Funct Integr Genomics DOI 10.1007/s10142-016-0534-8

ORIGINAL ARTICLE

Migration of endophytic diazotroph Azorhizobium caulinodans ORS571 inside wheat (Triticum aestivum L) and its effect on microRNAs Li Qiu 1 & Qiang Li 2 & Junbiao Zhang 2 & Yongchao Chen 2 & Xiaojun Lin 2 & Chao Sun 2 & Weiling Wang 2 & Huawei Liu 2 & Baohong Zhang 3

Received: 14 September 2016 / Revised: 30 October 2016 / Accepted: 1 November 2016 # Springer-Verlag Berlin Heidelberg 2016

Abstract Azorhizobium caulinodans ORS571, a novel rhizobium, forms endosymbionts with its nature host Sesbania rostrata, a semi-aquatic leguminous tree. Recent studies showed that A. caulinodans ORS571, as endophytic rhizobium, disseminated and colonized inside of cereal plants. However, how this rhizobium infects monocot plants and the regulatory mechanism remains unknown. MicroRNAs (miRNAs) are small, endogenous RNAs that regulate gene expression at the post-transcriptional levels. In this study, we employed laser scanning confocal microscope to monitor the pathway that rhizobium invade wheat; we also investigated the potential role of miRNAs during A. caulinodans ORS571 infecting wheat. Our results showed that gfp-labeled A. caulinodans ORS571 infected wheat root hairs and emerged lateral roots, then disseminated and colonized within roots and migrated to other plant tissues, such as stems and leaves. Endophytic rhizobium induced the aberrant expression of miRNAs in wheat with a tissue- and time-dependent manner with a peak at 12–24 h after rhizobium infection. Some miRNAs, such as miR167 and miR393 responded more in This article forms part of a special issue of Functional and Integrative Genomics entitled BmiRNA in model and complex organisms^ (Issue Editors: Hikmet Budak and Baohong Zhang) * Huawei Liu [email protected] * Baohong Zhang [email protected] 1

College of Veterinary Medicine, Northwest A & F University, Yangling 712100, Shaanxi, China

2

College of Life Sciences, Northwest A & F University, Yangling 712100, Shaanxi, China

3

Department of Biology, East Carolina University, Greenville, NC 27858, USA

roots than that in shoots. In contrast, miR171 responded higher in shoots than that in roots. These results suggested that miRNAs could be responsive to A. caulinodans ORS571 infection and played important role in plant growth, nutrient metabolisms, and wheat-rhizobium interactions. Keywords Azorhizobium caulinodans ORS571 . Dynamic colonization . Wheat . MicroRNA

Introduction Plant growth-promoting rhizobacteria (PGPR) is a class of soil bacteria which can stimulate plant growth through enhancing the supply and availability of primary nutrients to their host plants when they were infected. Depending on the colonization site in the host plant, PGPR can be categorized into two types: (1) rhizospheric PGPR and (2) endophytic PGPR. Rhizospheric PGPR may colonize the rhizosphere, the surface of the root, or even superficial intercellular spaces (McCully 2001; Bhattacharyya and Jha 2012; Gupta et al. 2015). Endophytic PGPR may colonize apoplastic spaces inside the host plant. Legume-rhizobium symbiosis is the best characterized endophytic relationships. There are several models for PGPR-enhancing plant usage of nutrients: (1) fixing N2 for their host, (2) increasing the availability of the rhizospheric nutrients, (3) inducing increases in root surface area, and (4) enhancing other beneficial symbiosis of the host (Peix et al. 2001; Vessey 2003; Grobelak et al. 2015; Goswami et al. 2016). Azorhizobium caulinodans ORS571 (A. caulinodans ORS571) is a microsymbiont of the water-tolerant tropical legume Sesbania rostrata (S. rostrata) (Dreyfus et al. 1988). N2-fixing nodules are formed on stems and roots of S. rostrata by A. caulinodans ORS571. Stem nodules are formed via crack entry at the site of adventitious root primordia located

Funct Integr Genomics

on the stems. Root nodules are formed at the site of curled root hairs under well-aerated conditions or at base of lateral roots under hydroponic condition (Goormachtig et al. 2004a). Bacteria proliferate in the epidermal fissures at the lateral root base or at the adventitious root primordia on the stems during invasion via crack (Goormachtig et al. 2004b). Cortical infection pockets are formed by Nod factordependent local cell death induction and subsequent colonization of bacteria (D’Haeze et al. 2003). From the infection pockets, infection threads guide bacteria towards the cells in nodule primordia for symbiotic uptake (D’Haeze et al. 1998). Although it was well studied that A. caulinodans ORS571 can infect leguminous plant S. rostrata, few study has been reported on the infection of A. caulinodans ORS571 on monocot plants. Recently, we found that A. caulinodans ORS571 treatment significantly increased seedlings root length and shoot height in wheat by 17.04 and 8.37%, respectively (Liu et al. 2012). However, how A. caulinodans ORS571 interacts with wheat and the regulatory molecular mechanism is unclear. MicroRNAs (miRNAs) are class of endogenous, non-coding RNAs. The majority of mature miRNAs are 21–24 nt in length and evolutionarily conversed in plants from moss to high flowering plants (Millar and Waterhouse 2005; Zhang et al. 2006a, 2006b; Nozawa et al. 2012; Budak and Akpinar 2015). miRNAs play indispensable role in regulating gene expression ranging from organ development to stress responses by degrading target mRNAs at the post-transcriptional process or by repressing target gene translation (Carrington and Ambros 2003; Zhang et al. 2006a, 2006b; Wang et al. 2007; Rajwanshi et al. 2014; Zhang 2015; Li and Zhang 2016). For instance, miR168 and miR403 play key role in miRNA biogenesis, modification, and function (Zhang et al. 2015). miR393 and miR398 play negative regulation role in plant to resist abiotic and biotic stress (Navarro et al. 2006; Jagadeeswaran et al. 2009; Xin et al. 2010; Chen et al. 2012; Feng et al. 2014; Alptekin et al. 2016). miR1507 has been identified only in legume species thus far, which is related to rhizobial symbiosis (Subramanian et al. 2008). miR156, miR159, miR160, miR164, miR167, and miR393 play indispensable role in plant growth and development (Guo et al. 2005; Nikovics et al. 2006; Vaucheret 2006; Sieber et al. 2007; Shukla et al. 2008; Chen 2009; Meng et al. 2010; Pluskota et al. 2011; Bian et al. 2012; Li and Zhang 2016). miR164, miR167, miR169, miR171, miR399, miR444, and miR827 are involved in plant primary nutrient metabolisms (Lin et al. 2008; Liu et al. 2010; Meng et al. 2010; Liang et al. 2012; Mantri et al. 2013; Hackenberg et al. 2013). In our previous study, there was significant promotion for wheat growth after infecting wheat seeds with A. caulinodans ORS571 (Liu et al. 2012), which suggested that miRNAs may play a vital role in the wheat-rhizobium interactions. To study this, in this study, we showed the dynamic colonization of gfplabeled A. caulinodans ORS571 (gfp-A. caulinodans ORS571) within wheat and the expression patterns of the above

mentioned 15 miRNAs that were involved in plant growth, primary nutrient metabolisms, and plant-rhizobium interactions.

Results Dynamic colonization of gfp-A. caulinodans ORS571 in wheat tissues In order to reveal the dynamic colonization of A. caulinodans ORS571 within wheat tissues, the axenic germinated wheat seedlings were inoculated with gfp-A. caulinodans ORS571. The laser scanning confocal microscope results showed that through the breakage of the root tip, gfp-A. caulinodans ORS571 gained entry into the root interior and spread to the intercellular spaces of the lateral roots and within epidermis cells in neighboring regions, at 6-day post inoculation (dpi) contained fluorescent green cells of gfp-A. caulinodans ORS571 colonized in root hairs (Fig. 1a) and around lateral root junctions (Fig. 1b). gfp-A. caulinodans ORS571 could distribute in root epidermis intercellular space (Fig. 1c) and within the root epidermis cells (Fig. 1d). gfp-A. caulinodans ORS571 could spread into vascular bundles in roots (Fig. 1e). By 21 dpi, gfp-A. caulinodans ORS571 disseminated upward via epidermis and vascular bundles of stems (Fig. 1f) to leaves (Fig. 1g, h). A. caulinodans ORS571 infection induced differential expression of miRNAs in wheat shoots and roots The expression level of 15 conserved miRNAs in both shoots and roots which determined at six different time stages post inoculation was investigated respectively by using qRT-PCR. All the 15 tested miRNAs were expressed in wheat seedlings, but their expression level varied from each other at different time points post-inoculation (Fig. 2). In wheat shoots, miR403 and miR171 were upregulated at 6-h post inoculation (hpi), miR171 and miR398 were upregulated at 72 and 96 hpi when other miRNAs were downregulated. At 24 hpi, only miR399 was downregulated compared with other miRNAs. But at 12 and 48 hpi, the miRNA expression levels were intricate; some miRNAs were upregulated while others were downregulated. In wheat roots, some miRNAs were upregulated while others were downregulated at 6, 24, and 48 hpi. At 12 hpi, only miR171 and miR399 were downregulated compared with other miRNAs. At 72 and 96 hpi, all the miRNAs were downregulated. The different expression pattern of miRNAs in wheat indicated that they may be involved in different infection stages and play different roles in wheat-rhizobium interactions. For each miRNA, the results showed that endophytic rhizobium induced miRNA expression progressively with a peak at 12–24 hpi after treatment according to the expression patterns (Fig. 3). miRNA expression was also tissue-dependent and it

Funct Integr Genomics

Funct Integr Genomics Fig. 1 The dynamic colonization of gfp-A. caulinodans ORS571 within wheat tissues. a gfp-A. caulinodans ORS571 distributed in root hairs. b gfp-A. caulinodans ORS571 distributed around lateral root junctions. c gfp-A. caulinodans ORS571 distributed in root epidermis intercellular space. d gfp-A. caulinodans ORS571 distributed within the root epidermis cells. e The cross section of the root, gfp-A. caulinodans ORS571 distributed in the root epidermis and vascular bundles. f gfpA. caulinodans ORS571 distributed in the epidermis and vascular bundles of stems. g, h gfp-A. caulinodans ORS571 distributed in leaves

seemed that roots were more sensitive to the rhizobium infection than that in shoots based on the miRNA expression patterns. In most case, roots responded to the rhizobium infection with a peak at around 12 hpi; however, shoots were delayed about 12 h. This phenomenon was not difficult to be understood, because the endophytic rhizobium directly infected roots instead of shoots. Some miRNAs, including miR167 and miR393 responded more in roots than that in shoots. In contrast, miR171 responded higher in shoots than that in roots. According to the expression patterns, the 15 tested miRNAs could be classified into three classes: (1) the miRNAs responded to A. caulinodans ORS571 infection at same way and miRNAs expressions were induced in both shoots and roots; the majority of tested miRNAs belongs to these class, including miR168, miR403, miR156, and miR160; (2) the

Shoot Root

1.0

miRNAs responded to A. caulinodans ORS571 infection at same way and miRNAs expressions were inhibited in both shoots and roots; this class of miRNAs included miR399; and (3) the miRNAs were differentially expressed in one tissue but not in another, such as miR164 was highly induced in roots but the expression level was not changed too much in shoots. Among all tested 15 miRNAs, miR398 responded to endophytic rhizobium infection most with a fold change of expression more than 4 in both shoots and roots. All these results suggested that these miRNAs could be responsive to A. caulinodans ORS571 infection and could be involved in rhizobiuminduced plant growth, metabolism of major nutrients, and wheat-rhizobium interactions.

Discussion Migration of endophytic diazotroph in non-leguminous plants Endophytic bacteria can infect non-leguminous plants via the wounds and natural openings (lateral root fissures, stomata, and stem lenticels) and colonize within the area of epidermal, 24h

12h

6h 4

0.0

-.5

Relative Expression

Relative Expression

2

1

2

1

0

0

-1 mi R1 mi 68 R4 mi 03 R1 mi 56 R1 mi 59 R1 mi 60 R1 mi 64 R1 mi 67 R1 mi 69 R1 mi 71 R3 mi 93 R3 mi 98 R3 mi 99 R4 mi 44 R mi 827 R1 50 7

miRNA

48h

72h Shoot Root

96h Shoot Root

2.0

4

miRNA

2 1

1.0 .5 0.0

0

-.5

-1

-1.0 mi R1 mi 68 R4 mi 03 R1 mi 56 R1 mi 59 R1 mi 60 R1 mi 64 R1 mi 67 R1 mi 69 R1 mi 71 R3 mi 93 R3 mi 98 R3 mi 99 R4 mi 44 R mi 827 R1 507

.5 Relative Expression

Relative Expression

1.5

3

Shoot Root

1.0

0.0

-.5

-1.0

-1.5

miRNA

Fig. 2 A. caulinodans ORS571 induced relative expression levels of 15 miRNAs in wheat. Fifteen miRNAs were extracted from the shoots and roots with inoculation of A. caulinodans ORS571 at different time points

miRNA

mi R1 mi 68 R4 mi 03 R1 mi 56 R1 mi 59 R1 mi 60 R1 mi 64 R1 mi 67 R1 mi 69 R1 mi 71 R3 mi 93 R3 mi 98 R3 mi 99 R4 mi 44 R mi 827 R1 507

mi R1 mi 68 R4 mi 03 R1 mi 56 R1 mi 59 R1 mi 60 R1 mi 64 R1 mi 67 R1 mi 69 R1 mi 71 R3 mi 93 R3 mi 98 R3 mi 99 R4 mi 44 R mi 827 R1 50 7

miRNA

5

mi R1 mi 68 R4 mi 03 R1 mi 56 R1 mi 59 R1 mi 60 R1 mi 64 R1 mi 67 R1 mi 69 R1 mi 71 R3 mi 93 R3 mi 98 R3 mi 99 R4 mi 44 R mi 827 R1 507

-1

-1.0

mi R1 mi 68 R4 mi 03 R1 mi 56 R1 mi 59 R1 mi 60 R1 mi 64 R1 mi 67 R1 mi 69 R1 mi 71 R3 mi 93 R3 mi 98 R3 mi 99 R4 mi 44 R mi 827 R1 507

Relative Expression

.5

Shoot Root

3

Shoot Root

3

Relative Expression

R

miRNA

(0, 6, 12, 24, 48, 72, and 96 hpi). The endogenous reference gene was β-tubulin. Non-infected seedlings grown under the same conditions were used as controls

Funct Integr Genomics miR168

miR403

3.0

3.0

Shoot Root

3.0 Shoot Root

2.0 1.5 1.0

2.0 1.5 1.0

0h

6h

12h

24h

48h

72h

0h

6h

12h

24h

48h

72h

Shoot Root

3 2

1.5 1.0

0.0 0h

6h

12h

24h

48h

72h

6h

12h

24h

48h

72h

0h

24h

48h

miR171

3.0

24h

48h

72h

2.0 1.5 1.0

1.5 1.0

.5

.5 0.0

96h

0h

6h

12h

24h

48h

72h

Treatment Time / h

miR393

miR398

96h

0h

1.0

3 2 1

0.0

0 12h

24h

48h

72h

6h

12h

miR444

24h

48h

72h

.8 .6 .4

0h

6h

.5

0.0 48h

Treatment Time / h

72h

96h

48h

72h

3.5

Shoot Root

96h

Shoot Root

3.0

Relative Expression

1.0

24h

miR1507

2.5

Relative Expression

1.5

12h

Treatment Time / h

miR827

2.0

24h

1.0

96h

3.0

12h

Shoot Root

Treatment Time / h

Shoot Root

96h

.2

Treatment Time / h

2.5

72h

0.0 0h

96h

48h

1.2

4

.5

24h

1.4

Shoot Root

Relative Expression

Relative Expression

1.5

12h

miR399

5

2.0

6h

Treatment Time / h

6

2.5

Shoot Root

2.0

0.0

Shoot Root

96h

2.5

Relative Expression

Relative Expression 12h

72h

3.0

Shoot Root

Treatment Time / h

3.0

6h

12h

miR169

0

0h

6h

miR167

1

6h

1

Treatment Time / h

2

0h

2

96h

2.5

6h

3

Treatment Time / h

3

96h

4

Treatment Time / h

Shoot Root

72h

0 0h

96h

4

0h

48h

Shoot Root

.5

0

24h

5

Shoot Root

2.0

1

12h

miR164

Relative Expression

4

6h

miR160

2.5

Relative Expression

5

0h

Treatment Time / h

3.0

6

96h

Treatment Time / h

miR159

Relative Expression

1.0

0.0

96h

Treatment Time / h

Relative Expression

1.5

.5

0.0

0.0

Relative Expression

2.0

.5

.5

Shoot Root

2.5

Relative Expression

2.5

Relative Expression

Relative Expression

2.5

Relative Expression

miR156

2.0 1.5 1.0

2.5 2.0 1.5 1.0

.5

.5

0.0

0.0 0h

6h

12h

24h

48h

Treatment Time / h

72h

96h

0h

6h

12h

24h

48h

Treatment Time / h

72h

96h

Funct Integr Genomics

R

Fig. 3 A. caulinodans ORS571 induced differential expression patterns of 15 miRNAs in wheat. Fifteen miRNAs were extracted from shoots and roots with inoculation of A. caulinodans ORS571 at different time points (0, 6, 12, 24, 48, 72, and 96 hpi). The endogenous reference gene was β-tubulin. Non-infected seedlings grown under the same conditions were used as controls. The normalized miRNA levels at 0 hpi were arbitrarily set to 1

cortical, and vascular root tissues to form small ecological habitats (Chi et al. 2005). In rice, gfp-labeled rhizobium can disseminate upward to aerenchyma and vascular tissue within leaf sheaths above the stem base and within leaves (Chi et al. 2005). Previous study revealed the colonization pattern of Azospirillum brasilense Yu62 on maize roots (Liu et al. 2003). In this study, laser scanning confocal micrographs indicated that wheat roots and rhizosphere played critical role in the infection process of gfp-A. caulinodans ORS571, which gained entry into root vascular tissues through fissures of lateral root junctions and root hairs and colonized within vascular tissues and intercellular spaces of the roots. We also found that gfp-A. caulinodans ORS571 could colonize in epidermis and vascular bundles of stems (Fig. 1f) and leaves (Fig. 1g, h), which suggested that rhizobium could migrate from roots upward to leaves within wheat. This result was consistent with previous studies on colonization pattern of rhizobium within non-leguminous plants (maize, rice, and tobacco) (Liu et al. 2003; Chi et al. 2005; Ji et al. 2010). miRNAs are involved in plant-microbe interactions Although studies have shown that certain miRNAs can be responsive to biotic and abotic stress in wheat (Xin et al. 2010; Feng et al. 2014), limited information was available for miRNAs responsive to A. caulinodans ORS571 infection. Investigating miRNAs involved in wheat-rhizobium interactions will gain a better understanding of miRNAs and their regulatory role, ideally leading to improve wheat growth and yield via inoculation of A. caulinodans ORS571. Comparing and analyzing the expression patterns of miRNAs in wheat inoculated and non-inoculated with A. caulinodans ORS571 showed that 15 conserved miRNAs had dynamic expression patterns and some miRNAs markedly changed in the expression levels, which demonstrated that these miRNAs may play regulatory role in wheat-rhizobium interactions. miRNA expression implicates beneficial plant-microbe interactions miR168 was found to be upregulated under pathogen stress in wheat and Populus (Xin et al. 2010; Chen et al. 2012). miR393 was upregulated in pathogen attack, and the antibacterial resistance was enhanced via overexpression of miR393 in Arabidopsis (Navarro et al. 2006). In this study, miR168

expression level was about twofold of CK in both shoots and roots at 12 hpi. miR393 expression level was about 2.3-fold of CK in roots at 12 hpi, and expression level was about 1.6-fold of CK in shoots at 24 hpi. The results suggested that miRNAs play critical regulatory role in beneficial plant-microbe interactions as which in plant-pathogen interactions. miR398 was found to defend against ROS in plant during the pathogen infection (Jagadeeswaran et al. 2009). ROS burst also played crucial role in the early step of nodule and infection thread organogensis during legume-rhizobium symbiosis (D’Haeze et al. 1998; Santos et al. 2001; Soto et al. 2006; Chang et al. 2009; Damiani et al. 2016; Montiel et al. 2016). miR1507 might be a legume-specific miRNA family thus far, which related to rhizobial symbiosis (Subramanian et al. 2008). In this study, miR398 has a fold change of expression more than 4 in roots at 12 hpi and in shoots at 48 hpi. miR1507 expression level was about threefold of control in shoots at 24 hpi, which suggested that A. caulinodans ORS571 also induced ROS burst in wheat as common infection weapons like plant-pathogenic bacteria (Soto et al. 2006). The results further implied that wheat may have the potential to form symbiosis with A. caulinodans ORS571 as its native legume host. miRNA expression implicates simulative plant growth and development miR160 was related to many hormone-responsive gene expression changes and produced malformation (Shukla et al. 2008). miR164 was transiently induced by auxin, and overexpression of miR164 in Arabidopsis affected the development of roots, stems, leaves, and other tissues (Guo et al. 2005; Nikovics et al. 2006; Sieber et al. 2007; Chen 2009; Li and Zhang 2016). miR167 regulated growth of lateral roots (Vaucheret 2006; Meng et al. 2010; Li and Zhang 2016). Overexpression of miR393 also led to root development change obviously, such as primary root elongation, more adventitious roots, and more tillers (Bian et al. 2012; Xia et al. 2012; Li and Zhang 2016). In this study, miR160, miR164, and miR167 expression level was about 2.4-fold, 4.1-fold, and 2.8-fold, respectively, of CK in roots at 12 hpi. But there were no significant differences between treatment and CK in shoots of miR160, miR164, and miR167. miR393 had higher expression in roots than that in shoots from 6 to 48 hpi. The results suggested that A. caulinodans ORS571, as PGPR may lead to form more lateral roots and more tillers in wheat, which were in accordance with our previous studies (Liu et al. 2012; Liu et al. 2013). miR156, miR159, and miR160 were involved in seed germination. miR159 and miR160 played a major role before germination of radicles by regulating hormones sensitivity. On the contrary, miR156 played a major role after germination of radicles (Pluskota et al. 2011). In this study, the expression level of miR156, miR159, and miR160 were about 2.2-fold, 4.3-fold, and 2.4-fold, respectively, of CK in roots at 12 hpi. The results

Funct Integr Genomics

suggested that inoculation A. caulinodans ORS571 may enhance activity of seed germination and promote the growth of wheat seedling.

miRNA expression implicates enhanced primary nutrient metabolisms miR164 and miR167 were also associated with N signal (Meng et al. 2010). miR169 and miR171 were downregulated when N was deficient (Liang et al. 2012; Mantri et al. 2013). In this study, miR164, miR167, and miR169 had the highest expression level in roots at 12 hpi. However, miR171 had the highest expression level in shoots at 24 hpi. The results suggested that inoculation A. caulinodans ORS571 may enhance wheat N uptake on half-strength Hoagland’s No. 1 plant growth medium. miR399 was related with induction of low phosphorus, which can increase P uptake in plant (Lin et al. 2008; Liu et al. 2010; Hackenberg et al. 2013). The expression of miR399 could not be detected under normal P uptake circumstances. Overexpression of miR399 could result in phosphorus accumulation even under high phosphate conditions (Fujii et al. 2005; Bari et al. 2006; Mallory and Vaucheret 2006; Chiou 2007; Meng et al. 2010). miR827 was also upregulated under low phosphate conditions (Meng et al. 2010; Hackenberg et al. 2013). In this study, miR399 expression level was only about 0.21-fold of CK in roots at 24 hpi. The reason was that in half-strength Hoagland’s No. 1 plant growth medium containing 0.5 mmol/L KH2PO4, the P was under sufficient condition. The expression of miR399 was dramatically downregulated, which indicated that P uptake and transport of wheat were significantly enhanced via inoculation A. caulinodans ORS571. The expression pattern of miR827 was opposite to miR399 due to the fact that miR827 may have other functions except responding to low phosphate condition in plant. In summary, gfp-A. caulinodans ORS571 could colonize dynamically within wheat, which can migrate from roots upwards to leaves. The inoculated plants showed better growth conditions compared to the control, which were accorded with our previous studies. Endophytic rhizobium-induced miRNAs were dynamically expressed with a tissue- and time-dependent manner in wheat with a peak at 12–24 hpi, which were involved in plant growth, primary nutrient metabolisms, and plantrhizobium interactions. The results will help to elucidate the molecular mechanism of wheat-rhizobium interactions. Because some miRNAs, such as miR156 and miR171, have multiple family members and also have more than one target, the molecular mechanism of miRNAs involved in wheat-rhizobium interactions needs further research.

Materials and methods Bacteria and plasmid gfp-A. caulinodans ORS571, in which pHC60 (gfp plasmid vector) was transfered to wild-type A. caulinodans ORS571 via the triparental mating method (Chi et al. 2005), was kindly provided by the Jing lab of the Institute of Botany, Chinese Academy of Sciences.

Plant culture and treatment Wheat (Triticum aestivum L.), hexaploid gramineous crops, is the most widely cultivated in the world. Seeds of wheat (T. aestivum L.) cv. Xiaoyan 22 were surface sterilized with 70% ethanol for 1 min followed by 1% NaClO for 10 min, and then washed three times with sterile water to completely remove the NaClO. Surface-sterilized seeds were germinated on water-agar medium in dark for 2 days at 28 °C. Then, 30 healthy wheat seedlings were transferred into sterilized 1 L flask containing 300 mL sterilized quartz sand and 80 mL half-strength Hoagland’s No. 1 plant growth medium. gfp-A. caulinodans ORS571 were cultured for 2 days at 28 °C in TY liquid medium and then suspended in phosphate-buffered saline (PBS, pH 7.4) to 108 cells/mL. A total of 30 mL gfp-A. caulinodans ORS571 was gently introduced into the wheat seedling rhizosphere by a pipette tip inserting about 1.0 cm below the quartz sand. The infected wheat were incubated in a growth chamber at 25 °C for 16 h photoperiod with light Table 1

Primers used in qRT-PCR for amplifying 15 miRNAs

Name of primers

Primer sequence (5′-3′)

miR168 miR403 miR156 miR159 miR160 miR164 miR167 miR169 miR171 miR393

ATCGCTTGGTGCAGATCG GCTTGTTTTTGTGCGTGCTC CGCTGACAGAAGAGAGTGAGCAC TTTGGATTGAAGGGAGCTCTG GATATGCGTGCAAGGAGCC TATGGAGAAGCAGGGCACG TGAAGCTGCCAGCATGATCTG CAGCCAAGGATGACTTGCC CGCTGGTATTGTTTCGGCTC TTCCAAAGGGATCGCATTG

miR398 miR399 miR444 miR827 miR1507 β-tubulin-1 β-tubulin-2 Uni-primer

GCTAGTGTTCTCAGGTCGCC GATGCCAAAGGAGAATTGCC TGCAGTTGCTGCCTCAAGC GCGTTAGATGACCATCAGCAAAC CTCGTTCCGTAATACATCATCTCG GGACCGTACGGGCAGATCT CACCAGACTGCCCAAACACA ACGTCGTATCGTCATCTGACC

Funct Integr Genomics

intensity of 10,000 lx and at 18 °C for 8 h dark. Non-infected seedlings grown under the same conditions were used as controls. Shoots and roots were harvested at 0, 6, 12, 24, 48, 72, and 96 hpi, respectively, and then frozen immediately in the liquid nitrogen, and stored at −80 °C.

Authors’ contributions HL and BZ were the principal investigators and took primary responsibility for the paper. HL, BZ, and LQ conceived and designed the experiments. LQ, QL, JZ, YC, XL, CS, and WW performed the experiments. LQ, QL, JZ, and YC analyzed the data. HL, BZ, QL, JZ, and YC wrote the paper and prepared figures. All the authors read and approved the final manuscript.

Observing gfp-A. caulinodans ORS571 using laser scanning confocal microscopy

Compliance with ethical standards

gfp-A. caulinodans ORS571 produced a sufficiently bright fluorescent signal which could be detected by laser scanning confocal microscope. Wheat shoots and roots were excised from plants and thoroughly washed to remove any potential bacteria from the external surfaces. The shoots and roots were cut into small pieces and then the sections were mounted on slides. A Nikon A1R laser confocal microscope with 488 and 561 nm band-pass filters was used to capture the green fluorescence from gfp-A. caulinodans ORS571 and the red autofluorescence from the host tissue, respectively. The images were acquired and then analyzed using NIS Viewer 3.20 (Nikon, Tokyo, Japan). Total RNA extraction, reverse transcription, and miRNA quantification Total RNAs were isolated from the frozen shoots and roots respectively by using TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instruction. Reverse transcription was performed using One Step PrimeScript® miRNA cDNA synthesis kit (TaKaRa, Dalian, China). The first strand cDNAwas reversely transcribed with 4 μg total RNAs, 10 μL 2× miRNA reaction buffer mix, 2 μL 0.1% BSA, 2 μL miRNA PrimeScript® RT enzyme mix, and then added RNase-free ddH2O up to 20 μL. We chose miR#a as the mature miRNA for an individual miRNA family. To analyze the expression profile of mature miRNAs, quantitative real-time PCR (qRT-PCR) was used with SYBR® Premix Ex TaqTM II (TaKaRa, Dalian, China). qRT-PCR was performed on CFX96 real-time PCR system (Bio-RAD, Hercules, CA, USA) for each miRNA with three technical and biological replicates. A total 25 μL reaction system was containing 12.5 μL SYBR Premix Ex Taq II, 2 μL cDNAs, 1 μL forward primer (Table 1), 1 μL reverse primer (Table 1, Uni-Primer), and 8.5 μL ddH2O. The PCR mixtures were preheated at 95 °C for 5 min, followed by 40 cycles of amplification (95 °C for 5 s, 60 °C for 30 s). All reactions chose βtubulin as the reference gene. Non-infected seedlings grown under the same conditions were used as controls. The results of the qRT-PCR were analyzed using the 2−△△Ct method. Acknowledgements We thank Professor Yuxiang Jing for presenting the gfp-A. caulinodans ORS571. This work was partially supported by the Agricultural Key Science and Technology Program of Shaanxi Province (2015NY006), the International Cooperation and Exchanges Project of Shaanxi Province (2015KW-028), and the National Natural Science Foundation of China (31071870, 30700489).

Competing interests The authors declare that they have no competing interests.

References Alptekin B, Langridge P, Budak H (2016) Abiotic stress miRNomes in the Triticeae. Funct Integr Genomics doi:10.1007/s10142-016-0525-9 Bari R, Datt Pant B, Stitt M, Scheible WR (2006) PHO2, microRNA399, and PHR1 define a phosphate-signaling pathway in plants. Plant Physiol 141:988–999 Bhattacharyya PN, Jha DK (2012) Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World J Microbiol Biotechnol 28:1327–1350 Bian H, Xie Y, Guo F, Han N, Ma S, Zeng Z, Wang J, Yang Y, Zhu M (2012) Distinctive expression patterns and roles of the miRNA393/TIR1 homolog module in regulating flag leaf inclination and primary and crown root growth in rice (Oryza sativa). New Phytol 196:149–161 Budak H, Akpinar BA (2015) Plant miRNAs: biogenesis, organization and origins. Funct Integr Genomics 15:523–531 Carrington JC, Ambros V (2003) Role of microRNAs in plant and animal development. Science 301:336–338 Chang C, Damiani I, Puppo A, Frendo P (2009) Redox changes during the legume–Rhizobium symbiosis. Mol Plant 2:370–377 Chen L, Ren Y, Zhang Y, Xu J, Zhang Z, Wang Y (2012) Genome-wide profiling of novel and conserved Populus microRNAs involved in pathogen stress response by deep sequencing. Planta 235:873–883 Chen X (2009) Small RNAs and their roles in plant development. Annu Rev Cell Dev Biol 25:21–44 Chi F, Shen SH, Cheng HP, Jing YX, Yanni YG, Dazzo FB (2005) Ascending migration of endophytic rhizobia, from roots to leaves, inside rice plants and assessment of benefits to rice growth physiology. Appl Environ Microb 71:7271–7278 Chiou TJ (2007) The role of microRNAs in sensing nutrient stress. Plant Cell Environ 30:323–332 Damiani I, Pauly N, Puppo A, Brouquisse R, Boscari A (2016) Reactive oxygen species and nitric oxide control early steps of the legume– rhizobium symbiotic interaction. Front Plant Sci 7:454 D’Haeze W, Gao M, De Rycke R, Montagu MV, Engler G, Holsters M (1998) Roles for azorhizobial Nod factors and surface polysaccharides in intercellular invasion and nodule penetration, respectively. Mol Plant Microbe In 11:999–1008 D’Haeze W, De Rycke R, Mathis R, Goormachtig S, Pagnotta S, Verplancke C, Capoen W, Holsters M (2003) Reactive oxygen species and ethylene play a positive role in lateral root base nodulation of a semiaquatic legume. Proc Natl Acad Sci USA 100:11789–11794 Dreyfus B, Garcia JL, Gillis M (1988) Characterization of Azorhizobium caulinodans gen. nov., sp. nov., a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata. Int J Syst Evol Microbiol 38:89–98 Feng H, Duan X, Zhang Q, Li X, Wang B, Huang L, Wang X, Kang Z (2014) The target gene of tae-miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates resistance of wheat to stripe rust. Mol Plant Pathol 15:284–296

Funct Integr Genomics Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK (2005) A miRNA involved in phosphate-starvation response in Arabidopsis. Curr Biol 15:2038–2043 Goormachtig S, Capoen W, Holsters M (2004a) Rhizobium infection: lessons from the versatile nodulation behaviour of water-tolerant legumes. Trends Plant Sci 9:518–522 Goormachtig S. Capoen W, James EK, Holsters M (2004b) Switch from intracellular to intercellular invasion during water stress-tolerant legume nodulation. Proc Natl Acad Sci USA 101:6303–6308 Goswami D, Thakker JN, Dhandhukia PC (2016) Portraying mechanics of plant growth promoting rhizobacteria (PGPR): a review. Cogent Food Agr 2:1127500 Grobelak A, Napora A, Kacprzak M (2015) Using plant growthpromoting rhizobacteria (PGPR) to improve plant growth. Ecol Eng 84:22–28 Guo HS, Xie Q, Fei JF, Chua NH (2005) MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell 17: 1376–1386 Gupta G, Parihar SS, Ahirwar NK, Snehi SK, Singh V (2015) Plant growth promoting rhizobacteria (PGPR): current and future prospects for development of sustainable agriculture. J Microb Biochem Technol 7:96–102 Hackenberg M, Shi BJ, Gustafson P, Langridge P (2013) Characterization of phosphorus-regulated miR399 and miR827 and their isomirs in barley under phosphorus-sufficient and phosphorus-deficient conditions. BMC Plant Biol 13:214 Jagadeeswaran G, Saini A, Sunkar R (2009) Biotic and abiotic stress down-regulate miR398 expression in Arabidopsis. Planta 229: 1009–1014 Ji KX, Chi F, Yang MF, Shen SH, Jing YX, Dazzo FB, Cheng HP (2010) Movement of rhizobia inside tobacco and lifestyle alternation from endophytes to free-living rhizobia on leaves. J Microbiol Biotechnol 20:238–244 Li C, Zhang B (2016) MicroRNAs in control of plant development. J Cell Physiol 231:303–313 Liang G, He H, Yu D (2012) Identification of nitrogen starvationresponsive microRNAs in Arabidopsis thaliana. PLoS One 7:e48951 Lin SI, Chiang SF, Lin WY, Chen JW, Tseng CY, Wu PC, Chiou TJ (2008) Regulatory network of microRNA399 and PHO2 by systemic signaling. Plant Physiol 147:732–746 Liu HW, Sun C, Yang H, Lin XJ, Guo AG (2012) Promotion for wheat growth and root colonization after infecting wheat seeds with Azorhizobium caulinodans. Plant Nutr Fert Sci 18:210–217 (in Chinese) Liu HW, Lin XJ, Sun C, Li Q, Yang H, Guo AG (2013) Inoculation two azotobacter enhancing osmotic stress resistance and growth in wheat seedling. Chin J Plant Ecol 37:70–79 (in Chinese) Liu JQ, AllanD L, Vance CP (2010) Systemic signaling and local sensing of phosphate in common bean: cross-talk between photosynthate and microRNA399. Mol Plant 3:428–437 Liu Y, Chen SF, Li JL (2003) Colonization pattern of Azospirillum brasilense Yu62 on maize roots. Acta Bot Sin 45:748–752 Mallory AC, Vaucheret H (2006) Functions of microRNAs and related small RNAs in plants. Nat Genet 38:S31–S36 Mantri N, Basker N, Ford R, Pang E, Pardeshi V (2013) The role of micro-ribonucleic acids in legumes with a focus on abiotic stress response. Plant Genome 6:1–14 McCully ME (2001) Niches for bacterial endophytes in crop plants: a plant biologist’s view. Aust J Plant Physiol 28:983–990 Meng Y, Ma X, Chen D, Wu P, Chen M (2010) MicroRNA-mediated signaling involved in plant root development. Biochem Biophys Res Commun 393:345–349

Montiel J, Arthikala MK, Cárdenas L, Quinto C (2016) Legume NADPH oxidases have crucial roles at different stages of nodulation. Int J Mol Sci 17:680 Millar AA, Waterhouse PM (2005) Plant and animal microRNAs: similarities and differences. Funct Integr Genomics 5:129–135 Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones JD (2006) A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312:436–439 Nikovics K, Blein T, Peaucelle A, Ishida T, Morin H, Aida M, Laufs P (2006) The balance between the MIR164A and CUC2 genes controls leaf margin serration in Arabidopsis. Plant Cell 18:2929–2945 Nozawa M, Miura S, Nei M (2012) Origins and evolution of microRNA genes in plant species. Genome Biol Evol 4:230–239 Peix A, Rivas-Boyero AA, Mateos PF, Rodriguez-Barrueco C, MartinezMolina E, Velazquez E (2001) Growth promotion of chickpea and barley by a phosphate solubilizing strain of Mesorhizobium mediterraneum under growth chamber conditions. Soil Biol Biochem 33:103–110 Pluskota WE, Martínez-Andújar C, Martin RC, Nonogaki H (2011) MicroRNA function in seed biology, in non coding RNAs in plants. Springer 339–357 Rajwanshi R, Chakraborty S, Jayanandi K, Deb B, Lightfoot DA (2014) Orthologous plant microRNAs: microregulators with great potential for improving stress tolerance in plants. Theor Appl Genet 127: 2525–2543 Santos R, Hérouart D, Sigaud S, Touati D, Puppo A (2001) Oxidative burst in alfalfa-Sinorhizobium meliloti symbiotic interaction. Mol Plant Microbe In 14:86–89 Shukla LI, Chinnusamy V, Sunkar R (2008) The role of microRNAs and other endogenous small RNAs in plant stress responses. BBA-Gene Regul Mech 1779:743–748 Sieber P, Wellmer F, Gheyselinck J, Riechmann JL, Meyerowitz EM (2007) Redundancy and specialization among plant microRNAs: role of the MIR164 family in developmental robustness. Development 134:1051–1060 Soto MJ, Sanjuán J, Olivares J (2006) Rhizobia and plant-pathogenic bacteria: common infection weapons. Microbiology 152:3167–3174 Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O (2008) Novel and nodulation-regulated microRNAs in soybean roots. BMC Genomics 9:160 Vaucheret H (2006) Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Dev 20:759–771 Vessey JK (2003) Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 255:571–586 Wang WX, Gaffney B, Hunt AG, Tang G (2007) MicroRNAs (miRNAs) and plant development. eLS Xia K, Wang R, Ou X, Fang Z, Tian C, Duan J, Wang Y, Zhang M (2012) OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers, early flowering and less tolerance to salt and drought in rice. PLoS One 7:e30039 Xin M, Wang Y, Yao Y, Xie C, Peng H, Ni Z, Sun Q (2010) Diverse set of microRNAs are responsive to powdery mildew infection and heat stress in wheat (Triticum aestivum L.). BMC Plant Biol 10:123 Zhang BH (2015) MicroRNA: a new target for improving plant tolerance to abiotic stress. J Exp Bot 66:1749–1761 Zhang BH, Pan XP, Cobb GP, Anderson TA (2006a) Plant microRNA: a small regulatory molecule with big impact. Dev Biol 289:3–16 Zhang BH, Pan XP, Cox SB, Cobb GP, Anderson TA (2006b) Evidence that miRNAs are different from other RNAs. Cell Mol Life Sci 63: 246–254 Zhang C, Xian Z, Huang W, Li Z (2015) Evidence for the biological function of miR403 in tomato development. Sci Hortic 197:619–626