Photosynth Res (2013) 115:81–87 DOI 10.1007/s11120-013-9835-0

TECHNICAL COMMUNICATION

Monitoring foreign gene incorporation into the plastome of Chlamydomonas reinhardtii by multiplex qPCR Eric A. Johnson

Received: 11 July 2012 / Accepted: 23 April 2013 / Published online: 7 May 2013 Ó Springer Science+Business Media Dordrecht 2013

Abstract The genetic material of the Chlamydomonas reinhardtii chloroplast can be easily manipulated and creation of transgenic plastomes is of interest for both photosynthetic research and for biofuel and biomass production. Because multiple copies of the chloroplast genome are present, it is important to understand whether, following the introduction of a foreign gene, the resulting transgenic plastome is homoplasmic or heteroplasmic. By quantitative PCR together with a simple DNA extraction procedure and a series of DNA oligonucleotides the following protocol will determine the extent of foreign gene incorporation into a host chloroplast plastome. This approach is used to follow the degree of heteroplasmy following biolistic transformation of several transgenic strains. The approach used is quick, simple to set up, and gives an accurate quantitation of foreign genes within of the chloroplast plastome. Possible future uses of the technique are discussed. Keywords Chlamydomonas  qPCR  Plastome  Transgenic  Chloroplast  Algae Abbreviations 56-FAM 50 6-Carboxyfluorescein 5HEX 50 -Hexachlorofluorescein 3IABkFQ 30 -Iowa Black fluorescent quencher TAP Tris-actetate-phosphate media ZEN IDT proprietary internal fluorescence quencher

This work was supported by a subcontract from the Department of Energy Fuel Cell Technologies Program (ZFT-9-99333). E. A. Johnson (&) Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218-2685, USA e-mail: [email protected]

Introduction The unicellular green alga Chlamydomonas reinhardtii is a powerful eukaryotic model organism for photosynthetic research in part because it contains a single, cup-shaped chloroplast that occupies over 70 % of its cell volume (Harris 2001). The chloroplast, a plastid found in eukaryotic photosynthetic organisms, probably evolved from an ancient endosymbiotic cyanobacterium (Cavalier-Smith 2000; Raven and Allen 2003) and as a result of this heredity it possess a small autonomous genome (plastome) that is polypoidic and capable of homologous recombination. Chloroplast genetics and plastome engineering are of particular interest for applications in biotechnology; (Day and Goldschmidt-Clermont 2011) homologous recombination allows precise gene placement (Boynton et al. 1988), plastids lack gene silencing or RNA interference (De Cosa et al. 2001), and plastomes are capable of stably incorporating large, polycistronic segments of foreign DNA (QuesadaVargas et al. 2005). A key advance in the stable transformation of the chloroplast genome was the development of markers for the selection of transformed organisms with much of the seminal work performed in C. reinhardtii (Boynton et al. 1988). Available selectable markers can either utilize a mutation incorporated into an existing chloroplast gene (Kindle et al. 1991) or a cassette of foreign DNA inserted into the plastome (Goldschmidt-Clermont 1991). Due to plastome polyploidy, transplastomic strains may be heteroplasmic (containing both transgenic and native versions) (Nishimura and Stern 2010; Shen et al. 2010). Natural heteroplasmy has also been identified numerous times in chloroplasts (Frey 1999) and specifically the chloroplast of C. reinhardtii (Bolen et al. 1980; Spreitzer and Chastain 1987). Maintenance of heteroplasmy and the genetic replication mechanism of the chloroplast are the

123

82

subjects of current research (Wolfe and Randle 2004; Azhagiri and Maliga 2007). Confirmation of homoplasmy, or identification of heteroplasmy, has traditionally been performed by either end-point PCR or Southern blotting of plastid DNA extracts. Quantitative PCR is a rapidly developing technology that is quick, sensitive, and convenient, and is increasingly used in the characterization of transgenic plant species (Bubner and Baldwin 2004) including the chloroplast (Ruiz et al. 2011). The experiments described in this paper use a simplified procedure, where the relative number of transgenic plastome copies within a specific sample is assessed using a simple gene counting procedure. Transgenic samples are compared to standardized plasmid DNA containing a fixed ratio of foreign and native genes. Relative foreign gene incorporation can therefore be determined in whole cell extracts requiring minimal purification of host DNA. Southern blots and growth on selective media are used to validate these results. Potential benefits of quantitating heteroplasmy in algal transplastomic analysis are discussed. Cell culture and transformations Strain CC125 was obtained from the Chlamydomonas Resource Center (University of Minnesota). This and all subsequent strains were maintained on TAP agar plates under low (*5 lmol photons/m2 s) light (Harris 2001). When appropriate the TAP agar was supplemented with 50 lg/ml spectinomycin and 50 lg/ml streptomycin. Liquid cultures were grown in 10 ml TAP media under low light with constant mixing. All cultures were maintained at 20 °C. Chloroplast transformations were performed by biolistic transformation using a PDS-1000He device (BioRad) and gold microparticles coated with appropriate DNA according to manufacturer’s protocol (SeaShell Technologies). Plasmid construction The plasmid pUCb-wt was constructed from the plasmid pUCatpB-wt previously constructed in this laboratory (Johnson et al. 2007). In brief, the pUCatpB-wt plasmid was linearized using the restriction enzyme, PflMI, which cuts at a unique site within the plasmid. This cut site is within a fragment of C. reinhardtii chloroplast DNA surrounding the atpB gene and corresponds to basepair 158,715, according to established numbering (Maul et al. 2002). The aadA cassette was amplified from the plasmid pUCatpX (Goldschmidt-Clermont 1991) (acquired from the Chlamydomonas Resource Center) using the forward and reverse primers GGCCAATTCAGTTACTGTTATC GATGACTTTATTAGAGGCAGTG and GGCCAATT CAGTAACTGATCGCACTCTACCGATTGAG, respectively. These primers insert cut sites for the restriction

123

Photosynth Res (2013) 115:81–87

enzyme AlwNI on either side of the cassette, and when digested with this enzyme the resulting fragment has compatible ends with the PflMI-digested pUCatpB-wt plasmid. The two fragments were then ligated together to make pUCb-wt. The plasmid pUCe-wt has been described previously (Johnson 2008) and the plasmid pORF472::aadA (Fischer et al. 1996) was a gift from Dr. Kevin Redding. Southern blotting Samples of C. reinhardtii strains were used to inoculate a 10 ml culture of liquid TAP media supplemented with 50 lg/ml spectinomycin. Well-aerated cultures were grown under low light to a cell density of approximately 2 9 106 cells/ml. Cells were sedimented at 2,0009g for 5 min at 20 °C. DNA was purified from these cells by phenol extraction (Hoffman and Winston 1987). Purified DNA was then digested overnight at 37 °C using either EcoNI (pUCe-wt transformants) or EcoRI (for pORF472::aadA transformants). The digested DNA was then purified through an enzyme clean-up column (Qiagen) and stored at -20 °C until use. Approximately 250 ng of DNA was separated per well using a 0.7 % agarose gel and then transferred to a HyBond XL nylon membrane. The membrane was hybridized with biotinylated probes made from either the EcoNI fragment of pUCe-wt plasmid or the EcoRI fragment from the pORF472::aadA plasmid, using manufacturers protocols (NEB). Biotinylated bands were visualized using chemiluminescence (NEB). Culture sampling and qPCR Oligonucleotides used for PCR priming and probes in this work are listed in Table 1. One set of oligonucleotides, or assay, was designed to detect the atpB gene and another set was designed to detect the bacterial aadA gene. The two assays were run in multiplex to reduce the number of tubes and limits variation between samples. The pUCb-wt plasmid used as a standard in these experiments was linearized to minimize any supercoiling of the plasmid DNA that might interfere with proper amplification of the PCR product (Hou et al. 2010). Linearized pUCb-wt between 106 and 103 copies was used to calculate the efficiency (Pfaffl 2001; Vandesompele et al. 2002) for each assay during each experiment. The averaged efficiencies for the assays in multiplex are shown in Table 1. Strains of C. reinhardtii growing on TAP agar were sampled using clean, sterile toothpicks and resuspended in 20 ll of sterile water (approximately 106 cells/ml), then mixed with 20 ll of pure ethanol. 200 ll of a 5 % solution of Chelex resin in sterile water was added to the suspension and the entire mixture heated to 98 °C for 10 min followed

Photosynth Res (2013) 115:81–87

83

Table 1 Primers and probes. Oligonucleotides designed using the realtime PCR software (IDT) Assay

Sequence

Amplicon size

Efficiency%

150

94.8 ± 3.5

139

94.3 ± 1.9

aadA Forward primer

GGTTATCGCCGAAGTATCAACTC

Probe

/56-FAM/CGCTCGATG/ZEN/ACGCC AACTACCTC/3IABkFQ/

Reverse primer

CACCGTAACCAGCAAATCAATATC

atpB Forward primer

CCTTTTAGCTCCATACCGTCG

Probe

/5HEX/ACCAGCACC/ZEN/ACCGAA AAGACCAAT/3IABkFQ/

Reverse primer

CACCAACACCAGCAAATACAG

Efficiencies of each assay calculated based upon the methods of Pfaffl and Vandesompele and averaged over nine multiplexed experiments

by immediate cooling to 4 °C. The Chelex resin was sedimented by centrifugation at 14,0009g for 10 min at 4 °C. The resulting supernatant was then used immediately for PCR, using a CFX9000 thermocycler (BioRad). PCR oligonucleotides (Table 1) were manufactured by Integrated DNA Technologies (New Jersey, USA) and were designed for the bacterial aadA gene (Genbank AFA52987.1) and the C. reinhardtii chloroplast atpB gene (Genbank FJ436947.1). The forward and reverse primers were delivered in the desalted state while the internal probes were purified by reverse-phase HPLC. Using a 96-well plate (Bio-Rad) each well contained 1 9 SsoFast Probes master mix (BioRad), 0.5 lM each forward and reverse primer, 0.25 lM each labeled probe, and 2 ll the supernatant from the heated strain sample, so that the final volume is equal to 25 ll. The instrument was then brought to 95 °C for 3 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The data were analyzed using the CFX Manager software. All data shown are the average of triplicate wells on the same plate for each sample. Triplicate variation of the calculated incorporation rarely exceeded 8 % of the average value.

gene inserted within a different fragment of chloroplastic DNA from C. reinhardtii (Fig. 1). Plasmid A (pUCb-wt) placed the aadA gene near the atpB gene and was used as standardized DNA because it contains a single copy of both the foreign and native gene. The aadA gene, via plasmid B (pUCe-wt) or plasmid C (pORF472::aadA), was inserted into the chloroplast of C. reinhardtii using biolistic gene delivery. Following the growth of colonies on antibiotic-

Results and discussion This procedure compares relative copy numbers between genes both native and foreign to the chloroplast. For these experiments, the atpB gene coding for the chloroplast ATP synthase b subunit was selected as the native gene, while the bacterial aadA gene (a common selective marker for genetic engineering of the chloroplast (Goldschmidt-Clermont 1991)) was used as the foreign gene. The DNA sequences for the primers and probes used to detect these genes are listed in Table 1 along the amplicon size and efficiencies for these assays. Three independent plasmids were used for this procedure, each with the bacterial aadA

Fig. 1 Diagram of the chloroplast plastome. Plasmids derived from chloroplast DNA shown, but sizes are not to scale. In each plasmid, a white box shows the approximate location of the foreign aadA gene. Plasmid A is pUCb-wt containing chloroplast DNA surrounding the atpB gene. Plasmid B is pUCe-wt containing chloroplast DNA surrounding the atpE gene. Plamsid C is pORF472::aadA containing chloroplast DNA surrounding the rpoC2 gene. Exact sequence of each plasmid is available in published literature(Fischer et al. 1996; Johnson, Rosenberg et al. 2007; Johnson 2008)

123

84

media, potential transformants were sampled by qPCR for the incorporation of the aadA gene within their plastome. Analysis by qPCR results in a value for the quantitative cycle (Cq) of the reaction that is directly related to the quantity of the starting material. The relative quantity (DCq) of gene target is determined by relating the Cq of the sample to the Cq of a control sample while compensating for the efficiency (E) of the oligonucleotides used for the qPCR, calculated by E raised to the power of (CqcontrolCqsample). The normalized copy count (DDCq) is then calculated as the ratio of the DCq of the foreign gene to the DCq of gene native to the chloroplast plastome. The incorporation of the foreign gene into the host plastome is equivalent to the value of DDCq, with a value of 1 for 100 % incorporation of the foreign gene. The plastome of C. reinhardtii can be readily transformed by homologous recombination with the plasmid pUCe-wt (Johnson 2008) resulting in a transgenic chloroplast genome that contains a single copy of the aadA gene adjacent to the atpE gene (Fig. 1). The Southern blot shown in Fig. 2a, shows a distinct shift in the chloroplast genomic DNA fragment that surrounds the atpE gene present only in the transgenic e(wt) strain. In addition, no evidence is seen for the native fragment in this strain, showing the e(wt) strain to be homoplasmic for the transgenic chloroplast plastome. This means that each copy of the chloroplast genome in the e(wt) strain contains one copy of the aadA gene and one copy of the native atpB gene. Samples of either strain CC125 or e(wt) were amplified with the aadA and atpB assays in a multiplex reaction. While the target for the atpB assay was detected in both samples, the aadA assay failed to produce a fluorescent signal in the CC125 sample. The aadA assay was able to amplify a PCR fragment in the e(wt) sample (Table 2), thus both Southern blot analysis and qPCR show that the e(wt) strain is transgenic and homoplasmic. In the following experiments, e(wt) was used as the positive control strain, with the assumption that the level of aadA present in this strain was in parity with the atpB gene in the chloroplast genome. In contrast to pUCe-wt, the plasmid pORF472::aadA has been shown to induce heteroplasmy in the chloroplast of C. reinhardtii (Goldschmidt-Clermont 1991). The pORF472::aadA plasmid contains a portion of the rpoC2 chloroplast gene with a central fragment deleted and the aadA gene inserted at that location. The rpoC2 gene is essential to cell viability, so transgenic strains must maintain a heteroplasmic chloroplast containing both the transgenic and native forms of the plastome to maintain functional rpoC2 gene product for cell survival. Following biolistic transformation and selection, transgenic strains were recovered that both were resistant to antibiotic and viable, suggesting the presence of

123

Photosynth Res (2013) 115:81–87

Fig. 2 Southern blot of restriction fragment length polymorphisms within strains of C. reinhardtii. N (native) denotes the predicted size of the fragment in native plastome, T (transgenic) denotes the predicted size of the same fragment following insertion of the aadA cassette. a Strains CC125 and e(wt) digested with EcoNI and probed with the biotinylated EcoNI fragment from pUCe-wt. The native fragment is approximately 3.3 kbp, while the transgenic fragment is 5.2 kbp. b DNA from colonies transformed with pORF472::aadA digested with EcoRI and probed with the biotinylated EcoRI fragment from pORF472::aadA. The native fragment is approximately 1.4 kbp, while the transgenic fragment is 3.1 kbp. Fragment sizes estimated based upon published chloroplast and plasmid sequences and verified by co-migration with 1 kb plus DNA ladder (Life Technologies)

heteroplasmic chloroplasts. Figure 2b shows the results of Southern blot analysis of four individual colonies following transformation. All four substrains show the presence of a larger fragment of the chloroplast plastome than found in the native genome, suggesting the presence of the aadA gene within the chloroplast. However, all four substrains also showed the persistent presence of the native plastome fragment, showing that the chloroplast remains heteroplasmic. Multiplex qPCR detected the foreign gene within the host plastome of the four substrains (Table 2), with all substrains having a DDCq value of less than 1, also suggesting heteroplasmy. Both Fig. 2b and Table 2 show the predominance of the transgenic plastome (darker upper band in Fig. 2b and the DDCq greater than 0.5 in Table 2) in the substrains. Table 2 suggests a relative equivalence in heteroplasmy between substrains, while Fig. 2b shows substrain d having slightly less native plastome. The pORF472::aadA is also notable for its ‘‘recycling’’ ability within the chloroplast (Fischer et al. 1996). When grown without antibiotic in the media, strains transformed with the pORF472::aadA plasmid will purge the foreign gene from the chloroplast, resulting in strains that are once again homoplasmic in the native plastome. To follow this transition from heteroplasmic to homoplasmic, the substrains were sampled and a small amount (approximately 1,000 cells in 5 ll per passage) dotted onto fresh TAP agar with or without antibiotic and allowed to grow for approximately 12 days. These were then sampled, assayed

Photosynth Res (2013) 115:81–87

85

Table 2 Calculation of incorporation of aadA gene following transformation of CC125 strain (passage 0) Strain

AadA replicates

DCq aadA

AtpB replicates

DCq atpB

DDCq

Cq

Cq

Cq

Cq

Cq

Cq

Std 103

27.86

27.36

27.96

28.56

27.97

28.25

Std 104

24.20

24.15

24.00

24.69

24.54

24.33

Std 105

20.79

20.82

20.30

21.19

21.27

20.81

6

Std 10

17.18

17.08

17.12

17.74

17.59

17.57

CC125

ND

ND

ND

20.37

20.36

20.44

ND ± ND

1.26 ± 0.04

ND ± ND

Substrain a

19.32

19.30

19.47

19.14

19.15

19.22

1.95 ± 0.12

2.80 ± 0.09

0.70 ± 0.05

Substrain b Substrain c

20.36 18.95

20.78 19.13

20.28 19.09

20.22 19.15

20.39 19.17

20.2 19.22

0.95 ± 0.16 2.38 ± 0.15

1.36 ± 0.09 2.78 ± 0.08

0.69 ± 0.13 0.85 ± 0.06

Substrain d

18.44

18.43

18.42

18.36

18.38

18.38

3.58 ± 0.07

4.70 ± 0.12

0.76 ± 0.02

e(wt)

20.32

20.28

20.57

20.71

20.75

20.77

1.00 ± 0.10

1.00 ± 0.02

1.00 ± 0.10

Substrains a,b,c, and d transformed with pORF472::aadA plasmid, e(wt) transformed with pUCe-wt plasmid. Replicates performed in three independent wells from the same sample. Equations for calculation of DCq and DDCq given in text. The value for DDCq represents the relative amount of the aadA gene to the atpB gene, thus gives the degree of incorporation of the aadA gene into the strain. Cq values for different concentrations (copies per well) of the linearized standard plasmid (pUCb-wt) are shown for comparison

by multiplex qPCR for the incorporation of the aadA gene, and then passed onto fresh agar. The process was repeated for a total of eight passages. During each analysis a sample of the e(wt) strain was treated identically to the substrains and also tested. Figure 3 shows the results of eight passages onto both antibiotic-supplemented and antibiotic-free media. The use of the e(wt) control (dotted line in Fig. 3a) also shows the long-term precision of this qPCR measurement, since this strain is homoplasmic and does not vary its aadA content from one passage to the next. Over the course of eight passages, the e(wt) strain gave an average aadA incorporation of 99 % with a standard deviation of 10 %.

When the substrains were maintained on TAP agar supplemented with antibiotic, the level of aadA incorporation varied between passages but stayed similar to the original value. Transfer of the substrain to antibiotic-free media resulted in the progressive loss of the aadA gene from the plastome. Following each passage, strains from the antibiotic-free plates were passed back to antibioticsupplemented plates to test for antibiotic sensitivity (Fig. 4). Following loss of detection of the aadA gene by the multiplex qPCR procedure, each strain regains sensitivity and failed to grow on antibiotic-supplemented media. It should be noted that substrain d did not lose detectable levels of aadA even after eight passages, and it also did not

Fig. 3 Incorporation of the foreign aadA gene within the host plastome of several strains. Open diamonds represent the control e(wt) strain maintained on TAP agar. Solid squares represents transgenic strains maintained on antibiotic-supplemented media. Solid triangles represent the transgenic strains maintained on antibiotic-free

media, however when Cq for the aadA gene falls below the level of detection of the assay (103 total copies), a solid circle is shown (no exact value is possible). Once detection of any aadA gene is lost, an open circle is shown

123

86

Photosynth Res (2013) 115:81–87

Fig. 4 Dot-blots of transgenic substrains onto antibiotic TAP media. Following growth on antibiotic-free TAP media, samples of each strain were transferred to TAP media supplemented with 50 lg/ml spectinomycin and 50 lg/ml streptomycin to test for antibiotic sensitivity. As an example, the cultures shown in the passage four

column had been passed four times onto antibiotic-free media (approximately 12 days per passage) then passed back onto supplemented media, allowed to grow approximately 12 days and documented. Final column shows strains maintained on supplemented media throughout the experiment

show regained antibiotic sensitivity. It is unclear why this substrain failed to completely purge its transgenic plastome. Use of multiplex qPCR to assess heteroplasmy of the chloroplast takes approximately 2 h from the initial sampling of a culture until a calculation of heteroplasmy is achieved. This calculation is far faster than the results achieved using Southern blotting and does not require equilibration of DNA concentration between samples. However this approach requires an oligonucleotide assay with sufficient efficiency (an E value between 90 and 100 %) for use in this protocol, and while design of oligonucleotides is straightforward, it may require several attempts before optimal conditions are found. Once assays are available for a gene, this technique provides a powerful tool for analysis of plastome heteroplasmy. This technique may be of particular interest in understanding what factors influence the initial degree of heteroplasmy, and what factors can be used to effectively push a chloroplast toward homoplasmy from a heteroplasmic state. It may also be a useful technique for understanding the nature of heteroplasmy, or in tracking plastome transference during cell mating. The rapid DNA sampling also makes this technique useful for screening colonies following genetic transformation, allowing rapid quantitation of foreign gene incorporation, especially when coupled to emerging techniques such as digital PCR (Hindson et al. 2011). Analysis of heteroplasmy using a simple, rapid multiplexed PCR approach provides another powerful tool for chloroplast research.

Acknowledgments The pORF472::aadA plasmid was provided by Dr. Kevin Redding. This work was supported through the Department of Energy Fuel Cell Technologies Program under subcontract ZFT-999333-01.

123

References Azhagiri AK, Maliga P (2007) Exceptional paternal inheritance of plastids in Arabidopsis suggests that low-frequency leakage of plastids via pollen may be universal in plants. Plant J 52(5):817–823 Bolen PL, Gillham NW, Boynton JE (1980) Evidence for persistence of chloroplast markers in the heteroplasmic state in Chlamydomonas reinhardtii. Curr Genet 2(2):159–167 Boynton JE, Gillham NW, Harris EH, Hosler JP, Johnson AM, Jones AR, Randolph-Anderson BL, Robertson D, Klein TM, Shark KB, Sanford JC (1988) Chloroplast transformation in Chlamydomonas with high velocity microprojectiles. Science 240(4858):1534–1538 Bubner B, Baldwin IT (2004) Use of real-time PCR for determining copy number and zygosity in transgenic plants. Plant Cell Rep 23(5):263–271 Cavalier-Smith T (2000) Membrane heredity and early chloroplast evolution. Trends Plant Sci 5(4):174–182 Day A, Goldschmidt-Clermont M (2011) The chloroplast transformation toolbox: selectable markers and marker removal. Plant Biotechnol J 9(5):540–553 De Cosa B, Moar W, Lee SB, Miller M, Daniell H (2001) Overexpression of the Bt cry2Aa2 operon in chloroplasts leads to formation of insecticidal crystals. Nat Biotechnol 19(1):71–74 Fischer N, Stampacchia O, Redding K, Rochaix JD (1996) Selectable marker recycling in the chloroplast. Mol Gen Genet 251(3):373–380 Frey JE (1999) Genetic flexibility of plant chloroplasts. Nature 398(6723):115–116

Photosynth Res (2013) 115:81–87 Goldschmidt-Clermont M (1991) Transgenic expression of aminoglycoside adenine transferase in the chloroplast: a selectable marker of site-directed transformation of chlamydomonas. Nucleic Acids Res 19(15):4083–4089 Harris EH (2001) Chlamydomonas as a model organism. Annu Rev Plant Physiol Plant Mol Biol 52:363–406 Hindson BJ, Ness KD, Masquelier DA et al (2011) High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal Chem 83(22):8604–8610 Hoffman CS, Winston F (1987) A 10-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57(2–3):267–272 Hou YB, Zhang H, Miranda L, Lin SJ (2010) Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene. PLoS ONE 5(3):e9545 Johnson EA (2008) Altered expression of the chloroplast ATP synthase through site-directed mutagenesis in Chlamydomonas reinhardtii. Photosynth Res 96(2):153–162 Johnson EA, Rosenberg J, McCarty RE (2007) Expression by Chlamydomonas reinhardtii of a chloroplast ATP synthase with polyhistidine-tagged beta subunits. Biochim Biophys ActaBioenergetics 1767(5):374–380 Kindle KL, Richards KL, Stern DB (1991) Engineering the chloroplast genome: techniques and capabilities for chloroplast transformation in Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 88(5):1721–1725 Maul JE, Lilly JW, Cui L, dePamphilis CW, Miller W, Harris EH, Stern DB (2002) The Chlamydomonas reinhardtii plastid chromosome: islands of genes in a sea of repeats. Plant Cell 14(11):2659–2679 Nishimura Y, Stern DB (2010) Differential replication of two chloroplast genome forms in heteroplasmic Chlamydomonas reinhardtii gametes contributes to alternative inheritance patterns. Genetics 185(4):U1161–1167

87 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res 29(9):e45 Quesada-Vargas T, Ruiz ON, Daniell H (2005) Characterization of heterologous multigene operons in transgenic chloroplasts: transcription, processing, and translation. Plant Physiol 138(3):1746–1762 Raven JA, Allen JF (2003) Genomics and chloroplast evolution: What did cyanobacteria do for plants? Genome Biol 4(3):293–300 Ruiz ON, Alvarez D, Torres C, Roman L, Daniell H (2011) Metallothionein expression in chloroplasts enhances mercury accumulation and phytoremediation capability. Plant Biotechnol J 9(5):609–617 Shen HF, Qian BJ, Yang LT, Liang WQ, Chen WW, Liu ZH, Zhang DB (2010) Estimation of the homoplasmy degree for transplastomic tobacco using quantitative real-time PCR. Eur Food Res Technol 231(1):143–150 Spreitzer RJ, Chastain CJ (1987) Heteroplasmic suppression of an amber mutation in the Chlamydomonas chloroplast gene that encodes the large subunit of ribulosebisphosphate carboxylase oxygenase. Curr Genet 11(8):611–616 Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3(7):0034.1–0034.11 Wolfe AD, Randle CP (2004) Recombination, heteroplasmy, haplotype polymorphism, and paralogy in plastid genes: implications for plant molecular systematics. Syst Bot 29(4):1011–1020

123