (a mycotoxin from Fusarium moniliforme), heavy metal cadmium (CdSO4), wasp venom MP (agonist of PLD/PLC signalling downstream of G proteins) and L-PA (a cell permeable derivative of PA). Presented concentrations of the inducers were previously established to yield an intermediate level of cell death. For ethylene treatment, 100 μl l−1 of the gas was established in the head space of closed flasks through injection of a fixed amount of ethylene. This yielded a final concentration of ethylene in the culture medium of 10– 12 μl l−1.The cultures were also treated with PLD inhibitors (1-butanol, L-PEA and 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF)), PLC inhibitors (U-73122 and neomycin), AVG (an inhibitor of ethylene synthesis enzyme aminocyclopropane-1-carboxylic acid (ACS)) and with synthetic human caspase inhibitors: irreversible broad range caspase inhibitor Z-Asp-CH2-DCB, irreversible caspase-1 inhibitors Ac-YVAD-CMK and biotinyl-YVAD-CMK and reversible caspase-1 (Ac-YVAD-CHO) and caspase-3 (biotinDEVD-CHO) inhibitors.

E.T. Iakimova et al.

In general, the inhibitors were tested in a range of concentrations (from nM to mM) with and without the addition of cell death inducing compounds. Most of the chemicals were taken from concentrated stocks allowing microlitre volumes to be added to the cell cultures. Lowest concentrations of inhibitors giving significant reduction of chemicalinduced cell death are presented. For allowing the uptake into the cells, the inhibitors were added 20 min before the cell death inducers. Cell death was determined at different times after start of the treatments. Cell death determination For cell death determination, 250 μl from the cell suspension was diluted with 4 ml tap water in small Petri dishes. The vital dye FDA (0.002 %) was used to stain the living cells, and the cell counting was executed using a fluorescence microscope (Axiovert, Zeiss, Darmstadt, Germany) at ×100 magnification, filter combination excitation/emission wavelength 495/520 nm. For each sample three different non-overlapping microscope fields each containing at least 100 cells were randomly chosen. Cell death was calculated as a percentage of dead cells to the total number of cells as described in de Jong et al. (2000). Cell death imaging Cellular morphology of tomato cells was examined using a TCS SP2 AOBS CLSM system (Leica-Microsystems GmbH, Mannheim, Germany) mounted on an inverted Leica DM IRE2 microscope. Two different lasers (405 and 488 nm) were employed for excitation and two emission channels for fluorescence imaging and one separate channel for non-confocal transmission imaging. Overlays and orthogonal projections were made using the Leica Confocal software. The images were taken from 24-h chemicaltreated tomato cells stained with FDA (green fluorescing vital dye) and propidium iodide (PI)—permeable in the nuclei of dead cells (fluorescing in red). Hydrogen peroxide assay Cells from WT and PLDα1 antisense cell lines were treated with CPT and harvested at different time points between time zero and 6 h post-treatment. The culture medium was removed and cells were washed twice in washing buffer (24.7 mM KNO 3 , 1.1 mM NaH 2 PO 4 , 1 mM MgSO 4 , 1 mM (NH4)2SO4, 1 mM CaCl2, 20 mM MES, 2 % sucrose, pH 6.6) to remove interfering substances. Thereafter, 0.5 g of cells was re-suspended in 5 ml of the washing buffer. Samples were taken both immediately and after 30 min of incubation on a rotary shaker. Then, the cells were spun down, and H 2O 2 was measured in the supernatant by

chemiluminescence in a ferricyanide-catalysed oxidation of luminol (Schwacke and Hager 1992). To compare independent experiments, a standard of 50 μl of 1 μM H2O2, freshly prepared in washing buffer, was used. For details on the procedure, see de Jong et al. (2002). Measurement of ethylene production Five-day-old WT cells were treated with 5 μM MP, 10 μM AVG or with a combination of MP and AVG. Online ethylene production of the suspension cells was monitored in a flowthrough system using a sensitive carbon dioxide laser-based ethylene detector (type ETD-300, Sensor Sense B.V.) in combination with a gas handling system. The ETD-300 is a stateof-the art ethylene sensor based on laser photoacoustic spectroscopy (Cristescu et al. 2008). The gas handling was performed by a valve control box (type VC-6, Sensor Sense B.V.), designed for measuring from up to six cuvettes per experiment. This allowed comparative measurements in different batches of cells or differently treated samples in a one and the same run. Glass cuvettes (100 ml volume) with 20 ml cell suspension (approximately 5 g FW) were used per experiment. MP (5 μM final concentration) was injected into the cell suspension alone or in combination with 10 μM AVG. For accurate detection of the extremely low amounts of ethylene produced by the cells, ethylene was allowed to accumulate in the headspace for 40 min, after which the vials were flushed for 20 min with purified air at a flow of 2 l h−1 and the accumulated ethylene was quantified. Prior to entering the photoacoustic detector, the air was freed from carbon dioxide and water vapour using a scrubber containing KOH and CaCl2. Data analysis and artworks Presented data are average values from at least three independent experiments. Statistical significance of the differences was evaluated by one-way ANOVA (Dunkan’s multiple range test, confidence level p≤0.05). Where appropriate, statistically different values are indicated with different letters or LSD (p≤0.05) is presented. Standard errors of the means (SEM(n−1)) are shown. Graphics artworks and statistical analysis were performed using GraphPad Prism and MS Office Excel.

Results Effect of chemical cell death inducers on cell death in WT and PLDα1antisense cells Tomato suspension cells Msk8 of WT and PLDα1 transformed lines PLD3 and PLD5 were treated with a range of concentrations (1–20 μM) of CPT and cell death

Phospholipase D-related PCD signalling in tomato cells

monitored during increasing exposure time at 6-h intervals between 0 and 48 h post-treatment. Both PLDα1-silenced lines showed lesser sensitivity to CPT, and the response to CPT was delayed by 12 h in comparison to WT cells (Fig. 1a, b). Twenty four hours after administration of 5 μM CPT, approximately 35–40 % cell death was established, and this concentration of CPT was routinely used in the further experiments. The suspension cells of transformed and WT lines were also subjected to treatments with other PCD inducers: 20 μM FB1 and 100 μM CdSO4. In response to these inducers, cell death in PLDα1 antisense lines was always at least 40 % less than in the WT (Fig. 1 c). To additionally assess whether PLD, PLC and PA are involved in chemical-induced PCD, the WT cells were treated with L-PA and MP. These compounds induced cell death in a dose-dependent manner, producing 28 and 40 % cell lethality at 10 and 100 nM L-PA, respectively, and 25 and 45 % cell death at 2 and 5 μM MP, respectively (Fig. 1d). The L-PA effect was saturated at concentrations higher than 100 nM. The obtained results indicate that PLD, PLC and PA may be involved in chemical-induced cell death in tomato cells. PLD and PLC inhibitors block cell death induced by toxic chemicals To further address the involvement of PLD in cell death signalling, the WT cells were treated with CPT, FB1, CdSO4 and MP in combination with the PLD inhibitors 0.05 % 1butanol, 20 μM L-PEA and 1 mM AEBSF. When applied alone at the indicated concentrations, the inhibitors did not induce cell death higher than 8 % (Fig. 2). When applied together with cell death triggers, PLD inhibitors remarkably suppressed cell death leading to approximately 40–70 % inhibition (Fig. 2). Application of 2-butanol, which does not interfere with PLD, did not inhibit cell death. Administration of the PLC inhibitors 2 μM neomycin and 1 μM U73122 also resulted in significant decrease in cell death (approximately 40–50 % inhibition; Fig. 2). These results additionally pointed to the involvement not only of PLD but also of PLC in chemical-induced cell death in tomato cells. MP was used as agonist of PLD and PLC signalling downstream of G proteins. PLD and PLC inhibitors efficiently alleviated MP-induced cell death (Fig. 2), which confirms the contribution of these enzymes to cell death process. PLD contribution to caspase-like-dependent proteolysis To elucidate whether PLDα1 signalling might contribute to caspase-dependent cell death pathways, the suspension cells of PLD3, PLD5 and WT lines were subjected to treatments with CPT and a range of synthetic human caspase inhibitors. The applied inhibitors Ac-YVAD-CMK, biotinyl-YVADCMK and Ac-YVD-CHO are specific to human caspase-1

and biotin-DEVD-CHO is specific to human caspase-3. ZAsp-CH2-DCB is a general caspase inhibitor. In WT suspension cells, CPT-induced cell death was reduced by approximately 50 % in the presence of 100 nM of the different caspase inhibitors, and the same was found in empty vector transformed cells (data not shown). In the CPT-treated PLDα1 (PLD3) silenced line, the caspase inhibitors did not suppress the cell lethality (Fig. 3). The response of PLD5 cells (data not shown) did not differ from that of PLD3 cell. To verify the efficiency of caspase inhibitors in cell death suppression, as a negative control, the chemicaltreated WT cells were also treated with the caspaseunrelated peptide MeOSuc-AAPV-CMK carrying the same ketone moiety as the caspase-1 inhibitors. This did not lead to cell death inhibition (data not shown). These results suggested that during chemical-induced cell death in tomato cells PLDα1 signalling might mediate caspase-like-related processes. Role of ROS in PLD signalling To study the participation of ROS in PLDα1-associated cell death, H2O2 production was assayed in CPT-treated WT and PLD3 and PLD5 cells. Lower basic H2O2 production was found in non-treated cells from PLD3 suspensions in comparison to WT. Treatment of WT cells with CPT resulted in a drastic increase in H2O2 amount within 1 h after administration of the cell death inducer and did not change significantly for the consecutive 6 hours of the measuring period. The level of H2O2 in PLDα1-silenced cells was only slightly elevated in comparison to non-treated PLD3 cells (Fig. 4). The kinetics and the level of H2O2 production in PLD5 cells (data not shown) matched the pattern of PLD3 cells. This indicated that, in response to applied cell death trigger, PLDα1 promotes the ROS production. Involvement of ethylene in chemical-induced cell death The effect of ethylene on chemical-induced cell death was studied by treating PLD3, PLD5 and WT cell suspensions with a combination of CPT and a high concentration of ethylene (100 μl l−1 in the head space). Exogenous ethylene, whereas insufficient by itself to induce cell death, doubled the cell death in CPT-treated WT cells (Fig. 5a) and a similar stimulation of cell death was observed in PLD3 and PLD5 cell lines. These observations indicate that high concentrations of ethylene might trigger PLD-independent cell death signalling. Information on the implication of ethylene in PLDrelated signalling was also obtained from WT cells exposed to PLD activator MP. The cells were co-treated with MP and the ACS inhibitor AVG. This resulted in a remarkable suppression of MP-induced cell death (Fig. 5b). To additionally analyse if ethylene is indeed a natural component in PLD and

E.T. Iakimova et al.

a

b

60

120 WT PLD3 PLD5 c c

c

30 b

b

80 L-PA

MP

60 c

c b

b

a

10

1

1 0.

01

1

CdSO4 100 µM

0.

FB1 20 µM

a

0

0

Control

20

a

00

a

0.

0

a

0.

10

c

c

40

10

20

d

5

40

d 100

2

Cell death (%)

50

d

Cell death (%)

c

Concentration (µM)

Fig. 1 Effect of chemical cell death inducers on cell death in Msk8 WT and PLDα1 antisense (PLD3 and PLD5) tomato cell lines. a Cells were treated with 1–20 μM CPT. b Cells were treated with 5 μM CPT and cell death scored at regular intervals within 1–48 h. c Effect of FB1 and CdSO4. d WT cells were treated with 1, 10 or 100 nM PA and 2, 5 or 10 μM MP. The experiments were performed with 5-day-old

suspension cells and cell death determined as a percentage of dead cells to the total number of cells, following FDA staining of the living cells. Control cells were left non-treated. In a, c and d, the cell death was scored 24 h after the treatments. LSD (p≤0.05) is as follows: a 6.35; b 4.03. In c and d, statistically different values are shown with different letters. Error bars indicate SEM(n −1)

PA-associated cell death pathways, the ethylene emission in MP and MP+AVG-treated cells was measured. The used photoacoustic detector provided very accurate detection of low ethylene amounts. One hour after administration of MP, ethylene production started to increase, peaking after 4 h at approximately 0.18 nl l−1 and slowly declining thereafter. Cotreatment with MP and AVG significantly reduced the amount of ethylene produced. In non-treated cells and in cells treated with AVG only, the ethylene emanation remained low for up to 24 h (Fig. 5c). No ethylene production was detected from culture medium without cells (data not shown). As MP was applied in order to mimic PLD-related signalling, these results indicate that PLD-mediated cell death events might be communicated by low levels of ethylene.

PI. In the cytoplasm of the vital cells, FDA is cleaved by esterases to produce the green fluorescing derivative fluorescein, which is trapped inside the cells. Dead cells are FDA negative. PI enters through the damaged plasma membrane and into the nucleus. In the living cells of both WT (Fig. 6a, b) and PLDα1-silenced lines (Fig. 7a, b), a preserved cytoskeleton, diffuse nucleus and intact vacuole were observed. The dead cells showed a compacted nucleus and severely shrunken protoplast separated from the cell wall. The cytoskeleton structure was not detectable (Figs. 6d–f and 7a). Nuclei in dead cells were PI positive (Fig. 6f, i). Similar cell death symptoms were observed in both WT and PLDα1 antisense cells at any of the applied chemical cell death inducers (Figs. 6 and 7). The presented images show typical cell death morphology. These demonstrate that, in comparison to WT, the suppression of PLDα1 in mutant cells did not alter the morphological occurrence of cell death in chemical-treated cultures. In addition, no change of cell death phenotype was observed in presence of cell death inhibitors.

Characterisation of cellular morphology The cellular morphology was examined after staining of the living cells with FDA and after staining of the dead cells with

Phospholipase D-related PCD signalling in tomato cells

60

50

Cell death (%)

40

30

20

10

L

-P C o 1 EA n t -B 2 ro l U 0 2 -B T µ A U 0. M N E T 05 e B 0 % o S .0 m F 5 % y U ci 1 m 7 n 3 M 2 1 2 2 uM 1 u M C C PT P T 5 C + µ P L- M C T+ PE P 1- A C CP T+ BU 2 P T T + -B T + N AE UT C e P om BS T + y F U c 7 in 3 1 F 2 2 B F 1 B 2 1 0 F +L µ B M 1 -P F + B 1- EA 1 F FB + BU B 2 1 1 + -B T + N AE UT F eo B B 1 m SF + y U ci C 7 d 3 n S 1 C O 2 2 d 4 S C O 10 d 4 0 S + C O L µM d 4 -P C C SO +1 E d dS 4 - A S + B O O4 2 UT 4 C + +A BU d N S eo EB T O 4 m SF + y U ci 7 3 n 1 2 2 M P M P 5 M +L uM P -P + M 1- EA P B M + U M 2 P P + -B T + N AE UT M eo BS P m + y F U c 7 in 3 1 2 2

0

Fig. 2 Effect of PLD and PLC inhibitors on chemical-induced cell death in Msk8 WT tomato suspension cells Cell death was induced by applying 5 μM CPT, 20 μM FB1, 100 μM CdSO4 and 5 μM MP (white bars) to 5-day-old WT tomato cells. PLD inhibitors 20 μM L-PEA, 0.05 % 1-butanol and 1 mM AEBSF (shaded bars) and PLC inhibitors 2 μM neomycin and 1 mM

U73122 (striped bars) were applied 20 min before cell death inducers. 0.05 % 2-Butanol (dotted bars) was added as negative control. In the combined treatments, the inducer and inhibitor concentrations were as at their single use. Control cells (black bars) were left non-treated. Cell death was scored 24 h after the treatments. LSD (p≤0.05)=9.09. Error bars indicate SEM(n − 1)

Discussion

confirmed the earlier reported expression of PLDa1 in response to salt stresses (Laxalt et al. 2001). Qin et al. (1997) suggested a catabolic role of PLDα in plant vacuoles during cell lysis, and Laxalt et al. (2001) suggested that it could be involved in large-scale lipid degradation associated with cell death. Our experiments show that, compared to WT and empty vector transformed cells, the PLDa1 transgenic tomato cells (Laxalt et al. 2001; Bargmann et al. 2006a) are less responsive to the cell death-inducing chemicals CPT, FB1 and cadmium (Fig. 1a–c). The results clearly point that, in tomato suspension cells, PLDα1 plays a role in chemicalinduced PCD. However, the cell death in PLDα1-silenced cells was not entirely inhibited, which suggest that either the residual PLDα activity or other signalling pathways (e.g. through PLC) might contribute to the cell death process. The

PLD/PLC/PA signalling is involved in chemical-induced cell death in tomato suspension cells To assess the possible involvement of PLD in chemicalinduced cell death, we have analysed the response of two independent PLDα1 RNAi tomato cell lines (Bargmann et al. 2006a, b) exposed to cell death triggers of different origin. These RNAi lines showed 85–90 % reduced PLDα1 expression and protein levels and greatly decreased in vivo PLD activity and PA levels (Bargmann et al. 2006a). In response to high salinity, the transformed cells showed strongly reduced PLD activity, indicating that this isoform is responsible for, at least part of, the observed PLD activity (Bargmann et al. 2006a). The findings of these authors

E.T. Iakimova et al.

50

Cell death (%)

40 WT PLD3

30 20 10

PT C +Z PT -A 5 sp C uM PT -C C H + PT 2A cD +b C YV B io A tin D -C yl -Y C M PT VA K + D C A PT C c M +B -YV K A io D tin -C -D H O EV D -C H O

yl in ut

B

C

nM -Y M VA K 1 D 00 A -C cuM M YV K B A io 10 D tin 0 -C nM -D H O EV 10 D 0 -C nM H O 10 0 nM

D

cA

Z-

A

sp

-C

YV A

H

2-

-C

D

C

B

C

10

0

on

tr

ol

0

Fig. 3 Effect of synthetic human caspase inhibitors on CPT-induced cell death in Msk8 WT and PLDα1 antisense (PLD3) tomato suspension cells. Five-day-old tomato suspension cells were treated with 5 μM CPT and with 100 nM of the following caspase inhibitors: broad range irreversible caspase inhibitor ZAsp-CH2-DCB, irreversible caspase-1 inhibitors Ac-YVAD-CMK

and its biotinylated form biotinyl-YVAD-CMK, reversible caspase-1 inhibitor Ac-YVAD-CHO and biotinylated caspase-3 inhibitor biotin-DEVD-CHO. In combined treatments, the concentrations of the chemicals are as at their single use. Control cells were left non-treated. Cell death was scored 24 h after the treatments. LSD (p≤0.05)=6.51. Error bars indicate SEM(n − 1)

lack of inhibition of CPT-induced cell death in PLDa1silenced cells at the addition of caspase inhibitors (Fig. 3) suggests that these other signaling pathways might contribute to caspase-like independent signaling. In addition to PLDα1-silenced cell lines, the participation of phospholipases D and C in cell death was studied in WT cells by applying specific PLD and PLC inhibitors to cell

cultures treated with the different cell death inducers. L-PEA (a product of PLA2 catalyzed hydrolysis of membrane glycerophospholipids), AEBSF (serine protease inhibitor proven to also inhibit PLD) and 1-butanol were selected based on their potency to suppress PLD enzymatic activity (Ryu et al. 1997; Andrews et al. 2000; Testerink and Munnik 2005). 1-Butanol may substitute for water in the PLDmediated formation of PA giving rise to production of inactive phosphatidylbutanol and thereby inhibiting PAdependent responses. 2-Butanol does not serve as an alternative substrate for PLD and was used as a negative control. Some of these chemicals were earlier demonstrated to suppress cell death in, e.g. suspension-cultured carrot cells and maize roots under hypoxia (He et al. 1996; Koch et al. 1998). These PLD and PLC inhibitors consistently suppressed the cell death in WT cells treated with various inducers. The reduced cell death response of PLDα1 antisense cells in response to CPT, FB1 and Cd treatment (Fig. 1a–c) and the inhibition of cell death in chemical-treated WT cells in the presence of PLD inhibitors (Fig. 2) confirm that PLD is instrumentally involved in cell death in tomato suspension cells. The possible involvement of PLC in chemical-induced cell death was supported by the observation that, when either of PLD or PLC enzymes was inhibited, the cell death was reduced only by approximately 50 %. However, factors other than PLC might be also responsible for the residual cell death in PLDa1-silenced cells. The suggested role of PA in cell death stimulation was substantiated by showing a cell death response to low

Hydrogen peroxide (µM)

3.0 2.5 2.0

WT WT+CPT PLD3+CPT PLD3

1.5 1.0 0.5 0.0

0

1

2

3 Time (h)

4

5

6

Fig. 4 Hydrogen peroxide production in CPT treated Msk8 PLDα1 transformed (PLD3) and wild type (WT) tomato cell lines. WT cells (circles) and PLD3 (triangles) were left untreated or treated with 5 μM CPT (diamonds WT, squares PLD3) and harvested at different time points between 0 and 6 h post-treatment. H2O2 was measured using luminoldependent chemiluminescence as described in “Materials and methods”. Data are means from at least three independent experiments using different batches of cells. LSD (p≤0.05)=0.66. Error bars indicate SEM(n−1)

Phospholipase D-related PCD signalling in tomato cells 60

80

a

b

WT PLD3

e

c

40

c

d b

Cell death (%)

PLD5

60

Cell death (%)

c

50

40

30

20

b

b

20 a a

a

a

10

a a

a

a

0

0

Control

Eth 100 µl l

-1

CPT 5 µM

CPT + Eth

Control

MP 5 µM

AVG 10 µM

MP + AVG

c

Fig. 5 Involvement of ethylene in cell death in Msk8 PLDα1 antisense (PLD3 and PLD5) and WT tomato suspension cells. a PLD3, PLD5 and WT cells were treated with 100 μl l−1 ethylene (in the headspace) alone, with 5 μM CPT alone and with combination of ethylene and CPT. b WT cells were treated with 5 μM MP and 10 μM AVG at single and combined application. Cell death in a and

b was scored 24 h after treatments. c Ethylene was measured online using laser-based photoacoustic detector (for details see “Materials and methods”). Arrow indicates the time of administration of the chemicals. Control cells in a–c were left untreated. In a and b, statistically different values are shown with different letters. Error bars indicate SEM(n −1)

concentrations of L-PA (a derivative of L-alpha-phosphatidic acid) (Fig. 1d). This PA analogue was used because native PA did not exert an effect when added to the cell culture, which may be related to its poor uptake in the cells (Yakimova et al. 2006). Our data show a concentrationdependent effect of L-PA on cell death; at L-PA concentrations higher than 100 nM, the effect was saturated. This demonstrates the involvement of PA in cell death mediation. In addition, the effect of MP, used to stimulate both PLD or PLC signalling, greatly stimulated cell death in WT cells. PLC, in interplay with ethylene and calcium, has been shown to participate in PCD during aerenchyma formation

in maize roots under hypoxic conditions (Drew et al. 2000). A role of PLC in xylogenesis (type of developmental PCD) has been established in xylogenic zinnia cell culture where the inhibition of PLC with U-73122 and inhibition of GTPbinding proteins by pertussis toxin led to elimination of 1,4,5-trisphosphate production and at least partially prevented the formation of tracheary elements (Zhang et al. 2002). The repression of cell death in the presence of PLC inhibitors reported here (Fig. 2) supports the previously suggested involvement of PLC in chemical-induced cell death in tomato cells (Yakimova et al. 2006, 2007). Our data also substantiate the recent findings of Wang et al.

E.T. Iakimova et al.

a

cs

nu

cs

b

c

e

f

nu

d

cw pm

cw

pm

p

p nu

nu

g dc

pm

h dc

i dc

dc

dc

dc nu

nu

dc

p

dc

lc

lc

lc

Fig. 6 Representative images of living and dead chemical-treated WT tomato suspension cells. a Transmission light image of a living cell. b FDA staining of the cell in a. c PI staining of the cell in a. d Morphology of a dead cell—visible are severely shrunken protoplast, plasma membrane separated from the cell wall and compact nucleus; cytoskeleton is not detectable—transmission light image. e FDA staining of the cell in d—

the dead cell is FDA negative. f PI staining of the cell in d—visible is PI positive compact dead nucleus. g Transmission light image of a cluster of dead and living cells. h FDA staining of the cells in g. i PI staining of the cells in g. The images were taken using CLSM as described in “Materials and methods”. cs cytoskeleton. cw cell wall, dc dead cell, lc living cell, pm plasma membrane, nu nucleus, p protoplast. Scale bars 20 μm

(2013). Using a similar pharmacological approach, these authors demonstrate that both PLC and PLD are involved in the stress response of tobacco suspension cells exposed to riboflavin. Plant PLD and PLC are suggested candidates for effectors of the heterotrimeric G proteins that are activated at various stress responses (reviewed by Tuteja and Sopory 2008). Using Arabidopsis mutants, Park et al. (2004) showed that Rho-related small G protein (ROP) 2 is implicated in PA-induced leaf cell death and ROS generation in guard cells. The participation of PLD/PLC in stress signalling downstream of G proteins has been studied following the exposure of plant cell cultures to MP—a cationic amphipathic 14-residue peptide toxin from the wasp Vespula lewisii. Both PLD and PLC may be activated by binding of

MP to G-protein coupled receptors (Ross and Higashijima 1994; Munnik et al. 1995; van Himbergen et al. 1999). In the unicellular algae Chlamydomonas, it has been demonstrated to trigger signalling pathways involving Ca2+, IP3 turnover, PLC, PLD, PA and oxidative stress downstream of G proteins, ethylene, NO and caspase-like proteolysis (Quarmby et al. 1992; Munnik et al. 1998; van Himbergen et al. 1999; Arisz et al. 2003). The potency of MP to activate PLD in tomato suspension cells has also been shown (van der Luit et al. 2000; Laxalt et al. 2001). Our current findings that MP induces cell death in tomato suspension cells and our recently reported effect of MP on cell death in Chlamydomonas reinhardtii (Yordanova et al. 2010) clearly indicate that PLD/PLC signalling indeed contributes to PCD.

Phospholipase D-related PCD signalling in tomato cells

a

b dc

p

lc

dc

lc

v cs

nu

nu sc lc

sc

lc nu

dc

dc

Fig. 7 Representative images of living and dead chemical-treated PLDα1-silenced tomato suspension cells. a Transmission light image. b FDA staining. The living cells are FDA positive and the dead cells are FDA negative. In the living cells, visible are diffused nuclei, intact vacuole and preserved cytoskeleton. In the dead cell, visible is severely shrunken

protoplast separated from the cell wall; cytoskeleton is not detectable. The images were taken using CLSM as described in “Materials and methods”. cs cytoskeleton, dc dead cell, lc living cell, nu nucleus, p protoplast, v vacuole. Scale bars 20 μm

PLD signalling operates in conjunction with caspase-like proteases

appears to be a component. However, caspase-like independent routes are suggested to be also involved in the executioner cascade (de Jong et al. 2002; Woltering et al. 2002; Woltering 2004). Theoretically, the lack of effect of caspase inhibitors on cell death in PLDα1-silenced cells supports the contribution of other pathways. Factors in such pathways might be PLC/Ca2+ or various other messengers.

It was earlier shown in tomato cells that cell death induced by CPT was inhibited by low concentrations (10–100 nM) of the human caspase-1 inhibitor Ac-YVAD-CMK, caspase-3 inhibitor Ac-DEVD-CHO and by the pan-caspase inhibitor Z-AspCH2-DCB (de Jong et al. 2000; Woltering et al. 2002; Woltering 2010; Yakimova et al. 2006, 2007; Iakimova et al. 2008). In this study, CPT-elicited PLDα1-silenced cells were exposed to a range of caspase inhibitors. Although the caspase inhibitors significantly reduce CPT-induced cell death in WT cells, no such effect was observed in PLDα1 antisense cells (Fig. 3). This indicates that PLDα1-associated cell death signals are linked to caspase-like activities. The lack of cell death inhibition in WT cells in the presence of the caspaseunrelated peptide MeOSuc-AAPV-CMK carrying a similar active moiety confirmed that caspase-like specificity of the inhibitors. The applied caspase-1 inhibitors are thought to target the plant VPE; the caspase-3 inhibitor is thought to target a proteasome subunit expressing caspase-3 activity (for details, see Woltering et al. 2002; Woltering 2010 and references therein). The results obtained suggest that such activities might be involved in PLDα1-mediated cell death in tomato cells. The cell death inhibition by the pan-caspase inhibitor Z-Asp-CH2-DCB additionally points to a role of caspase-like signalling. However, the precise identification of the nature of the caspase-like proteases involved in plant cell death requires further analyses. We show that the silencing of PLDα1 results in reduced cell death in response to CPT, which demonstrates that cell death is dependent on PLDα1. However, the cell death was not abolished to the level of nontreated control PLD3 cells, which indicates that other pathways might be responsible for the residual cell death effects. PCD operates in complicated network, in which PLDα1

ROS are involved in PLD-mediated cell death response In several reviews, ROS-mediated PLD, PLC and PA effects in plant stress tolerance have been described (e.g., Wang 2005; Tuteja and Sopory 2008; Li et al. 2009; Hong et al. 2010; Testerink and Munnik 2011). It has been shown that PA produced through PLD can enhance the activity of RbohNADPH-oxidase in copper-treated tobacco BY cells (Yu et al. 2008) and wheat roots (Navari-Izzo et al. 2006). In Arabidopsis protoplasts, a protective role of PLDδ in cell death mediated by freezing-induced oxidative damage is documented (Li et al. 2004). The inhibition of PLD and PLC was demonstrated to prevent H2O2 accumulation in cultured rice cells elicited with N-acetylchitoologosaccharide (Yamaguchi et al. 2003) and in tobacco cells exposed to riboflavin (Wang et al. 2013). Additionally, Zhang et al. (2003) reported that PLDδ is stimulated by H2O2 and the resulting PA functions to decrease H2O2-induced cell death in Arabidopsis protoplasts. Contrary, PA treatment increased the ROS level and promoted the cell death in Arabidopsis leaves (Park et al. 2004). Cumulatively, the findings indicate that the different PLD isoforms might contribute to different steps of cell deathassociated ROS signalling. In CPT-treated PLDα1 transformed tomato cell lines, we found lower levels of H2O2 in comparison to CPT-treated WT cells (Fig. 4). This suggests that in the studied experimental model PLDα1 activation may stimulate cell death through

E.T. Iakimova et al.

ROS production. Previously, we have established that NADPH oxidase inhibitors and ROS scavengers prevented chemical-induced cell death (de Jong et al. 2002; Yakimova et al. 2006, 2007; Iakimova et al. 2008), which substantiates the assumption that ROS signalling is mechanistically involved in cell death in tomato suspension cells. Cross-talk of PLD signalling and ethylene PLD has been shown to interfere with the action and production of ethylene. Antisense suppression of PLDα and blocking of PLDα activity by L-PEA decreased the rate of ethylenepromoted senescence in detached Arabidopsis leaves (Fan et al. 1997). Furthermore, in cultured carrot cells, PLD activation was established as a signalling step in the perception of the increase in ethylene production occurring at an early stage of glucose starvation (Lee et al. 1998). In our experimental model, MP-induced cell death was associated with an increase in ethylene production that was efficiently suppressed by simultaneous treatment of the cells with AVG. AVG treatment also greatly reduced the MPinduced cell death (Fig. 5b, c). This indicates that Gprotein-associated cell death is possibly dependent on ethylene. Binding of ethylene to ETR1 results in the rapid breakdown of the receptor protein and the subsequent inactivation of CTR1, being a negative regulator of downstream signal transduction events (Kevany et al. 2007; Lin et al.

2009). PLDα-derived PA may, independently from ethylene, also elicit an ethylene response by inactivation of CTR1 as proposed for PA’s role in the mediation of stress signalling in copper-treated broccoli seedlings and in Arabidopsis plants (Testerink et al. 2007, 2008; Jakubovicz et al. 2010). The treatment with cell death inducing chemicals may, through the activation of PLD, therefore also induce an ethylene response. Given the involvement of ethylene in cell death, the PLD-related ethylene response may play an important role in PLD-mediated cell death. If the role of PLD in cell death would mainly be through ethylene, then adding extra ethylene to PLDα1-silenced cells should completely restore the cell death to the level of chemical-treated WT cells supplied with ethylene. In both cases, the ethylene response is expected to be saturated. The application of a saturating concentration of ethylene to PLDα1 antisense cells did indeed stimulate the cell death induced by CPT. However, cell death was not up to the level observed in WT cells treated with CPT and ethylene (Fig. 5 a). This shows that, in chemical-treated PLDα1 antisense cells, the possible diminished ethylene response is not the main or only reason for the reduced cell death. Morphological manifestation of cell death We have earlier reported that, in WT tomato suspension cells, treatments with cell death inducing chemicals result in a cell death phenotype of protoplast shrinkage and

Cell death trigger

Exogenous ethylene (high levels)

MAPKs

CLP-independent cell death

PLC

PLD

IP3 (PA)

PA (Ca2+)

Ca2+

CLPs

Endogenous ethylene (low levels)

CLP-dependent cell death

ROS

Cell death Fig. 8 Schematic model of suggested signalling during chemicalinduced cell death in tomato suspension cells. Cell death-inducing chemicals may trigger both a caspase-like protein (CLP) dependent pathway (mediated mainly through PLD and PA) and a caspase-likeindependent pathway (mediated mainly through PLC, Ca2+ and other messengers). As Ca2+ and PA may serve as messengers in both pathways, the relative abundance of these messengers may shift the pathway to either CLP-dependent or CLP-independent cell death. Both

pathways need low concentrations of ethylene (or increased ethylene responsiveness) to facilitate the production of sufficient amounts of ROS (e.g. H2O2), which is mechanistically involved in PCD. Although basal concentrations of ethylene produced by the cells are required for cell death in both pathways, high concentrations of (applied) ethylene may primarily stimulate the caspase-like-independent pathway, presumably through activation of a MAP kinase pathway (MAPKs)

Phospholipase D-related PCD signalling in tomato cells

retraction from the cell wall and compaction of the nucleus (de Jong et al. 2002; Iakimova et al. 2008). These features correspond to the morphological PCD category of plant necrotic cell death as recently defined by van Doorn et al. (2011). Staining with the fluorophore PI and transmission light images revealed that in response to tested cell death inducers PLDα1-silenced cells expressed similar symptoms of necrotic PCD as observed in the WT cells (Figs. 6d–I and 7a). Comparative analyses also showed that following the FDA staining, no difference in the morphology of the living WT and PLDα1-deficient cells was detected (Figs. 6b and 7b). This suggests that PLDα1 deficiency does not qualitatively affect the type of cell death. PLDs are shown to play a role in modifications of cellular components. It has been demonstrated that, in tobacco BY cells, activation of PLD by n-butanol, MP, xylanase, NaCl and hypoosmotic stress led to the release of cortical microtubules from the plasma membrane and their partial depolymerisation (Dhonukshe et al. 2003). In addition, Andreeva et al. (2009) reported that small interfering RNA (siRNA) targeting AtPLDδ promoted whereas siRNA targeting AtPLDβ and γ reduced longitudinal microtubule orientation in epidermal cells of Allium porrum L. leaves. The role of PLDα isoforms in microtubule rearrangements is not yet clearly established (Gardiner et al. 2001; Dhonukshe et al. 2003; Motes et al. 2005). Although we observed that the cytoskeleton in the dead cells had disappeared (Figs. 6d, e and 7a), the extent of performed microscopy analysis did not allow distinguishing structural changes in microtubules. Suggested interplay of signals during chemical-induced cell death in tomato suspension cells

death. Although mostly studied in isolation, it is expected that the relative levels of these factors and their interactions are decisive for the eventual outcome of the cell death process (de Jong et al. 2002). In conclusion, we propose that, in tomato suspension cells, cell death-inducing chemicals may trigger both a caspase-like-dependent pathway (mediated mainly through PLD and PA) and a caspase-like-independent pathway (mediated mainly through PLC). Both pathways need low concentrations of ethylene (or increased ethylene responsiveness) and possibly calcium to facilitate the production of sufficient amounts of ROS, which is mechanistically involved in PCD. Although basal concentrations of ethylene produced by the cells are required for cell death in both pathways, high concentrations of (applied) ethylene may primarily stimulate the caspase-like independent pathway (Fig. 8). Acknowledgements The research was partially supported by EU FP6 Marie Curie Intra-European fellowship project MEIF-CT2006-041762; grant no. 041PE&RC2010.09.4 from C.T. de Wit Graduate School for Production Ecology & Resource Conservation, Wageningen, The Netherlands; project B-1502/05 from the National Science Fund, Ministry of Education, Youth and Science, Bulgaria; and a EU FP6-2004 Infrastructures-5 Project grant no. 026183-TRACEGASFAC, Trace Gas Facility, Radboud University, Nijmegen, The Netherlands. We are grateful to Ana Laxalt, Instituto de Investigaciones Biológicas, Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata, Mar del Plata, Argentina and Teun Munnik, Section of Plant Physiology, Swammerdam Institute for Life Sciences, University of Amsterdam, The Netherlands for kindly providing us with PLDα1silenced tomato cell lines. The assistance of Elisabeth S. Pierson, Department of General Instrumentation, Faculty of Sciences, Radboud University, Nijmegen, The Netherlands, with CLSM and the help of Zhenya P. Yordanova and Simona M. Cristescu with ethylene measurements are highly appreciated. Conflict of interest We declare that there is no conflict of interest.

Our experiments clearly show the involvement of PLD, PLC and PA in chemical-induced cell death and indicate that the signal transduction also involves other factors such as caspase-like proteases, calcium, ethylene and ROS. Cell death-inducing chemicals possibly simultaneously stimulate PLD and PLC activities and subsequently stimulate the formation of PA and possibly an increase in free cytosolic Ca2+. In parallel, cell death-inducing chemicals may stimulate ethylene synthesis. PA might operate through enhancement of the ethylene response (inactivation of CTR1) and may, together with ethylene, stimulate ROS production through stimulation of NADPH-oxidase. PLDα1 signalling may proceed through caspase-like proteases. PLC activation may lead to the production of IP3 and elevated Ca2+ and may, in addition, also give rise to increased PA levels. Also calcium may, in a variety of ways, contribute to the formation of ROS. It was earlier shown (De Jong et al. 2002) that increased cytosolic calcium levels in conjunction with ethylene may stimulate ROS and cell death in a caspase-like-independent way. The produced ROS is suggested to quantitatively relate to the extent of cell

References Andreeva Z, Ho AYY, Barthet MM, Potocký M, Bezvoda R, Žárský V, Marc J (2009) Phospholipase D family interactions with the cytoskeleton: isoform δ promotes plasma membrane anchoring of cortical microtubules. Funct Plant Biol 36:600–612 Andrews B, Bond K, Lehman JA, Horn JM, Dugan A, GomezCambronero J (2000) Direct inhibition of in vitro PLD activity by 4-(2-aminoethyl) benzenesulfonyl fluoride. Biochem Biophys Res Commun 273:302–311 Arisz SA, Valianpour F, van Gennip AH, Munnik T (2003) Substrate preference of stress-activated phospholipase D in Chlamydomonas and its contribution to PA formation. Plant J 34:595–604 Bargmann BOR, Laxalt AM, ter Riet B, van Schooten B, Merquiol E, Testerink C, Haring MA, Bartels D, Munnik T (2006a) Multiple PLDs Required for high salinity and water deficit tolerance in plants. Plant Cell Physiol 50:78–89 Bargmann BOR, Laxalt AM, ter Riet B, Schouten E, van Leeuwen W, de Dekker HL, Koster CG, Haring MA, Munnik T (2006b) LePLDβ1 activation and relocalization in suspension-cultured tomato cells treated with xylanase. Plant J 45:58–68

E.T. Iakimova et al. Bargmann BR, Laxalt AM, ter Riet B, Testerink C, Merquiol E, Mosblech A, Leon-Reyes A, Pieterse CM, Haring MA, Heilmann I, Bartels D, Munnik T (2009) Reassessing the role of phospholipase D in the Arabidopsis wounding response. Plant Cell Environ 32:837–850 Cristescu SM, Persijn ST, te Lintel HS, Harren FJM (2008) Laserbased systems for trace gas detection in life sciences. Appl Phys B 92:343–349 de Jong AJ, Hoeberichts FA, Yakimova ET, Maximova E, Woltering EJ (2000) Chemical-induced apoptotic cell death in tomato cells: involvement of caspase-like proteases. Planta 211:656–662 de Jong AJ, Yakimova ET, Kapchina VM, Woltering EJ (2002) A critical role of ethylene in hydrogen peroxide release during programmed cell death in tomato suspension cells. Planta 214:537–545 de Jong CF, Laxalt AM, Bargmann BO, de Wit PJ, Joosten MH, Munnik T (2004) Phosphatidic acid accumulation is an early response in the Cf-4/Avr4 interaction. Plant J 39:1–12 den Hartog M, Verhoef N, Munnik T (2003) Nod factor and elicitors activate different phospholipid signaling pathways in suspensioncultured alfalfa cells. Plant Physiol 132:311–317 Dhonukshe R, Laxalt AM, Goedhart J, Gadella TWJ, Munnik T (2003) Phospholipase D activation correlates with microtubule reorganization in living plant cells. The Plant Cell 15:2666–2679 Drew MC, He C-J, Morgan PW (2000) Programmed cell death and aerenchyma formation in roots. Trends Plant Sci 5:123–127 Fan L, Zheng S, Wang X (1997) Antisense suppression of phospholipase Dα retards abscisic acid- and ethylene-promoted senescence of postharvest Arabidopsis leaves. Plant Cell 9:2916–2919 Gardiner JC, Harper JD, Weerakoon ND, Collings DA, Ritchie S, Gilroy S, Cyr RJ, Marc J (2001) A 90-kD phospholipase D from tobacco binds to microtubules and the plasma membrane. Plant Cell 13:2143–2158 Gonorazki G, Laxalt AM, Testerink C, Munnik M, Da la Canal L (2008) Phosphatidylinositol 4-phosphate accumulates extracellularly upon xylanase treatment in tomato cell suspensions. Plant Cell Environ 31:1051–1062 He C-J, Morgan PW, Drew MC (1996) Transduction of an ethylene signal is required for cell death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia. Plant Physiol 112:463–4724186 Hoeberichts FA, Woltering EJ (2003) Multiple mediators of plant programmed cell death: interplay of conserved cell death mechanisms and plant-specific regulators. BioEssays 25:47–57 Hong JH, Chung GH, Cowan AK (2009) Delayed leaf senescence by exogenous lyso-phosphatidylethanolamine: towards a mechanism of action. Plant Physiol Biochem 47:526–534 Hong Y, Zhang W, Wang X (2010) Phospholipase D and phosphatidic acid signalling in plant response to drought and salinity. Plant Cell Environ 33:627–635 Iakimova ET, Woltering EJ, Kapchina-Toteva VM, Harren FJM, Cristescu SM (2008) Cadmium toxicity in cultured tomato cells —role of ethylene, proteases and oxidative stress in cell death signalling. Cell Biol Int 32:1521–1529 Jacob T, Ritchie S, Assmann SM, Gilroy S (1999) Abscisic acid signal transduction in guard cells is mediated by phospholipase D activity. Proc Natl Acad Sci USA 96:12192–12197 Jakubowicz M, Gałgańska H, Nowak W, Sadowski J (2010) Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings. J Exp Bot 61:3475–3491 Kevany BM, Tieman DM, Taylor MG, Cin VD, Klee HJ (2007) Ethylene receptor degradation controls the timing of ripening in tomato fruit. Plant J 51:458–467 Koch W, Wagner C, Seitz HU (1998) Elicitor-induced cell death and phytoalexin synthesis in Daucus carota L. Planta 206:523–532

Laxalt AM, Raho N, Ten Have A, Lamattina L (2007) Nitric oxide is critical for inducing phosphatidic acid accumulation in xylanaseelicited tomato cells. J Biol Chem 282:21160–21168 Laxalt AM, ter Riet B, Verdonk JC, Parigi L, Tameling WI, Vossen J, Haring M, Musgrave A, Munnik T (2001) Characterization of five tomato phospholipase D cDNAs: rapid and specific expression of LePLDβ1 on elicitation with xylanase. Plant J 26:237–247 Lee S, Hirt H, Lee Y (2001) Phosphatidic acid activates a woundactivated MAPK in Glycine max. Plant J 26:479–486 Lee SH, Chae HS, Lee TK, Kim SH, Shin SH, Cho BH, Cho SH, Kang BG, Lee WS (1998) Ethylene mediated phospholipid catabolic pathway in glucose-starved carrot suspension cells. Plant Physiol 116:223–229 Leung J, Bouvier-Durand M, Morris PC, Guerrier D, Chefdor F, Giraudat J (1994) Arabidopsis ABA response gene ABI: features of a calcium-modulated protein phosphatase. Science 264:1448– 1452 Li M, Hong Y, Wang X (2009) Phospholipase D- and phosphatidic acid-mediated signaling in plants. Biochim et Biophys Acta - Mol Cell Biol Lipids 1791:927–935 Li W, Li M, Zhang W, Welti R, Wang X (2004) The plasma membranebound phospholipase Dδ enhances freezing tolerance in Arabidopsis thaliana. Nature Biotech 22:427–433 Lin Z, Zhong S, Grierson D (2009) Recent advances in ethylene research. J Exp Bot 60:3311–3336 Meijer HJ, Munnik T (2003) Phospholipid-based signaling in plants. Annu Rev Plant Biol 54:265–306 Meyer K, Leube MP, Grill E (1994) A protein phosphatise 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264:1452–1455 Mishkind M, Vermeer JEM, Darwish E, Munnik T (2009) Heat stress activates phospholipase D and triggers PIP2 accumulation at the plasma membrane and nucleus. Plant J 60:10–21 Motes CM, Pechter P, Yoo CM, Wang Y-S, Chapman KD, Blancaflor EB (2005) Differential effects of two phospholipase D inhibitors, 1-butanol and N- acylethanolamine, on in vivo cytoskeletal organization and Arabidopsis seedling growth. Protoplasma 226:109– 123 Munnik T, Arisz SA, De Vrije T, Musgrave A (1995) G protein activation stimulates phospholipase D signalling in plants. Plant Cell 7:2197–2210 Munnik T, van Himbergen JAJ, ter Riet B, Braun FJ, Irvine RF, van den Ende H, Musgrave A (1998) Detailed analysis of the turnover of polyphosphoinositides and phosphatidic acid upon activation of phospholipases C and D in Chlamydomonas cells treated with non-permeabilizing concentrations of mastoparan. Planta 207:133–145 Mur LAJ, Kenton P, Lloyd AJ, Ougham H, Prats E (2008) The hypersensitive response; the centenary is upon us but how much do we know? J Exp Bot 59:501–520 Navari-Izzo F, Cestone B, Cavallini A, Natali L, Giordani T, Quartacci MF (2006) Copper excess triggers phospholipase D activity in wheat roots. Phytochemistry 67:1232–1242 Neill SJ, Desikan R, Clarke A, Hurst RD, Hancock JT (2002) Hydrogen peroxide and nitric oxide as signalling molecules in plants. J Exp Bot 53:1237–1247 Park J, Gu Y, Lee Y, Yang Z, Lee Y (2004) Phosphatidic acid induces leaf cell death in Arabidopsis by activating the Rho-related small G protein GTPase-mediated pathway of reactive oxygen species generation. Plant Physiol 134:129–136 Peng Y, Zhang J, Cao G, Xie Y, Liu X, Lu M, Wang G (2010) Overexpression of a PLDa1 gene from Setaria italica enhances the sensitivity of Arabidopsis to abscisic acid and improves its drought tolerance. Plant Cell Rep 29:793–802 Qin W, Pappan K, Wang X (1997) Molecular heterogeneity of phospholipase D (PLD): cloning of PLDγ and regulation of plant

Phospholipase D-related PCD signalling in tomato cells PLDγ, -β and -α by polyphosphoinositides and calcium. J Biol Chem 272:28267–28273 Quarmby LM, Yueh YG, Cheshire JL, Keller LR, Snell WJ, Crain CR (1992) Inositol phospholipid metabolism may trigger flagellar excision in Chlamydomonas reinhardtii. J Cell Biol 116:737–744 Ross EM, Higashijima T (1994) Regulation of G-protein activation by mastoparan and other cationic peptides. Methods Enzymol 237:26–37 Ryu SB, Karlsson BH, Ozgen M, Palta JP (1997) Inhibition of phospholipase D by lysophosphatidylethanolamine, a lipid-derived senescence retardant. Proc Natl Acad Sci USA 94:12717–12721 Sang Y, Zheng S, Li W, Huang B, Wang X (2001) Regulation of plant water loss by manipulating the expression of phospholipase Dα. Plant J 28:135–144 Schwacke R, Hager A (1992) Fungal elicitor induce a transient release of active oxygen species from cultured spruce cells that are dependent on Ca2+ and protein-kinase activity. Planta 187:136–141 Shen P, Wang R, Jing W, Zhang W (2011) Rice phospholipase Dα is involved in salt tolerance by the mediation of H+-ATPase activity and transcription. J Integr Plant Biol 53:289–299 Testerink C, Munnik T (2005) Phosphatidic acid: a multifunctional stress signaling lipid in plants. Trends Plant Sci 10:368–375 Testerink C, Munnik T (2011) Molecular, cellular, and physiological responses to phosphatidic acid formation in plants. J Exp Bot 62:2349–2361 Testerink C, Larsen PB, van der Does D, van Himbergen JA, Munnik T (2007) Phosphatidic acid binds to and inhibits the activity of Arabidopsis CTR1. J Exp Bot 58:3905–3914 Testerink C, Larsen PB, McLoughlin F, van der Does D, van Himbergen JA, Munnik T (2008) PA, a stress-induced short cut to switch-on ethylene signalling by switching-off CTR1? Plant Signal and Behav 3:681–683 Tuteja N, Sopory SK (2008) G protein coupled receptors, heterotrimeric G proteins and signal coupling via phospholipases. Plant Signal Behav 3:79–86 van der Luit AH, Piatti T, van Doorn A, Musgrave A, Felix G, Boller T, Munnik T (2000) Elicitation of suspension-cultured tomato cells triggers the formation of phosphatidic acid and diacylglycerol pyrophosphate. Plant Physiol 123:1507–1516 van Doorn WG, Woltering EJ (2005) Many ways to exit? Cell death categories in plants. Trends Plant Sci 10:117–122 van Doorn WG, Beers EP, Dangl JL, Franklin-Tong VE, Gallois P, Hara-Nishimura I, Jones AM, Kawai-Yamada M, Lam E, Mundy J, Mur LA, Petersen M, Smertenko A, Taliansky M, Van Breusegem F, Wolpert T, Woltering E, Zhivotovsky B, Bozhkov PV (2011) Morphological classification of plant cell deaths. Cell Death Differ 18:1241–1246 van Himbergen JAJ, ter Riet B, Meijer HJG, van den Ende H, Musgrave A, Munnik T (1999) Mastoparan analogues stimulate phospholipase C- and phospholipase D activity in Chlamydomonas: a comparative study. J Exp Bot 50:1735–1742 Vossen JH, Abd-El-Haliem A, Fradin EF, van den Berg GCM, Ekengren SK, Meijer HJG, Seifi A, Bai Y, ten Have A, Munnik T, Thomma BPHJ, Joosten MHAJ (2010) Identification of tomato

phosphatidylinositol-specific phospholipase-C (PI-PLC) family members and the role of PLC4 and PLC6 in HR and disease resistance. Plant J 62:224–239 Wang X (2005) Regulatory functions of phospholipase D and phosphatidic acid in plant growth, development, and stress responses. Plant Physiol 139:566–573 Wang L, Zhu X, Liu J, Chu X, Jiao J, Liang Y (2013) Involvement of phospholipases C and D in the defence responses of riboflavintreated tobacco cells. Protoplasma 250:441–449 Woltering EJ (2004) Death proteases come alive. Trends Plant Sci 9:469–472 Woltering EJ (2010) Death proteases: alive and kicking. Trends Plant Sci 15:185–188 Woltering EJ, van der Bent A, Hoeberichts FA (2002) Do plant caspases exist? Plant Physiol 130:1764–1769 Yakimova ET, Kapchina-Toteva VM, Laarhoven L-J, Harren FM, Woltering EJ (2006) Involvement of ethylene and lipid signalling in cadmium-induced programmed cell death in tomato suspension cells. Plant Physiol Biochem 44:581–589 Yakimova ET, Kapchina-Toteva VM, Woltering EJ (2007) Signal transduction events in aluminum-induced cell death in tomato suspension cells. J Plant Physiol 164:702–708 Yamaguchi T, Minami SN (2003) Activation of phospholipases by Nacetylchitoologosaccharide elicitor in suspension-cultured rice cells mediates reactive oxygen generation. Physiol Plant 118:361–370 Yamaguchi T, Kuroda M, Yamakawa H, Ashizawa T, Hirayae K, Kurimoto L, Shinya T, Shibuya N (2009) Suppression of a phospholipase D gene, OsPLDb1, activates defense responses and increases disease resistance in rice. Plant Physiol 150:308–319 Yordanova ZP, Iakimova ET, Cristescu SM, Harren FJM, KapchinaToteva VM, Woltering EJ (2010) Involvement of ethylene and nitric oxide in cell death in mastoparan-treated unicellular alga Chlamydomonas reinhardtii. Cell Biol Int 34:301–308 Yu ZL, Zhang JG, Wang XC, Chen J (2008) Excessive copper induces the production of reactive oxygen species, which is mediated by phospholipase D, nicotinamide adenine dinucleotide phosphate oxidase and antioxidant systems. J Integr Plant Biol 50:157–167 Zhang XG, Gary GC, Crain RC (2 002) In volvement o f phosphoinositide turnover in tracheary element differentiation in Zinnia elegans L. cells. Planta 215:312–318 Zhang W, Wang C, Qin C, Wood T, Olafsdottir G, Welti R, Wang X (2003) The oleate-stimulated phospholipase D, PLDσ, and phosphatidic acid decrease H2O2-induced cell death in Arabidopsis. Plant Cell 15:2285–2295 Zhang W, Qin C, Zhao J, Wang X (2004) Phospholipase Dα1-derived phosphatidic acid interacts with ABI1 phosphatase 2C and regulates abscisic acid signaling. Proc Natl Acad Sci USA 101:9508– 9513 Zien CA, Wang C, Wang X, Welti R (2001) In vivo substrates and the contribution of the common phospholipase D, PLDα, to woundinduced metabolism of lipids in Arabidopsis. Biochim Biophys Acta 1530:236–248