World J Microbiol Biotechnol (2011) 27:1035–1043 DOI 10.1007/s11274-010-0548-7
ORIGINAL PAPER
Isolation and characterization of a Bacillus licheniformis strain capable of degrading zearalenone Ping-Jung Yi • Cheng-Kang Pai • Je-Ruei Liu
Received: 20 February 2010 / Accepted: 19 August 2010 / Published online: 29 August 2010 Ó Springer Science+Business Media B.V. 2010
Abstract The worldwide contamination of cereals, oilseeds, and other crops by mycotoxin-producing moulds is a significant problem. Mycotoxins have adverse effects on humans and animals that result in illnesses and economic losses. Reduction or elimination of mycotoxin contamination in food and feed is an important issue. This study aimed to screen soil bacteria for degradation of zearalenone (ZEN). A pure culture of strain CK1 isolated from soil samples showed most capable of degradation of ZEN. Using physiological, biochemical, and 16S rRNA gene sequence analysis methods, CK1 was identified as Bacillus licheniformis. Addition of 2 ppm of ZEN in Luria–Bertani (LB) medium, B. licheniformis CK1 decreased 95.8% of ZEN after 36 h of incubation. In ZEN-contaminated corn meal medium, B. licheniformis CK1 decreased more than 98% of ZEN after 36 h of incubation. In addition, B. licheniformis CK1 was non-hemolytic, non-enterotoxin producing, and displayed high levels of extracellular xylanase, cellulase, and protease activities. These findings suggest that B. licheniformis CK1 could be used to reduce the concentrations of ZEN and improve the digestibility of nutrients in feedstuffs simultaneously.
P.-J. Yi J.-R. Liu (&) Institute of Biotechnology and Department of Animal Science and Technology, National Taiwan University, 4F., No. 81, Chang-Xing Street, Taipei, Taiwan e-mail:
[email protected] C.-K. Pai Department of Life Science, National Taiwan Normal University, Taipei, Taiwan J.-R. Liu Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan
Keywords Biodegradation Zearalenone Bacillus licheniformis Xylanase Cellulase
Introduction The worldwide contamination of cereals, oilseeds, and other crops by mycotoxin-producing moulds is a significant problem. Feed contaminated with mycotoxins, such as aflotoxins, fumonisins, ochratoxins, tremorgenic toxins, trichothecenes, and zearalenone (ZEN), pose a health risk to animals and, as a consequence, may cause significant economic losses due to the lower efficacy of livestock production. In addition, directly or indirectly (through animal products), contaminated foods may also pose a health risk to humans (Hussein and Brasel 2001). Zearalenone is a nonsteroidal estrogenic mycotoxin biosynthesized through a polyketide pathway by a variety of Fusarium fungi, including Fusarium graminearum, F. culmorum, F. cerealis, F. equiseti, F. crookwellense, and F. semitectum, which are common soil fungi in temperate and warm countries, and are regular contaminants of cereal crops worldwide (Desjardins and Proctor 2007; Zinedine et al. 2007). ZEN is frequently implicated in reproductive disorders of farm animals and occasionally in hyperoestrogenic syndromes in humans. Although ZEN is not classifiable as to carcinogenicity in humans (Group 3) by the International Agency for Research on Cancer (IARC) of the World Health Organization, it has been shown to be hepatotoxic, haematotoxic, immunotoxic and genotoxic (International Agency for Research on Cancer 1993; Zinedine et al. 2007). Much research has been conducted in order to identify methods which can salvage mycotoxin-contaminated commodities and thereby avert health risks associated with the toxins (Bata and Lasztity 1999). Many workers in the
123
1036
field are of the opinion that the best solution for decontamination should be detoxification by biodegradation, as this provides the opportunity for removal of mycotoxins under mild conditions, without using harmful chemicals or causing significant losses in nutritive value and palatability of decontaminated food and feed (Bata and Lasztity 1999; Wu et al. 2009). Bacillus licheniformis is a ubiquitous bacterium commonly found in the soil and wasted organic material, and is used extensively for the production of industrial enzymes, such as amylase and protease (Waldeck et al. 2006). A previous study indicated that certain strains of B. licheniformis offer great potential as probiotics for human use or feed additives (Sorokulova et al. 2008). It has been shown that the probiotic strains of B. licheniformis are effective for enhancement of the immune system of mice (Huang et al. 2008), and for increasing body weight gain, reducing diarrhea, and improving the feed-conversion efficiency of pigs (Kyriakis et al. 1999; Alexopoulos et al. 2004a, b; Kritas et al. 2006). In addition, previous studies showed that B. licheniformis could inhibit Aspergillus growth and degrade aflatoxin B1 (AFB1) and ochratoxin A (OTA) (Bohm et al. 2000; Petchkongkaew et al. 2008). However, our review of the literature found no previous reports on the degradation of ZEN by B. licheniformis. In the present study, a ZEN-degradation bacterial strain CK1 was isolated and genotypically and phenotypically characterized. The levels of extracellular xylanase, carboxymethyl cellulase (CMCase) and protease activities, as well as the enterotoxin producing capability of CK1 were also evaluated.
Materials and methods Chemicals and reagents A stock solution of ZEN was prepared by dissolving the solid standard (Sigma–Aldrich Co. St. Louis, MO) in acetonitrile (0.5 mg ml-1) and was stored in the dark at -20°C and brought to room temperature before use. The ZEN standard solutions for high-performance liquid chromatography (HPLC) calibration or spiking purposes were prepared daily by diluting the stock solutions in methanol. Acetonitrile and methanol (HPLC grade) was supplied by J. T. Baker Inc. (Phillipsburg, NJ).Water for HPLC mobile phase was purified successively by reverse osmosis and a Milli-Q system (Millipore, Bedford, MA). All other chemicals used were of analytical reagent grade and obtained from Sigma–Aldrich (St. Louis, MO). All solutions prepared for HPLC were filtered through a 0.45 lm nylon filter before use.
123
World J Microbiol Biotechnol (2011) 27:1035–1043
Bacterial strains A total of 168 bacterial strains were isolated from the soil samples collected from the experimental farm of National Taiwan University (Taipei, Taiwan) according to the methods described by Petchkongkaew et al. (2008). Material from single colonies was transferred to Luria– Bertani (LB) broth (Difco Laboratories, Detroit, MI) containing 2 ppm ZEN and incubated at 37°C in an orbital shaker (Major Science Inc., Taipei, Taiwan) at 250 rpm for 24 h. The culture was centrifuged at 5,0009g for 20 min at 4°C, and the supernatant was collected to quantify ZEN concentration by using HPLC as described by Silva and Vargas (2001). A pure culture of the strain that showed most capable of degradation of ZEN was designated as CK1, and was subjected to further analysis. The bacterial strain CK1 has been deposited in the Taiwanese Bioresource Collection and Research Center with deposit number BCRC 910458. The B. licheniformis type strain ATCC 14580, obtained from the American Type Culture Collection (ATCC; Manassas, VA), was used as a reference strain in this study. All of the Bacillus strains were routinely cultured and maintained at 37°C in LB broth. Agar plates were prepared by adding agar (1.5% w/v) (Difco) into the broth. Phenotypic characteristics of CK1 strain For colony morphological observation, bacteria were cultivated on blood agar plates (Merck, Darmstadt, Germany) at 37°C for 24 h. For 40 ,60 -diamidino-2-phenylindole (DAPI) staining, the cells were grown in LB broth at 37°C, harvested at mid-log phase, fixed in ethanol, and stained as described by Waldeck et al. (2006). Gram staining of the bacterial cells was performed with the Gram Staining kit (Sigma–Aldrich Co.) according to the manufacturer’s instructions. Carbon source utilization was determined with the API 50 CHB system (bioMerieux, Inc., Marcy l’Etoile, France). Molecular identification of CK1 strain Genomic DNA was isolated from CK1 using the DNeasy Blood & Tissue kit (Qiagen Inc., Valencia, CA). The partial 16S rRNA gene sequence of CK1 was amplified by PCR using the standard 16S rRNA gene primers, 16S–27f (50 AGAGTTTGATCMTGGCTCAG 30 ) and 16S–1492r (50 CGGTTACCTTGTTACGACTT 30 ), which can be used to amplify the maximum number of nucleotides in the 16S rRNA gene of a wide variety of bacterial taxa (Weisburg et al. 1991). The resultant PCR product was then sequenced by an automatic sequencing service provided by Mission Biotech Inc. (Taipei, Taiwan). Alignments and phylogenetic
World J Microbiol Biotechnol (2011) 27:1035–1043
analysis of the 16S rRNA gene sequences were performed using nucleotide sequences from position 54 to 510, which includes hypervariable regions V1 to V3. Sequences were aligned in the BioEdit Sequence Alignment Editor program (Hall 1999), and a phylogenetic tree was constructed by the neighbor-joining method in ClustalW (Thompson et al. 1994) and displayed with the TreeView program (Page 1996). Degradation of ZEN in LB broth by B. licheniformis strains To determine the effect of B. licheniformis CK1 and ATCC 14580 on the degradation of ZEN in LB broth, 10 ml of LB broth containing 2 ppm ZEN was inoculated at 1% with an overnight culture of B. licheniformis CK1 or ATCC 14580 and incubated at 37°C in an orbital shaker at 250 rpm for 36 h. During incubation, samples were taken at 0, 4, 8, 12, 24, and 36 h to extract and quantify ZEN concentration by using HPLC. To investigate the interaction of B. licheniformis CK1 with ZEN, B. licheniformis CK1 was cultured in LB broth containing 2 ppm of this mycotoxin for 36 h. The cells were harvested by centrifugation at 5,0009g for 20 min at 4°C. The cell pellet was resuspended in 1 ml of 0.1 mol l-1 phosphate-buffered saline (PBS; pH 7.4), sonicated for 10 min with an ultrasonicator (Model XL, Misonix, Farmingdale, NY), and fractioned into intracellular supernatant and cell-wall pellet fractions by subsequent centrifugation at 13,0009g for 20 min at 4°C. The cell-wall pellet was extracted by acetonitrile–water (84:16, v/v) and centrifugated at 13,0009g for 20 min at 4°C, and then the supernatant was analyzed for ZEN. Degradation of ZEN in contaminated-corn by B. licheniformis strains Corn kernels used in this study was purchased from local supermarket outlets. It was tested for absence of ZEN. ZEN-contaminated corn meal was prepared according to the method described by Mateo et al. (2001). In brief, F. graminearum ATCC 26557 was inoculated in sterile corn kernels and incubated at 20°C for 3 weeks. Then, the cultures were dried at 45°C for 48 h and finally ground to meal with a blender (Dynamics Corporation, New Hartford, CT). To determine the effect of B. licheniformis CK1 and ATCC 14580 on the degradation of ZEN in contaminated corn, l g of the ZEN-contaminated corn meal was suspended in 99 ml of distilled water. After sterilized at 121°C for 15 min, the corn meal medium was inoculated at 1% with an overnight culture of B. licheniformis CK1 or ATCC 14580 and incubated at 37°C in an orbital shaker at
1037
250 rpm for 36 h. During incubation, samples were taken at 0, 12, 24, and 36 h to extract and quantify ZEN concentration by using HPLC. Determination of ZEN by HPLC The ZEN concentration in the samples was determined by HPLC performed on a Shimadzu (Kyoto, Japan) LC-20 AT delivery system equipped with a RF-10AXL fluorescence detector (Shimadzu, Kyoto, Japan), a Shimpack CLC-ODS column (Shimadzu, Kyoto, Japan; 250 9 4.6 mm i.d., particle size 5 lg), and a Rheodyne injector (Rheodyne Inc., Cotati, CA). Before analyzed by HPLC, the samples were extracted with acetonitrile–water (84:16, v/v) for 90 min at 180 rpm on an orbital shaker, cleaned up by using the Romer Mycosep 224 column (Romer Labs Inc., Union, MO), and evaporated to dryness under nitrogen flow at 60°C according to the manufacturer’s instruction. The dried residue was re-dissolved in 300 ll of methanol solution (80:20, v/v with ultrapure and deionized water) and filtered through a membrane (0.45 lm), and 20 ll was injected into the HPLC to quantify ZEN. The mobile phase was methanol solution (80:20, v/v with ultrapure and deionized water), which has been filtered through a membrane (0.45 lm) and degassed for 5 min before use. The mobile phase flow rate was adjusted to 0.5 ml min-1, and detection was performed at 225 nm (excitation) and 465 nm (emmision). Linearity of the method was verified by analyzing six standard solutions in the range of 0.05–5 ppm for ZEN (0.05, 0.15, 0.5, 1.25, 2.5, and 5 ppm). Each concentration was analyzed in triplicate. The linear regression equation for the standard curve showed an R2 value [0.99, indicating a good linearity. The ZEN levels in the samples were calculated by comparing the area of the chromatographic peak of the sample with those of the standard curve. In case the reading of the samples was not within the range of the standard curve, the sample extract was quantitatively diluted and re-analyzed. Xylanase, CMCase, and protease activity of B. licheniformis strains For estimation of the extracellular xylanase, CMCase, and protease activities, 10 ml of LB broth was inoculated at 1% with an overnight culture of B. licheniformis CK1 or ATCC 14580 and incubated at 37°C in an orbital shaker at 250 rpm for 16 h. The culture was centrifuged at 5,0009g for 20 min at 4°C. The supernatant was collected for subsequent enzyme analysis. The extracellular xylanase, CMCase, and protease activities of B. licheniformis CK1 and ATCC 14580 were analyzed using the radial diffusion methods described by Teather and Wood (1982) and Waldeck et al. (2006).
123
1038
The levels of the extracellular xylanase and CMCase activities were quantified using birchwood azo-xylan and azo-CMC (Megazyme, Wicklow, Ireland) as substrates according to the manufacturer’s instruction as follows: 0.5 ml of the culture supernatant was incubated with 0.5 ml of 100 mM sodium acetate buffer (pH 5.0) containing 2% of the dyed substrate. After incubation at 40°C for 60 min, the reaction was stopped by adding 2.5 volumes of precipitant solution (4% sodium acetate trihydrate and 0.4% zinc acetate in 95% ethanol solution). After centrifugation at 1,0009g for 10 min, the absorbance of the supernatant was measured at a wavelength of 590 nm. The units of enzyme activity were determined from a standard curve supplied by the manufacturer. One unit of the fibrolytic enzyme activity was defined as that releasing 1 lmol of dye per minute from the respective substrate under the assay conditions. The levels of the extracellular protease activity was quantified by measuring the amounts of dye liberated by B. licheniformis CK1 culture supernatant incubated with 2% (w/v) azo-casein (Megazyme) in 100 mM sodium phosphate buffer (pH 7.0) according to the method described by Waldeck et al. (2006). After incubation at 40°C for 60 min, nondigested azo-casein was precipitated by the addition of 3 volumes of 5% trichloroacetic acid (TCA) solution and then centrifugation at 1,0009g for 10 min. The absorbance of the supernatant was measured at 440 nm. The units of enzyme activity were determined from a standard curve supplied by the manufacturer. One unit of the protease activity was defined as that releasing 1 lmol of dye per minute from azo-casein under the assay conditions. Detections of enterotoxins by using commercial immunoassay kits Enterotoxins were detected using the BCET-RPLA Toxin Detection kit (Oxoid, Basingstoke, United Kingdom) that is specific for the detection of the HblC subunit of the Hbl enterotoxin, and using the TECRA Bacillus Diarrheal Enterotoxin Visual Immunoassay (VIA) kit (Tecra Diagnostics, Roseville, Australia) that is specific for the detection of the NheA subunit of the Nhe enterotoxin. Detection of enterotoxin genes by PCR
World J Microbiol Biotechnol (2011) 27:1035–1043
Analysis System Institute 1998). All results were expressed as mean ± standard deviation. Student’s t-test was used for inter-group comparison, and a P-value less than 0.05 was considered significant.
Results Isolation and identification of Bacillus sp. CK1 Following the procedure outlined in Methods, a pure culture of strain CK1 showed most capable of degradation of ZEN was subjected to further analysis on the basis of phenotypic (including Gram staining, catalase and oxidase reactions, and typical spore formation) and physiological characteristics (including assimilation of citrate, nitrate, propionate, anaerobic growth, and growth at 50 and 55°C) related to genus Bacillus. The strain CK1 exhibited a rough and irregular edge colony morphology, and did not possess hemolytic capacity on blood agar plate (Fig. 1). The cells of CK1 were observed as straight rods with rounded ends, arranged singly or in chains, motile, and endospore-forming (Fig. 1). The features of CK1 were consistent with the description of Bacillus licheniformis in Bergey’s Manual of Systematic Bacteriology (Claus and Berkeley 1986). Further biochemical characterization with the API 50 CHB system disclosed rather faint differences between CK1 and B. licheniformis ATCC 14580 (Table 1). Out of 49 carbohydrates, both CK1 and B. licheniformis ATCC 14580 grew on 26. However, distinct variation was observed in the assimilation of the sugars (ribose, galactose, rhamnose, acetylglucosame, lactose, and melibiose) as shown in Table 1. According to the biochemical characteristic tests, CK1 was identified as B. licheniformis with 99.9% identity by the API 50 CHB system. Moreover, definite evidence for the affiliation of CK1 with the species B. licheniformis was confirmed by 16S rRNA gene sequencing, including the hypervariable regions V1 to V3. The strain CK1 revealed 99.3% identity with B. licheniformis ATCC 14580. Therefore, according to the results of microscopic observations, physiological and biochemical tests, and the phylogenetic analysis based on the V1–V3 region of 16S the rRNA gene (Fig. 2), the strain CK1 was identified as B. licheniformis.
The presence of B. cereus enterotoxin genes hbl (A, B, C, and D) and nhe (A, B, and C) was determined using PCR as previously described to profile food-poisoning Bacillus strains (Guinebretiere et al. 2002; Ouoba et al. 2008). Statistical analysis The significance of results was analyzed with the Statistical Analysis System software package version 9.1 (Statistical
123
Fig. 1 Microscopic and macroscopic examination of Bacillus sp. CK1. a and b Rod-shaped cells observed by phase-contrast and fluorescence microscopy. c The colony morphology of CK1 on blood agar
World J Microbiol Biotechnol (2011) 27:1035–1043 Table 1 Comparison of the biochemical characteristics of Bacillus licheniformis CK1 and ATCC 14580 using the ABI 50 CHB system
Substrate
1039
Strain CK1
Substrate ATCC 14580
Strain CK1
ATCC 14580
Glycerol
?
?
Esculin ferric citrate
?
?
Erythritol
–
–
Salicin
?
?
D-Arabinose
–
–
D-Cellobiose
?
?
L-Arabinose
?
–
D-Maltose
?
?
D-Ribose
?
?
D-Lactose
?
–
D-Xylose
?
?
D-Melibiose
–
?
L-Xylose
–
–
D-Sucrose
?
?
D-Adonitol
–
–
D-Trehalose
?
?
Methyl-xylopyranoside
–
–
Inulin
?
?
D-Galactose
–
?
D-Melezitose
–
–
D-Glucose D-Fructose
? ?
? ?
D-Raffinose Amidon/starch
? ?
? ?
D-Mannose
?
?
Glycogen
?
?
L-Sorbose
–
–
Xylitol
–
–
L-Rhamnose
–
?
Gentiobiose
–
–
Dulcitol
–
–
D-Turanose
–
–
Inositol
?
?
D-Lyxose
–
–
D-Mannitol
?
?
D-Tagatose
?
?
D-Sorbitol
?
?
D-Frucose
–
–
a-Methyl-D-mannoside
–
–
L-Frucose
–
– –
a-Methyl-D-glucoside
?
?
D-Arabitol
–
N-Acetylglucosamine
?
–
L-Arabitol
–
–
Amygdalin
?
?
Gluconate
–
–
Arbutin
?
?
2-Ketogluconate
–
–
5-Ketogluconate
–
–
Fig. 2 Neighbor-joining phylogenetic tree based on the V1–V3 region of the 16S rRNA gene of Bacillus species. At major nodes, bootstrap percentages for 1,000 resamplings are shown. The scale bar represents 0.1 nucleotide substitutions per nucleotide position. Bacillus species include B. amyloliquefaciens (GenBank accession
no. X60605), B. atrophaeus (AB021181), B. cereus (AF290547), B. coagulans (D16267), B. fastidiosus (X60615), B. firmus (D16268), B. megaterium (X60629), B. licheniformis (X68416), B. mojavensis (AY603656), B. subtilis subsp. subtilis (AJ276351), B. subtilis subsp. spizizenii (AF074970), and B. vallismortis (AB021198)
Degradation of ZEN by B. licheniformis CK1
and to compare degradation activities, the type strain of B. licheniformis, ATCC 14580, was cultured and investigated using the same procedure. As shown in Fig. 3a, both B. licheniformis CK1 and ATCC 14580 displayed
The ability of B. licheniformis CK1 to degrade ZEN was tested in LB broth containing 2 ppm of ZEN. As a reference
123
1040
World J Microbiol Biotechnol (2011) 27:1035–1043
To investigate the interaction of B. licheniformis CK1 with ZEN, B. licheniformis CK1 was cultured in LB broth containing 2 ppm of this mycotoxin for 36 h, and then the cells were collected and extracted with acetonitrile–water solution. ZEN was not observed on the HPLC chromatogram in the acetonitrile–water extraction of B. licheniformis CK1 cell walls, indicating that ZEN did not bind to the cell components of B. licheniformis CK1. Effect of ZEN on the growth characteristics of B. licheniformis strains When cultured in LB broth at 37°C, B. licheniformis CK1 reached stationary growth after 24 h of fermentation, with a concentration of 9.17 ± 0.14 log CFU ml-1 (OD600 of 2.09 ± 0.02). The growth pattern of B. licheniformis ATCC 14580 was similar to that observed for B. licheniformis CK1. The cell counts of B. licheniformis CK1 and ATCC 14580 were not significantly different throughout the fermentation period (data not shown). The effect of ZEN on the growth rate of B. licheniformis CK1 and ATCC 14580 was also investigated in this study. The results indicate that ZEN, added at a concentration of 2 ppm, was not toxic to B. licheniformis CK1 and ATCC 14580, as judged by the bacterial growth rate in the presence and absence of this mycotoxin (data not shown).
Fig. 3 Degradation kinetics of ZEN by Bacillus licheniformis CK1 (filled square) and ATCC14580 (open diagnol) cultured in LB broth containing 2 ppm ZEN (a) or ZEN-contaminated corn meal medium containing 1.8 ppm ZEN (b). The bars represent standard errors of the means calculated from two independent experiments performed in triplicate
characteristic degradation effects on ZEN. The degradation activities of B. licheniformis CK1 were significantly greater than those of B. licheniformis ATCC 14580. B. licheniformis CK1 decreased 95.8% while B. licheniformis ATCC decreased 41.0% of ZEN in LB broth after 36 h of incubation. The ability of B. licheniformis CK1 to degrade ZEN was also tested in ZEN-contaminated corn. Before inoculation of the tested bacterial strains, the ZEN concentration in corn meal medium (1%) was 1.79 ± 0.15 ppm. As shown in Fig. 3b, B. licheniformis CK1 displayed characteristic degradation effects on ZEN. After 36 h of incubation, ZEN residue in the supernatant of the corn meal solution was lower than 0.05 ppm, i.e., more than 97% of ZEN was degraded by B. licheniformis CK1. To the best of our knowledge, this is the first report of the degradation of ZEN by B. licheniformis strains.
123
Xylanase, CMCase, and protease activity of B. licheniformis CK1 If a ZEN-degradation bacterial strain can produce extracellular degradative enzymes, it could be used to reduce the concentrations of ZEN and improve the digestibility of nutrients in feedstuffs simultaneously. To measure extracellular degradative enzyme production, the radial diffusion assay was used to determine xylanase, CMCase, and protease activities of B. licheniformis CK1 and ATCC 14580. The size of clearing halos on media containing various polymers differed significantly between these two strains (Fig. 4a). B. licheniformis CK1 had larger degradation zones than B. licheniformis ATCC 14580 on all media tested (xylan, CMC, and skim milk), suggesting that B. licheniformis CK1 produced a comparatively larger amount of extracellular xylanase, cellulase, and protease. To substantiate the findings of the radial diffusion assay, enzyme activities were exemplified by determining specific activities in the culture supernatant. The results obtained clearly matched the findings obtained in the plate assays (Fig. 4b). As anticipated, all of the xylanase, cellulase, and protease activities of B. licheniformis CK1 were significantly higher than those of B. licheniformis ATCC14580.
World J Microbiol Biotechnol (2011) 27:1035–1043
1041
Fig. 4 Plate test for enzyme activity of Bacillus licheniformis CK1 and ATCC14580 strains. a Extracellular supernatant of growing culture of CK1 and ATCC14580 was pipetted into wells of agar plates containing oat-spelt xylan, carboxymethyl cellulose, and skim milk. Clearing halos around the wells indicated enzyme activities.
b Extracellular enzyme activity after 24 h of batch fermentation. The bars represent standard errors of the means calculated from two independent experiments performed in triplicate. Pairs of bars marked with an asterisk were significantly different at a P-value less than 0.05
Enterotoxins produced by B. licheniformis CK1
(Westlake et al. 1987), Gliocladium roseum (TakahashiAndo et al. 2002), and Trichosporon mycotoxinivorans (Molnar et al. 2004), and some strains of rumen protozoa (Kiessling et al. 1984) can degrade ZEN with varied efficiency compared to less- or non-toxic products. Despite the many publications on biodegradation of ZEN by microorganisms, their application in practice in detoxification of food and/or feed has been limited. This may be due to lack of information about mechanisms of biodegradation, toxicity of degradation products, and safety of the microorganisms towards animals (European Food Safety Authority 2009). In the present study, B. licheniformis CK1 was found possess the ability to degrade ZEN. Since certain strains of B. licheniformis have been used as probiotics for human or livestock animals (Sorokulova et al. 2008), B. licheniformis CK1 could potential be used to reduce the concentrations of ZEN in feedstuffs safely. The second possible strategy for bio-detoxification of mycotoxins in food and/or feed is binding of mycotoxins by cell wall components of microorganisms to inhibit the absorption of mycotoxin in consumed food in the digestive track. Some strains of bacteria and yeast such as Lactobacillus rhamnosus (El-Nezami et al. 2002) and Saccharomyces cerevisiae (Yiannikouris et al. 2004) could work as biological adsorbents that prevent the transfer of ZEN to the intestinal tract of humans and animals. A previous study showed that B. licheniformis could reduce the levels of AFB1 and OTA in culture medium (Petchkongkaew et al. 2008). However, the mechanisms responsible for the decrease of AFB1 and OTA were unclear. In the present study, we found that B. licheniformis CK1 decreased ZEN concentration in culture medium during incubation. Furthermore, ZEN was not observed on the HPLC chromatogram in the acetonitrile–water extraction of B. licheniformis CK1 cell walls, indicating that ZEN did
To confirm whether B. licheniformis CK1 produced enterotoxins, the organism was subjected to two commercial immunoassay kits specific to the HblC subunit of the Hbl enterotoxin and the NheA subunit of the Nhe enterotoxin. The type strain of B. licheniformis, ATCC 14580, was also tested using the same procedure. Neither B. licheniformis CK1 nor ATCC 14580 was found to produce enterotoxins (results not shown). Furthermore, PCR testing of genomic DNA from B. licheniformis CK1 and ATCC 14580 for the presence of enterotoxin genes as described previously for profiling of food-poisoning Bacillus strains (Guinebretiere et al. 2002; Ouoba et al. 2008) revealed that neither organism carried the B. cereus enterotoxin genes hbl (A, B, C, and D) or nhe (A, B, and C) (results not shown).
Discussion Bio-detoxification using microorganisms is a well-known strategy for the management of mycotoxins in foods and feeds. Bio-detoxification can reduce or eliminate the possible contaminations of mycotoxins in food and feed, and can be a highly efficient, specific and environmentally friendly method (Bata and Lasztity 1999; Wu et al. 2009). In the present study, we found that B. licheniformis CK1 possessed the ability to degrade ZEN. To the best of our knowledge, and following a thorough review of the relevant literature, this is the first report of degradation of ZEN by B. licheniformis strains. Principally there are two possible strategies for the biodetoxification of mycotoxins in food and feed. The first is microbial biodegradation of mycotoxin. Several strains of bacteria and yeast, including Butyrivibrio fibrisolvens
123
1042
not bind to the cell-wall components of B. licheniformis CK1. For this reason, future research will be directed to identify the metabolic pathways responsible for the degradation of ZEN by B. licheniformis CK1. B. licheniformis is well known for its potential to secrete a number of degradative enzymes, such as protease and amylase (Waldeck et al. 2006). Within the complete genome sequence of B. licheniformis ATCC14580, there are numerous genes that may allow degradation of cellulose, hemicelluloses, chitin, pectin, and protein (Veith et al. 2004). In the radial diffusion assay, B. licheniformis CK1 displayed larger degradation zones than B. licheniformis ATCC 14580 on all media tested (xylan, CMC, and skim milk), suggesting it produced a relatively large amount of extracellular xylanase, cellulase, and protease. As B. licheniformis CK1 not only possesses the ability to degrade ZEN but also can produce large amount of extracellular degradative enzymes, we suggested that it could be used to reduce the concentrations of ZEN and improve the digestibility of nutrients in feedstuffs simultaneously. Microorganisms used in food and feed should not produce harmful toxins. Most food poisoning incidents attributed to Bacillus species are associated with B. cereus, but the relevance of other Bacillus species as food poisoning organisms has been increasingly recognized (Salkinoja-Salonen et al. 1999). It is mainly strains of B. subtilis, B. licheniformis, and B. pumilus that have been associated with incidents of food-borne gastroenteritis, and it is believed that the enterotoxins produced by Bacillus spp. other than B. cereus are proteins transcribed from genes that are similar to those of B. cereus enterotoxins (From et al. 2005). Two different enterotoxin complexes produced by B. cereus, hemolysin BL (Hbl) and nonhemolytic enterotoxin (Nhe), have been characterized. Hbl complex is composed of three proteins, B, L1, and L2 transcribed from the genes hblA, hblD, and hblC, together with a fourth gene, hblB (encoding the B0 protein)(Guinebretiere et al. 2002). Nhe complex is also composed of three different proteins, NheA, NheB, and NheC encoded by the three genes nheA, nheB, and nheC, respectively (Guinebretiere et al. 2002). In this study, B. licheniformis CK1 was subjected to two commercial immunoassays specific to the HblC subunit of the Hbl enterotoxin and the NheA subunit of the Nhe enterotoxin to determine whether B. licheniformis CK1 produced enterotoxins. Neither B. licheniformis CK1 nor ATCC 14580 was found to produce enterotoxins (results not shown). Furthermore, B. licheniformis CK1 and ATCC 14580 did not carry the B. cereus enterotoxin genes hbl (A, B, C, and D) and nhe (A, B, and C), confirming that they did not possess the ability to produce enterotoxins. In conclusions, a ZEN-degradation strain of B. licheniformis CK1 was isolated and genotypically and
123
World J Microbiol Biotechnol (2011) 27:1035–1043
phenotypically characterized. B. licheniformis CK1 displayed characteristic detoxification effects on ZEN and could produce a large amount of extracellular xylanase, CMCase, and protease. In addition, B. licheniformis CK1 did not carry enterotoxin genes, and thus did not possess the ability to produce enterotoxins. These findings suggest that B. licheniformis CK1 could be used to reduce the concentrations of ZEN and improve the digestibility of nutrients in feedstuffs simultaneously. Acknowledgments The authors thank Professor Y. H. Cheng of National Ilan University for providing ZEN-contaminated corn meal. This research was conducted using funds partially provided by grant 98AS-2.1.4-AD-U1(9) and 99AS-2.1.4-AD-U1(5) from the Council of Agriculture, Republic of China.
References Alexopoulos C, Georgoulakis I, Tzivara A, Kyriakis CS, Govaris A, Kyriakis SC (2004a) Field evaluation of the effect of a probioticcontaining Bacillus licheniformis and Bacillus subtilis spores on the health status, performance, and carcass quality of grower and finisher pigs. J Vet Med A Physiol Pathol Clin Med 51:306–312 Alexopoulos C, Georgoulakis IE, Tzivara A, Kyriakis SK, Siochu A, Kyriakis SC (2004b) Field evaluation of the efficacy of a probiotic-containing Bacillus licheniformis and Bacillus subtilis spores, on the health status and performance of sows and their litters. J Anim Physiol Anim Nutr 88:381–392 Bata A, Lasztity R (1999) Detoxification of mycotoxin-contaminated food and feed by microorganisms. Trends Food Sci Technol 10:223–228 Bohm J, Grajewski J, Asperger H, Cecon B, Rabus B, Razzazi E (2000) Study on biodegradation of some A- and B-trichothecenes and ochratoxin A by use of probiotic microorganisms. Mycotoxin Res 16A:70–74 Claus D, Berkeley RCW (1986) Genus Bacillus Chon 1872. In: Sneath PHA, Mair NS, Sharpe ME, Holt JG (eds) Bergey’s manual of systematic bacteriology, vol 2. The Williams & Wilkins Co., Baltimore, pp 1105–1139 Desjardins AE, Proctor RH (2007) Molecular biology of Fusarium mycotoxins. Int J Food Microbiol 119:47–50 El-Nezami H, Polychronaki N, Salminen S, Mykkanen H (2002) Binding rather than metabolism may explain the interaction of two food-grade Lactobacillus strains with zearalenone and its derivative a-zearalenol. Appl Environ Microbiol 68:3545–3549 European Food Safety Authority (2009) Review of mycotoxindetoxifying agents used as feed additives: mode of action, efficacy and feed/food safety. Available at: http://www.efsa. europa.eu/en/scdocs/doc/22e.pdf From C, Pukall R, Schumann P, Hormazabal V, Granum PE (2005) Toxin-producing ability among Bacillus spp. outside the Bacillus cereus group. Appl Environ Microbiol 71:1178–1183 Guinebretiere MH, Broussolle V, Nguyen-The C (2002) Enterotoxigenic profiles of food-poisoning and food-borne Bacillus cereus strains. J Clin Microbiol 40:3053–3056 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis. Nucleic Acids Symp Ser 41:95–98 Huang JM, La Ragione RM, Nunez A, Cutting SM (2008) Immunostimulatory activity of Bacillus spores. FEMS Immunol Med Microbiol 53:195–203 Hussein HS, Brasel JM (2001) Toxicity, metabolism, and impact of mycotoxins on humans and animals. Toxicology 167:101–134
World J Microbiol Biotechnol (2011) 27:1035–1043 International Agency for Research on Cancer (1993) Overall evaluations of carcinogenicity to humans. In: IARC Monographs, vol 56. International Agency for Research on Cancer, Lyons, France, pp 397–444 Kiessling KH, Pettersson H, Sandholm K, Olsen M (1984) Metabolism of aflatoxin, ochratoxin, zearalenone, and three trichothecenes by intact rumen fluid, rumen protozoa, and rumen bacteria. Appl Environ Microbiol 47:1070–1073 Kritas SK, Govaris A, Christodoulopoulos G, Burriel AR (2006) Effect of Bacillus licheniformis and Bacillus subtilis supplementation of ewe’s feed on sheep milk production and young lamb mortality. J Vet Med A Physiol Pathol Clin Med 53:170–173 Kyriakis SC, Tsiloyiannis VK, Vlemmas J, Sarris K, Tsinas AC, Alexopoulos C, Jansegers L (1999) The effect of probiotic LSP 122 on the control of post-weaning diarrhoea syndrome of piglets. Res Vet Sci 67:223–228 Mateo JJ, Llorens A, Mateo R, Jimenez M (2001) Critical study of and improvements in chromatographic methods for the analysis of type B trichothecenes. J Chromatogr A 918:99–112 Molnar O, Schatzmayr G, Fuchs E, Prillinger H (2004) Trichosporon mycotoxinivorans sp. Nov., a new yeast species useful in biological detoxification of various mycotoxins. Syst Appl Microbiol 27:661–671 Ouoba LII, Thorsen L, Varnam AH (2008) Enterotoxins and emetic toxins production by Bacillus cereus and other species of Bacillus isolated from Soumbala and Bikalga, African alkaline fermented food condiments. Int J Food Microbiol 124:224–230 Page RD (1996) TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:357–358 Petchkongkaew A, Taillandier P, Gasaluck P, Lebrihi A (2008) Isolation of Bacillus spp. from Thai fermented soybean (Thuanao): screening for aflatoxin B1 and ochratoxin A detoxification. J Appl Microbiol 104:1495–1502 Salkinoja-Salonen M, Vuorio R, Andersson MA, Kampfer P, Andersson MC, Honkanen-Buzalski T, Scoging AC (1999) Toxigenic strains of Bacillus licheniformis related to food poisoning. Appl Environ Microbiol 65:4637–4645 Silva CMG, Vargas EA (2001) A survey of zearalenone in corn using Romer Mycosep 224 column and high performance liquid chromatography. Food Addit Contam 18:39–45 Sorokulova IB, Pinchuk IV, Denayrolles M, Osipova IG, Huang JM, Cutting SM, Urdaci MC (2008) The safety of two Bacillus probiotic strains for human use. Dig Dis Sci 53:954–963
1043 Statistical Analysis System Institute (1998) SAS User’s guide: statistics. SAS Institute Inc., Cary Takahashi-Ando N, Kimura M, Kakeya H, Osada H, Yamaguchi I (2002) A novel lactonohydrolase responsible for the detoxification of zearalenone: enzyme purification and gene cloning. Biochem J 365:1–6 Teather RM, Wood PJ (1982) Use of Congo red-polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Appl Environ Microbiol 43:777–780 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Veith B, Herzberg C, Steckel S, Feesche J, Maurer KH, Ehrenreich P, Ba¨umer S, Henne A, Liesegang H, Merkl R, Ehrenreich A, Gottschalk G (2004) The complete genome sequence of Bacillus licheniformis DSM13, an organism with great industrial potential. J Mol Microbiol Biotechnol 7:204–211 Waldeck J, Daum G, Bisping B, Meinhardt F (2006) Isolation and molecular characterization of chitinase-deficient Bacillus licheniformis strains capable of deproteinization of shrimp shell waste to obtain highly viscous chitin. Appl Environ Microbiol 72:7879–7885 Weisburg WG, Brans SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697–703 Westlake K, Mackie RI, Dutton MF (1987) Effects of several mycotoxins on specific growth rate of Butyrivibrio fibrisolvens and toxin degradation in vitro. Appl Environ Microbiol 53:613–614 Wu QH, Jezkova A, Yuan ZH, Pavlikova L, Dohnal V, Kuca K (2009) Biological degradation of aflatoxins. Drug Metab Rev 41:1–7 Yiannikouris A, Francois J, Poughon L, Dussap CG, Bertin G, Jeminet G, Jouany JP (2004) Adsorption of zearalenone by betaD-glucans in the Saccharomyces cerevisiae cell wall. J Food Protect 67:1195–1200 Zinedine A, Soriano JM, Molto JC, Manes J (2007) Review on the toxicity, occurrence, metabolism, detoxification regulations and intake of zearalenone: an oestrogenic mycotoxin. Food Chem Toxicol 45:1–18
123