Arch Toxicol (2009) 83:161–171 DOI 10.1007/s00204-008-0336-4
R E P R O D U CT IV E T O X I C O L O G Y
Mechanisms of estrogen-induced eVects in avian reproduction caused by transovarian application of a xenoestrogen, diethylstilbestrol Ryo Kamata · Fujio Shiraishi · Tokukazu Izumi · Shinji Takahashi · Akira Shimizu · Hiroaki Shiraishi
Received: 31 March 2008 / Accepted: 18 June 2008 / Published online: 3 July 2008 © Springer-Verlag 2008
Abstract To clarify breeding failure in avian species caused by the estrogenicity of chemicals, alterations in the reproductive systems of Japanese quail exposed in ovo to a xenoestrogen were investigated. An injection of diethylstilbestrol (DES) into the yolk before incubation decreased, after sexual maturation, egg-laying performance of female quails, which accompanied inducing abnormal development of the oviducts. All females treated with 50 ng DES/g of egg did not lay eggs, while 0.5–5 ng DES/g reduced egg weight and eggshell strength and thickness. In the uterus (shell gland), the mRNAs for calcium regulating factors, osteopontin and calbindin D28 K, were reduced dosedependently by DES. Scanning electron microscopy showed that shell thinning was pronounced in the mammillary and cuticular layers of the eggshell, regions where osteopontin proteins are reportedly located. These indicate that transovarian exposure to xenoestrogens causes malformation and dysfunction of the oviducts, where calcium regulating molecules could play key roles in eggshell thinning.
R. Kamata (&) · F. Shiraishi · H. Shiraishi Research Center for Environmental Risk, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki 305-8506, Japan e-mail:
[email protected] T. Izumi Department of Bioproduction Sciences, Ishikawa Prefectural University, 308 Suematsu 1-chome, Nonoichi-machi, Ishikawa 921-8836, Japan S. Takahashi · A. Shimizu Laboratory of Intellectual Fundamentals for Environmental Studies, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki 305-8506, Japan
Keywords Avian reproductive disorder · Diethylstilbestrol · Eggshell thinning · Osteopontin · Calbindin D28K · Japanese quail
Introduction Decreases in the populations of certain species of wildlife caused by harmful substances originating in human activity are a longstanding environmental issue. In particular, avian species are highly susceptible to chemical pollution. For instance, in areas polluted with the organochlorine compounds dichlorodiphenyltrichloroethane (DDT) and polychlorinated biphenyls (PCBs), various disabilities in the avian reproductive system, such as diminished reproductive behavior, morphological abnormalities of the reproductive organs and impairment of eggshell formation, have been observed (Newton 1979; Fry 1995). These reproductive abnormalities are thought to be due to the endocrine eVects of the chemicals. Indeed, Berg and colleagues have conWrmed that estrogenic compounds experimentally cause morphological abnormalities of avian reproductive organs and induce impairment of eggshell formation (Berg et al. 2001, 2004; Halldin et al. 2002; Holm et al. 2006). We recently reported that female Japanese quails (Coturnix japonica) treated as embryos with the synthetic estrogen, diethylstilbestrol (DES), produced, after sexual maturation, abnormal eggs such as soft-shelled/unmarked eggs or eggs completely lacking shells (Kamata et al. 2006a). As a result of impairment of eggshell formation, a dramatic decrease in the population of birds was predicted (Kamata et al. 2006b). Thus, it is understood that the estrogenicity existing in chemicals transferred from mother birds into eggs impairs the early reproductive diVerentiation and development in embryos and/or chicks and results in abnormal
123
162
development and the functional decline of avian reproductive tracts. Further detailed studies on reproductive disruption caused by xenoestrogens are required to investigate their underlying mechanisms and to help in understanding the normal reproductive functions of birds. There are, however, few useful reports on the biochemical and molecular biological aspects of aVected birds and organs or on the features of thin-walled eggshells. In the present study, with the objective of understanding the mechanisms of reproductive disorders, in particular aspects of eggshell thinning, caused by transovarian exposure to a xenoestrogen, we injected DES into Japanese quail eggs and evaluated its developmental and reproductive eVects as a model for estrogen action. To clarify structural and functional changes in the eggshell from female quails treated in ovo with DES, electron microscopic investigation in addition to the usual mechanical analysis of shell condition, such as eggshell strength, shell weight and thickness, was carried out. To explore the underlying cause of abnormal development and the functional decline of reproductive tracts, biochemical examination of blood and analyses of gene expression in female and male gonads and reproductive tracts as well as observations of changes in anatomy were performed. Expression analyses of gonadal gene in newly hatched chicks were also investigated. In our earlier studies test substances were administered into the air chamber of the egg on the tenth day of incubation to ensure embryo survival and to maximize the estrogenic eVect of the chemicals (Kamata et al. 2006a, b). However, in the present study DES was injected into the yolk before incubation of the egg to follow as closely as possible the actual exposure route of pollutants in wild birds, in which lipophilic chemicals are mainly transferred from mother birds into the egg yolk.
Arch Toxicol (2009) 83:161–171
and embryo viability checked on day 10 of incubation. Eggs for the study were collected from those pairs that exhibited embryo viability of 80% or more within the 2 weeks before the beginning of incubation and were stored at 12–13°C. As the average egg weight from pairs of Br males and WE females was approximately 10.5 g in our preliminary study, eggs weighing 10.5 § 0.5 g were chosen from the stored eggs and divided into treatment groups. Thirty-Wve eggs in each group were randomly selected, using a computer program of our own making, to minimize the diVerences between the averages of egg weights in the groups. Administration of test compounds DES (Sigma Chemical Co., St Louis, MO, USA) was dissolved in dimethylsulfoxide (DMSO), and, on the day before treatment, the DMSO solutions were diluted with corn oil to appropriate concentrations for administration. Doses of DES were adjusted to 0 (vehicle alone, 1% DMSO in corn oil), 0.5, 5 and 50 ng/g of egg. On the day of treatment, eggs were Wled at the blunt end with an electric micro grinder to make a small hole in the eggshell but to leave the shell membrane untouched. Ten micro liters of test solution were injected into the yolk through the exposed shell membrane and egg white using a 25-gauge needle attached to a Hamilton syringe. After injection, each hole was sealed with melted paraYn wax. These operations were carried out in the morning between 9:00 and 11:00. Thirty successfully injected eggs were incubated at 37.8°C and 60% relative humidity with a turning cycle of once an hour. On day 10 of incubation, eggs from each group were checked for embryo viability. Handling of birds
Materials and methods Selection of fertilized eggs Experiments were performed with the approval of the Animal Ethics Committee in National Institute for Environmental Studies under the Act on Welfare and Management of Animals in Japan. Forty pairs of Brazilian brown male (Br, maintained in our laboratory) and white egg female (WE, originally from the Nippon Institute for Biological Science, Yamanashi, Japan, and maintained in our laboratory) Japanese quails from 10 to 30 weeks of age, which regularly produced 10 or more eggs of 9.5–11.5 g each per 2 week period, were prepared and maintained to supply the fertilized eggs used in this study. At least ten eggs produced by each pair before an egg collecting period were incubated and their fertility
123
Eggs were moved to hatching boxes in the same incubator on day 15 of incubation, and hatched chicks were collected at 9:00 on days 17 and 18. Br and WE quails possess the plumage color genes on the Z chromosome, and their F1 oVspring can be genetically sexed by their plumage color after hatching (Kamata et al. 2006a). Male chicks possess wild-color plumage, while females possess brown plumage. Seven female and seven male chicks, without apparent malformations, from each treatment group were randomly selected and moved to a brooder. The rest of the chicks were sacriWced and examined for gross morphological characteristics. Samples of the gonads were removed for analysis of gonadal gene expression and were kept at ¡80°C until analysis. Because the required number of chicks of both sexes for molecular biological studies was not achieved after selection from a single batch of raised chicks, a further administration experiment with dosages of
Arch Toxicol (2009) 83:161–171
1 and 10 ng/g was performed. Quails were raised in mixed sex groups for each treatment and fed a low-phytoestrogen commercial diet for chicks (PLD-CHICK, Oriental Yeast Co. Ltd., Chiba, Japan). They were kept at 38°C for the Wrst 5 days and 35°C for the next 5 days, and then divided according to sex and transferred to stainless steel cages at 30°C. After a gradual temperature reduction, quails at 5 weeks of age were individually moved to single stainless cages in a barrier-sustained room with controlled temperature (23 § 2°C), relative humidity (55 § 15%) and 14 h per day illumination (light from 7:00 to 21:00), and fed a low-phytoestrogen commercial diet for adult quails (PLD, Oriental Yeast). From 5 weeks of age the eggs laid by each female quail were collected and the number and weights of the eggs were noted. Male and female quails, at 5 and 10 weeks of age, respectively, were sacriWced between 9:00 and 11:00 in the morning following blood removal and they were necropsied for reproductive system morphology. Blood was taken from the jugular vein, and serum was collected after centrifugation at 4°C and kept at ¡80°C until being analyzed for steroid hormones. The livers, testes and oviducts were removed and weighed and oviduct lengths measured. Small pieces of the testis and the oviduct uterus and white follicle region of the ovary were also removed and frozen at ¡80°C prior to analysis for gene expression.
163
images of the eggshell were taken around the equator, and the thickness of the cuticular layer, palisade layer and mammillary layer of the eggshell were measured at 15 points per egg for three or four eggs laid by diVerent females in each treatment group. In addition, eggshell specimens were boiled in 5% NaOH to remove the cuticular layer and shell membrane, soaked in a 5% acidic surfactant solution and then washed in an ultrasonic cleaner to remove organic constituents. Scanning electron micrographs of both interior and exterior surfaces of the resultant specimens were observed. Gene expression
Collected eggs were kept at 23 § 2°C, relative humidity (55 § 15%), and once a week eggshell strength was measured as the fracture resistance of the shell (N) using a digital force gauge (CPU-9500, Aikoh engineering Co. Ltd., Gifu, Japan) and a vertical test stand wherein an egg was compressed at the equator between two stainless steel surfaces. After the measurement of shell strength, the egg was cut around its meridian, emptied and dried together with its shell membrane. The resultant eggshell was weighed, and the shell thickness was measured with a micrometer (BMD25DM, Mitutoyo Corporation, Kanagawa, Japan) at Wve points along the meridian: the blunt end of the egg, the midpoint of the blunt end and equator, the equator, the midpoint of the equator and sharp end of the egg and the sharp end.
Total RNA was extracted from chick gonads, ovaries, testes and uteri with a SV Total RNA Isolation System (Promega, Madison, WI, USA) to determine the amount of transcript from the genes, and the quantity was determined by spectrophotometry at 260 nm. One hundred nanograms total RNA with 0.5 g oligo dT15 primer in a Wnal volume of 25 l was reverse transcribed at 37°C for 60 min using MMLV Reverse Transcriptase (Promega), and the resultant cDNA was diluted 4 times with nuclease-free water. For ampliWcation of each target mRNA, 2 l of a diluted cDNA solution was ampliWed by GoTaq DNA Polymerase (Promega), together with 0.5 M each of the speciWc primer combinations described in Table 1 in a total volume of 50 l. The PCR conditions were an initial denaturing step at 94°C for 2 min, followed by 30–40 additional cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 30 s. All primers were designed so that they would anneal at 60°C, and the appropriate cycle number for each gene was determined within the linear range of ampliWcation by preliminary examinations. AmpliWcation products were subjected to electrophoresis in 2% agarose gel beside molecular weight markers (100 bp DNA Ladder, Promega) and stained with ethidium bromide. The densities of bands in the gels were analyzed using a ChemiGenius 2 imaging system (Syngene, Cambridge, UK), and the relative expression of each PCR product was quantiWed by normalization with the product of the -actin gene (ACTB) using GeneTools software (Syngene). Since the level of expression of ACTB in the same tissues was constant between treated birds, ACTB was used as an internal control.
Scanning electron microscopy
Blood biochemistry
Eggshell specimens were cut into pieces, mounted on aluminum stubs with double-sided stick tape, and coated for 120 s with platinum in an E-1010 ion sputter coater (Hitachi, Tokyo, Japan). The specimens were observed under a model S-4700 scanning electron microscope (Hitachi HighTechnologies, Tokyo, Japan) at 15 kV. Cross-sectional
Concentrations of serum steroids (E2, testosterone and progesterone) were spectrophotometrically determined using commercial EIA kits (Cayman Chemical Company, Ann Arbor, MI, USA) according to the instructions given. Serum calcium was spectrophotometrically determined using a Wako Calcium C kit (Wako Pure Chemical Indus-
Eggshell properties
123
164
Arch Toxicol (2009) 83:161–171
Table 1 Sequence of primers and conditions used for RT-PCR ampliWcation Gene
Tissue sample
Accession No.
F, forward primer
PCR product (bp)
Number of PCR cycle
288
30
177
35
170
35
491
35
437
35 (40)
409
35
111
35 (40)
392
35
495
35
433
35
451
35
392
35
501
35
469
35
R, reverse primer ACTB
All tissues
AB199913
F: GCCAACAGAGAGAAGATGAC R: CACAATTTCTCTCTCGGCTG
FSHR
Chick gonad, ovary and testis
AF113531
F: CCTTTGTGGTCATCTGCATC R: GAACCCTGAGTGAAGCTGAT
LHCGR
S75716
F: TCCCAGACTTGACGCAGAT
CYP11A1
AB281616
F: AGGTGAGCGAGGACTTTGTG
R: GCCAACAGAGAGAAGATGAC R: TTGCAGAGTCATGGAAGTCG CYP17A1
AB281617
F: CTGTGAGGGACCTGATGGAT
HSD3B1
AB281618
F: GACTGCTGGACAAAGCCTTC
R: CCACTCCTTCTCATCGTGGT R: GCCTTCAGCACAGATTCCTC CYP19A1
AF533667
F: TCCAGCAGGTTGAAAGGTAC R: GCTTTGCTTTAGACAGAGGG
ESR1
Chick gonad and Uterus
AF442965
F: TGCAACGACTATGCTTCAG R: GCACTGACCATCTGTTCTGC
ESR2
AF045149
F: AACATCGAGCCCAAGCTTG R: TCCGAATTACGATGGCGGC
AR
AB188828
F: GCAAGCACCTAAGATGGCC
PGR
AB265142
F: AAACCTGAAACACCAAGTTCC
R: CTGAAGCCACCCAAACTCC R: CAATGGCCTTCACCAGTTCT VDR
U12641
F: ATCACCAAGGACAACCGGC
CALB1
AB265141
F: CTTGTCTGATGGAGGGAAG
R: ATGGGCTCTGGGAATGCAC R: CGTGTGTAGTTGTAAGTGGG SPP1
AF239805
F: TGACACCGATGAGTCTGATG R: TTAACGGGTGACCTCATTGT
ACTB -actin, FSHR follicle-stimulating hormone receptor, LHCGR luteinizing hormone receptor, CYP11A1 cholesterol side chain cleavage, CYP17A1 steroid 17-hydroxylase/C17–20 lyase, HSD3B1 3-hydroxysteroid dehydrogenase, CYP19A1 aromatase P450, ESR1 estrogen receptor , ESR2 estrogen receptor , AR androgen receptor, PGR progesterone receptor, VDR vitamin D3 receptor, CALB1 calbindin D28 K, SPP1 osteopontin. The numbers of PCR cycles for CYP17A1 and CYP19A1 in chicks are shown in parentheses
tries, Ltd., Osaka, Japan) based on the o-cresolphthalein complexone color development method according to the instructions given. Each of these serum concentrations in each sex was performed in duplicate by one assay employing a 96-well microplate. Statistics Statistical analyses were performed with a SigmaStat for Windows version 3.1.1 (Systat Software, Inc., Richmond, CA, USA). One-way analysis of variance (ANOVA), twoway ANOVA or nested ANOVA was used to examine diVerences between control and treatment groups for each measured variable, followed by post hoc analysis using Fisher’s LSD or the Holm-Sidak method for signiWcance.
123
The signiWcances of the between-group diVerences for the various observed categories were determined using Chisquared and Fisher’s exact tests. Each male and female treatment group included six or seven quails because of the unexpected deaths of newborns, and the results are expressed as the mean § SEM. Statistical signiWcance is noted where P < 0.05.
Results Hatchability of fertilized eggs (85.0%) was higher than the lower limit of the Organisation for Economic Co-operation and Development (OECD) guideline (>70%) (OECD 2000) and was not signiWcantly aVected by in ovo treatment.
Arch Toxicol (2009) 83:161–171
Although unexpected deaths unrelated to treatment groups were observed within 2 weeks of hatching, the frequency was normal, and the survival rate of in ovo exposed hatchlings (92.3%) was within the limits of the guideline (>85%). The sex of sacriWced chicks predicted from their plumage color coincided exactly with observations of the appearance of the gonads, and no gross morphological diVerences in gonadal diVerentiation of the hatchlings were observed between any of the treated groups. Gene expression in newly hatched chicks As listed in Table 1, the expressions of genes coding for gonadotropin receptors, steroidogenic enzymes, steroid hormone receptors and calcium regulating factors in the chick gonads were analyzed. Although mRNAs of all the genes except the estrogen receptor (ESR2) were detected in the gonads from chicks of both sexes, only the cytochrome P450 side chain cleavage gene (CYP11A1) of male chicks showed signiWcant diVerences between the treatment groups. There was no diVerence at a dosage of 0.5 ng DES/ g of egg, but a drastic reduction in CYP11A1 expression was observed in a limited number of male chicks treated with 5 or 50 ng DES/g after selection of raised chicks (data not shown). Therefore a further administration experiment with 1 and 10 ng DES/g was added in order to attempt intermediate doses. The gene expression of CYP11A1 was strongly reduced at dosages of 1 ng DES/g of egg or more (Fig. 1).
165
(Table 2). Three of six females treated with 5 ng DES/g of egg or all of six females with 50 ng DES/g did not lay eggs. A single female in the control group and one in the 0.5 ng DES/g group stopped laying eggs within the observation period. Egg weight, eggshell strength, eggshell weight and shell thickness in each treatment group were averaged for the 2 weeks from 8 to 10 weeks of age, when the quality and quantity of eggs became uniform. Dosages of 0.5 and 5 ng DES/g signiWcantly reduced egg weight and eggshell strength. Eggshell thickness was also reduced by the 5 ng DES/g treatment (Table 3), and the values measured at three of Wve points along the meridian of eggs (mid-point of the blunt end and equator, the equator and the mid-point of the equator and sharp end) were signiWcantly diVerent from those of the controls. Ultrastructural characterization of the eggshell Three layers of the eggshell, in particular, the cuticular and mammillary layers, were thinned by in ovo DES treatment. The thicknesses of these layers in both 0.5 and 5 ng DES/g groups were signiWcantly lower than those of the control group (Fig. 2). Because the mammillary structure in the 5 ng DES/g group was notably altered and reduced in thickness, mammillary cones that were high enough to measure were employed for this analysis. In addition, although circular pore structures are normally observed on the exterior surface of the eggshell after the cuticular layer is removed, deformed pores and unexpected holes were found in both 0.5 and 5 ng DES/g groups (Fig. 3).
Egg production and eggshell formation Morphology Egg production and quality in female quails were observed from 5 weeks of age. Total egg production was reduced by in ovo DES treatment in a dose-dependent manner
Fig. 1 Semi-quantitative RT-PCR analysis of the mRNA levels of cholesterol side chain cleavage (CYP11A1) in the gonad from new hatched Japanese quail chicks exposed in ovo to diethylstilbestrol (DES). a Electrophoretic pattern of PCR products, b expression level
Body weight during the experimental period and liver weight at necropsy were unaVected by all treatments, and
of CYP11A1 relative to the vehicle control. Each value is presented as the mean § SEM. Asterisks indicate signiWcant diVerences from the vehicle control: *P < 0.05, **P < 0.005. ACTB -actin
123
166
Arch Toxicol (2009) 83:161–171
Table 2 Egg production and quality in female Japanese quails following in ovo exposure to diethylstilbestrol (DES) Treatment
First egg (days)
Egg production (n)
Egg weight (g)
Eggshell strength (N)
Eggshell weight (% of egg weight)
Control
47.2 § 5.1
20.7 § 5.7
10.46 § 0.10
10.41 § 0.35
7.25 § 0.09
0.5
44.6 § 3.1
16.9 § 3.2
9.49 § 0.09*
8.67 § 0.21*
7.34 § 0.05
5
51.0 § 6.8
8.0 § 4.0
8.94 § 0.10*
8.07 § 0.23*
7.13 § 0.08
50
ND
0
ND
ND
ND
DES (ng/g of egg)
First egg represents the age (days) when female quails produced their Wrst egg, and egg production is presented as the total of eggs laid by one female during an observation period of 5 weeks. Egg weight, eggshell strength and eggshell weight were averaged for females in each group for the 2 weeks from 8 to 10 weeks of age. Each value is presented as the mean § SEM ND not detectable because females treated with 50 ng DES/g of egg did not lay eggs * SigniWcantly diVerent (P < 0.01) from the vehicle control Table 3 Eggshell thickness of eggs laid by female Japanese quails following in ovo exposure to diethylstilbestrol (DES) Treatment
Eggshell thickness (mm) Blunt end
Blunt end—equator
Equator
Equator—sharp end
Sharp end
0.186 § 0.002
0.173 § 0.002
0.182 § 0.002
0.190 § 0.002
0.202 § 0.003
0.5
0.185 § 0.002
0.174 § 0.002
0.176 § 0.002
0.194 § 0.002
0.215 § 0.003**
5
0.179 § 0.003
0.164 § 0.002*
0.170 § 0.002*
0.183 § 0.003*
0.204 § 0.004
50
ND
ND
ND
ND
ND
Control DES (ng/g of egg)
Values for females in each group were averaged for the 2 weeks from 8 to 10 weeks of age. Each value is presented as the mean § SEM ND not detectable, because females treated with 50 ng DES/g of egg did not lay eggs Asterisks indicate signiWcant diVerences from the vehicle control: * P < 0.05, ** P < 0.01
Fig. 2 Ultrastructural changes in the eggshell from female Japanese quails following in ovo exposure to diethylstilbestrol (DES). a Scanning electron micrographs of the layered structure of the eggshell. The bar represents 50 m. b Thickness of each layer in the eggshell measured from the electron micrographs. Each value is presented as the mean § SEM. Asterisks indicate signiWcant diVerences from the vehicle control: *P < 0.05, **P < 0.01
123
Arch Toxicol (2009) 83:161–171
167
Fig. 3 Scanning electron micrographs of the exterior surface of the eggshell after the cuticular layer was removed. A circular pore is present on the surface of the eggshell from a Japanese quail female in the vehicle control (left upper picture). Deformed pores (arrows) and many unknown holes (right picture) can be seen on the eggshell from females exposed in ovo to diethylstilbestrol (DES). Each bar represents 20 m
Fig. 4 Shortening of the left oviduct and abnormal development of the right oviduct in adult female Japanese quails following in ovo exposure to diethylstilbestrol (DES). Each value is presented as the length of the left or right oviducts (the mean § SEM). Asterisks indicate signiWcant diVerences from the vehicle control: *P < 0.05, **P < 0.001. ND not detected
all male and female quails were normal in external morphology. In ovo exposure to DES shortened the length of the left oviduct at 10 weeks of age in a dose-dependent manner (Fig. 4). The lengths of the left oviducts of female quails
treated with 5 or 50 ng DES/g were signiWcantly less than those of the controls. Although only the left oviduct and not the right reproductive tract develops in normal birds, abnormal development of the right oviduct was observed in four of six and Wve of six females treated with 5 and 50 ng DES/g, respectively. Each right oviduct was attached to the cloaca but did not contain anything resembling an egg. Almost all females, including non-laying females treated with high doses of DES (with an exception in each of the 0.5 and 5 ng DES/g groups), had growing and mature follicles (yolk) in their ovaries. One female in each of the 5 and 50 ng DES/g groups had neither the right nor left reproductive tract, although vestiges of the reproductive tract could be seen. These females also had growing and mature follicles (yolk) in the ovary. In addition, one non-laying female in each of the 5 and 50 ng DES/g groups had material thought to be residual egg yolk in the abdominal cavity. DES exposure did not statistically inXuence testis weight at 5 weeks of age, and the gonad-somatic indices (GSI) of exposed males were not diVerent from those of controls (Table 4). However, changes in testis weight occurred asymmetrically, and the weight asymmetry of testis (left/ right) in quails treated with 50 ng DES/g was signiWcantly higher than that of the controls.
Table 4 Morphology of the testis in male Japanese quails exposed in ovo to diethylstilbestrol (DES) Treatment
GSI (%)
Left testis weight (% of body weight)
Right testis weight (% of body weight)
Testis asymmetry (left/right)
Control
1.93 § 0.27
1.03 § 0.18
0.90 § 0.10
1.12 § 0.11
0.5
2.20 § 0.12
1.16 § 0.08
1.04 § 0.05
1.11 § 0.05
5
2.13 § 0.22
1.17 § 0.14
0.96 § 0.08
1.20 § 0.05
50
1.98 § 0.32
1.32 § 0.22
0.66 § 0.11
2.00 § 0.13*
DES (ng/g of egg)
GSI gonad somatic index. Each value is presented as the mean § SEM * SigniWcantly diVerent (P < 0.005) from the vehicle control
123
168
Arch Toxicol (2009) 83:161–171
Blood biochemistry The average serum estradiol, testosterone, progesterone and calcium concentrations in both control and DES exposed quails are shown in Table 5. Only serum testosterone concentration in males treated with 50 ng DES/g increased signiWcantly compared with that in the controls, whereas serum progesterone in females treated with 0.5 ng DES/g decreased. Gene expression in adult quails The expressions of genes coding for gonadotropin receptors and steroidogenic enzymes in the ovary and testis, and steroid hormone receptors and calcium regulating factors in the oviduct uterus were analyzed (Table 1), and mRNAs of all the genes except ESR2 were detected in the respective tested tissues. The expression of all the genes except the calcium regulating factors osteopontin (SPP1) and calbindin D28 K (CALB1) was constant with exposure to DES (data not shown). The mRNAs for SPP1 and CALB1 were reduced by DES treatment in a dose-dependent manner, and signiWcant diVerences in both genes, compared with the control, were observed at doses of 50 ng DES/g (Fig. 5).
Discussion The most signiWcant eVects of transovarian exposure to the xenoestrogen were malformations and dysfunctions of the reproductive tract, as previously reported. Shortening of the left oviduct and abnormal development of the right
oviduct induced by DES and eventually depressed egg production and eggshell formation were highly coincident with the results of studies using other estrogenic substances (Berg et al. 2001, 2004; Halldin et al. 2002; Holm et al. 2006). Thus, our results supported their earlier hypothesis that a functional malformation in the shell gland and impairment of eggshell formation, induced by embryonic exposure to estrogenic substances, were the principal cause of avian reproductive disorder and population decline in organochlorine polluted areas. Eggshell thinning, one of the most characteristic eVects of xenoestrogens, was investigated in detail by ultrastructural and molecular biological analyses in an attempt to clarify its causal mechanism. Scanning electron microscopic images of the eggshell showed the mammillary layer containing the mammillary core (the starting point for crystallization of calcium carbonate in eggshell formation) and the proteinaceous, unmineralized cuticular layer, were not formed adequately in females treated with DES. Impairment of eggshell formation was also veriWed by changes in gene expression of calcium regulating factors. Suppressed expression of genes for CALB1 and SPP1 means that calcium mobilization in the eggshell gland does not function normally. Calbindin is a calcium binding protein and is thought to play a role in calcium transport in the eggshell gland as well as in the intestine. Although in the intestine the expression levels of CALB1 and its mRNA are vitamin D dependent, in the shell gland these expressions are vitamin D independent but partially E2 dependent and increase during shell formation (Corradino et al. 1993; Ieda et al. 1995; Bar et al. 1996). The coincidence of depressed gene expression of CALB1 and eggshell thinning observed here
Table 5 Serum steroid and calcium concentrations in adult male and female Japanese quails exposed in ovo to diethylstilbestrol (DES) Treatment
Estradiol (pg/ml)
Testosterone (pg/ml)
Progesterone (pg/ml)
Calcium(mg/dl)
441 § 90
21.0 § 1.5
Female (10 weeks of age) Control
358 § 99
192 § 85
0.5
145 § 42
46 § 12
119 § 17**
22.2 § 2.9
5
150 § 43
68 § 30
213 § 58
21.2 § 2.5
50
165 § 24
90 § 25
360 § 73
27.1 § 2.6
ND
685 § 186
29 § 5#
8.1 § 0.1
ND
640 § 170
48 § 16#
8.0 § 0.2
DES (ng/g of egg)
Male (5 weeks of age) Control DES (ng/g of egg) 0.5
#
8.6 § 0.2 8.5 § 0.3
5
ND
554 § 134
47 § 6
50
ND
1818 § 592*
86 § 46
Each value is presented as the mean § SEM above the lower limit of detection for used methods ND not detectable # Values from a few males, which were below the detection limit, were excluded Asterisks indicate signiWcant diVerences from the vehicle control: * P < 0.05, ** P < 0.01
123
Arch Toxicol (2009) 83:161–171
169
Fig. 5 Semi-quantitative RTPCR analysis of the osteopontin (SPP1) and calbindin D28 K (CALB1) mRNAs in the uterus from female Japanese quails following in ovo exposure to diethylstilbestrol (DES). The expression levels of the SPP1 and CALB1 are presented as values relative to the vehicle control. Each value is presented as the mean § SEM. Asterisks indicate signiWcant diVerences from the vehicle control: *P < 0.005, **P < 0.001. ACTB -actin
suggested that dysfunction of the shell gland associated with CALB1 could occur in birds exposed in ovo to xenoestrogen. However, there was no evidence that serum calcium and the vitamin D receptor were involved in this condition. Osteopontin is a phosphorylated glycoprotein present in extracellular Xuids, at sites of inXammation and in the extracellular matrix of mineralized tissues, and it is a multifunctional cytokine which plays many key roles in bone remodeling and in immune and inXammatory responses (Denhardt and Noda 1998; Denhardt et al. 2001). In the avian oviduct, SPP1 has been reported to locate in the ciliated epithelial cells of the isthmus and in the non-ciliated epithelial cells of the shell gland (Fernandez et al. 2003). In the eggshell, interestingly, SPP1 was localized in the core of the shell membrane Wbers, in the base of the mammillae and in the outermost part of the palisade layer. The localized presence of SPP1 was coincident with the origins of the mammillary and cuticular layers where marked thinning of eggshells from females treated with DES was observed in this study. The localization of this molecule at the starting and Wnishing points for eggshell calciWcation indicated that SPP1 could be an important part of the calciWcation mechanism in the isthmus and uterus. Therefore, depressed gene expression of SPP1 as was observed here may substantially control the thickness of the eggshell.
The timing of estrogenic exposure is likely to inXuence the eVects of xenoestrogens on the reproductive tracts. The impact of DES exposure prior to incubation on the morphology of the reproductive tracts and on egg production and shell formation observed here was somewhat diVerent from the outcomes of embryonic exposure. In our previous studies exposure to 5 ng DES/g of egg or more on 10 days of incubation caused more obvious impairment to eggshell formation than was observed in the present study, and most females treated with 50 ng DES/g laid eggs but the eggs completely lacked shells (Kamata et al. 2006a). In contrast, morphological abnormalities of the reproductive tracts were more pronounced when exposure was prior to incubation. The length of the left oviduct at dosages of 5 and 50 ng DES/g was 54.4 and 38.4%, respectively, of that of the control, by prior exposure in this study, but 87.4 and 65.2% by exposure on 10 days of incubation (Kamata et al. 2006a). The right oviduct also occurred more frequently as a result of prior exposure, whereas exposure to 5 ng DES/g at 10 days of incubation did not cause the development of a right oviduct. Thus, early exposure to estrogenic action is more likely to disrupt elongation of the reproductive tracts, but late exposure is more likely to impair development and/ or function of the eggshell gland. In addition, mature follicles (egg yolks) were observed in the ovaries of even nonlaying females exposed to higher dosages of DES, and
123
170
therefore, egg yolk formation in the ovary is likely to function normally. Because residual egg yolks were found in the abdominal cavities of females that did not lay eggs, there may be dysfunction of the infundibulum rather than defective ovulation of mature follicles. Compared with female birds, there were few apparent eVects of transovarian exposure to the xenoestrogen on males. The only detectable alteration in adult males was the weight asymmetry of the testes. Our previous studies showed that embryonic exposure to DES on 10 days of incubation reduced testis weight symmetrically at 10 weeks of age, but another investigation reported that ethinylestradiol exposure at 3 days of incubation signiWcantly increased testis weight asymmetry (Halldin et al. 1999). Xenoestrogen exposure before incubation might also make a diVerence to testis weight as birds grow, because male quails were sacriWced at 5 weeks of age in this study. Alternatively, diVerences in timing of estrogenic exposure might bring about changes in testis development; early exposure resulting in testis weight asymmetry, and late exposure in the reduction in weight of both testes. Clear evidence that hormonal conditions are involved in changes in the reproductive organs was not found in the present study. In adult quails serum steroid concentrations and gene expressions of gonadotropin receptors, steroidogenic enzymes and steroid hormone receptors were not aVected by in ovo DES exposure. It is unlikely that the eVects of a single injection of DES would persist until pubertal development; nevertheless, very small but critical changes during embryogenesis and/or the early development of hatchlings might occur in the reproductive organs and/or in the brain, and resulting structural and functional defects might eventually appear with sexual maturation. Embryonic exposure to an estrogen analog was reported to diminish male-type sexual behavior and to reduce the numbers of vasotocinergic Wbers in the preoptic nucleus, stria terminalis and lateral septum of the Japanese quail brain, showing features of sexual dimorphism, after sexual maturation (Panzica et al. 1998). Lasting impairment of such regions in the brain might dictate abnormal development and dysfunction of the reproductive organs. It has been reported that the mRNA level of CYP11A1 is reduced by administration of estrogen analogs in adult male animals (Sakaue et al. 2002). Together with reduction in the mRNA levels of other testicular steroidogenic enzymes, this change is thought to impair testosterone production and resultant testis function. Transovarian exposure was conWrmed to also reduce the CYP11A1 mRNA after hatching in the present study. Although mRNAs for the other enzymes were not substantially altered, crucial reduction in this enzyme is likely to cause depletion of the precursors of steroid hormones, which may lead to endocrine disruption and may aVect testis development.
123
Arch Toxicol (2009) 83:161–171
The research reported here has provided new insights into reproductive disorders caused by transovarian exposure to a xenoestrogen. In particular, vulnerable points in the mechanism of eggshell formation that could lead to thinning and candidates for the target agents are reported here for the Wrst time. This evidence is expected to contribute not only to knowledge of the toxicological mechanisms of eggshell thinning but also to an increased understanding of the physiology of shell formation. Since it is still unclear how estrogenic action during embryogenesis and/or early development leads to malformations and dysfunction of the reproductive organs, further investigation into the mechanisms of reproductive disruption including controls of sex diVerences, such as regulation of the hypothalamic–pituitary–gonadal axis and sexual dimorphism in brain regions, is required. Acknowledgments The authors thank Mr. Toshiaki Ito, Ms. Miho Yamasaki and Ms. Yoko Okada for skillful technical assistance. This work was supported in part by Grants-in-Aid for ScientiWc Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan (grant reference no. 18710030).
References Bar A, Vax E, Hunziker W, Halevy O, Striem S (1996) The role of gonadal hormones in gene expression of calbindin (Mr 28, 000) in the laying hen. Gen Comp Endocrinol 103:115–122 Berg C, Holm L, Brandt I, Brunström B (2001) Anatomical and histological changes in the oviducts of Japanese quail, Coturnix japonica, after embryonic exposure to ethynyloestradiol. Reproduction 121:155–165 Berg C, Blomqvist A, Holm L, Brandt I, Brunström B, Ridderstråle Y (2004) Embryonic exposure to oestrogen causes eggshell thinning and altered shell gland carbonic anhydrase expression in the domestic hen. Reproduction 128:455–461 Corradino RA, Smith CA, Krook LP, Fullmer CS (1993) Tissue-speciWc regulation of shell gland calbindin D28 K biosynthesis by estradiol in precociously matured, vitamin D-depleted chicks. Endocrinology 132:193–198 Denhardt DT, Noda M (1998) Osteopontin expression and function: role in bone remodeling. J Cell Biochem Suppl 30–31:92–102 Denhardt DT, Noda M, O’Regan AW, Pavlin D, Berman JS (2001) Osteopontin as a means to cope with environmental insults: regulation of inXammation, tissue remodeling, and cell survival. J Clin Invest 107:1055–1061 Fernandez MS, Escobar C, Lavelin I, Pines M, Arias JL (2003) Localization of osteopontin in oviduct tissue and eggshell during diVerent stages of the avian egg laying cycle. J Struct Biol 143:171– 180 Fry DM (1995) Reproductive eVects in birds exposed to pesticides and industrial chemicals. Environ Health Perspect 103(Suppl 7):165– 171 Halldin K, Berg C, Brandt I, Brunström B (1999) Sexual behavior in Japanese quail as a test end point for endocrine disruption: eVects of in ovo exposure to ethinylestradiol and diethylstilbestrol. Environ Health Perspect 107:861–866 Halldin K, Holm L, Ridderstråle Y, Brunström B (2002) Reproductive impairment in Japanese quail (Coturnix japonica) after in ovo exposure to o, p’-DDT. Arch Toxicol 77:116–122
Arch Toxicol (2009) 83:161–171 Holm L, Blomqvist A, Brandt I, Brunström B, Ridderstråle Y, Berg C (2006) Embryonic exposure to o, p’-DDT causes eggshell thinning and altered shell gland carbonic anhydrase expression in the domestic hen. Environ Toxicol Chem 25:2787–2793 Ieda T, Saito N, Ono T, Shimada K (1995) EVects of presence of an egg and calcium deposition in the shell gland on levels of messenger ribonucleic acid of CaBP-D28 K and of vitamin D3 receptor in the shell gland of the laying hen. Gen Comp Endocrinol 99:145–151 Kamata R, Takahashi S, Shimizu A, Morita M, Shiraishi F (2006a) In ovo exposure quail assay for risk assessment of endocrine disrupting chemicals. Arch Toxicol 80:857–867 Kamata R, Takahashi S, Shimizu A, Shiraishi F (2006b) Avian transgenerational reproductive toxicity test with in ovo exposure. Arch Toxicol 80:846–856
171 Newton I (1979) Population ecology of raptors. T&AD Poyser, Berkhamsted OECD (Organisation for Economic Co-operation and Development) (2000) Proposed draft OECD guideline for testing of chemicals: avian reproduction toxicity test in the Japanese quail or Northern bobwhite, Paris Panzica GC, Castagna C, Viglietti-Panzica C, Russo C, Tlemcani O, Balthazart J (1998) Organizational eVects of estrogens on brain vasotocin and sexual behavior in quail. J Neurobiol 37:684–699 Sakaue M, Ishimura R, Kurosawa S, Fukuzawa NH, Kurohmaru M, Hayashi Y, Tohyama C, Ohsako S (2002) Administration of estradiol-3-benzoate down-regulates the expression of testicular steroidogenic enzyme genes for testosterone production in the adult rat. J Vet Med Sci 64:107–113
123