Anat Embryol (1994) 190:389-398

Anatomyand

Embryology

9 Springer-Verlag 1994

Parcellation of cortical areas by in situ hybridization for somatostatin mRNA in the adult rat: frontal, parietal, occipital, and temporal regions B. Garrett 1, B. Finsen 2, A. Wree 1 1Institute of Anatomy, Medical Faculty,Universityof Rostock, D-18055 Rostock, Germany 2 Department of Anatomy and Cytology,Institute of Medical Biology,Universityof Odense, DK-5000 Odense C, Denmark Accepted: 22 April 1994

Abstract. The expression of somatostatin mRNA within the neocortex of the rat was examined by in situ hybridization with an alkaline phosphatase-labeled probe. We sought to determine whether parcellation of the neocortex could be based upon the number and laminar location of the hybridized cells. Our investigation demonstrated that the boundaries of the neocortical areas can be determined by the distribution pattern of neurons expressing somatostatin mRNA. Few hybridized cells were located within layer IV, and this sparsity of cells within their wide granular layer marked the primary sensory areas. The occipital region was stratified, with insensely labeled cells in layers II/III and VI and faintly labeled cells in layer V. The parietal region carried a similar stratification, but more space between intensely labeled cells in layers III and V and between layers V and VI gave the region a three-tiered appearance. The temporal region displayed intensely labeled cells dispersed throughout layers III and VI and many in layer V as well as those faintly labeled without any breaks between the laminae. The distribution of the cells hybridized for somatostatin mRNA formed two configurations within the frontal region. It was difficult to identify any lamination in the first area, whereas the second area demonstrated a stratification reminiscent of the parietal region, but with only two tiers. The conclusion of the investigation is that in situ hybridization for somatostatin mRNA provides an exceptional means by which the areal boundaries within the neocortex may be drawn. Key words: Neuropeptides -Visual cortex - Somatosensory cortex Auditory cortex Rat

son 1985; Zilles and Wree 1985). The histology reveals differential distribution of somata and/or fibers within the neocortex, and thereby, the demarcation of the cortical areas. In particular, the primary sensory areas that form the anatomical correlates of physiologically responsive sensory cortices are easily recognized. However, the location of the boundaries between secondary sensory and association cortices can be rather elusive. To compound the problem, relative size of cortical areas, and thus, the placement of the areal boundaries, can vary between individual animals and between left and right hemispheres of the brain. Areal deliminations are amenable to other types of cytoarchitectonic labeling, and these procedures may be employed to clarify boundaries that are not obvious by traditional methods (Zilles et al. 1990). Descriptions of cells immunoreactive to somatostatin in the rat have not defined the neocortical areas via the laminar configuration of somatostatinergic neurons in the rat neocortex (McDonald et al. 1982; Hendry et al. 1984; Laemle and Feldman 1985; Vincent etal. 1985; Mizukawa etal. 1987). Studies employing in situ hybridization of somatostatin mRNA (Fitzpatrick-McElligott et al. 1988, 1991; Naus et al. 1988; Kiyama and Emson 1990; Priestley et al. 1991) have been general in description and have explicitly or implicitly regarded the cortex as homogeneous in the distribution of neurons with somatostatin mRNA expression. Taking advantage of the excellent single cell definition provided by alkaline phosphatase-labeled probes (Jablonski et al. 1986; Finsen et al. 1992), the aim of the present study is to point out the areal distinctions apparent whenever somatostatin is labeled by in situ hybridization within the rat neocortex. A preliminary report has been published in abstract form (Wree et al. 1992).

Introduction Traditionally, cytoarchitectural areas in the rat neocortex have been delineated by Nissl, myelin or acetylcholinesterase histology (Krieg 1946; Paxinos and WatCorrespondence to: A. Wree

Materials and methods Animal treatment

The animals were handled and processed under the guidelinesprovided by the Ethics Committee of the Medical Facultyat the Uni-

390 versity of Aarhus. Five adult Wistar rats were deeply anesthetized with Nembutal, and then perfused transcardially for 4 min with 0.5 1 of 4% paraformaldehyde in 0.15 M Sorensen's phosphate buffer, pH 7.3. After postfixation for an additional 2 h, the brains were cut into 50-lam-thick coronal sections on an Oxford Vibratome. The sections were sampled in 2 x sodium citrate when hybridized immediately after sectioning, or in a polyvinol pyrrolidon cryoprotective solution, and stored at - 14~ C until the time of hybridization. The hybridization signal is known to deteriorate if stored for long periods. Therefore, we held the maximum storage time to 1 week, and the average time was less than 2 days.

In situ hybridization Probe. The probe used was directed against 30 bases of preprosomatostatin mRNA molecule encoding amino acids 2-11 of the mature somatostatin 14 (SS-14). The sequence was 5"GAATGTCTTCCAGAAGAAGTTCTTGCAGCC (Goodman et al. 1983; Tavianini et al. 1984). The probe (NEP803, Dupont and DNA technology, DK) was directly labeled with alkaline phosphatase (AP, Jablonski et al. 1986). Hybridization. Prior to hybridization the Vibratome sections were washed for 2 x 30 rain in 2 x sodium citrate. The hybridization followed the procedure of Finsen et al. (1992) for Vibratome sections, using 1 pmol of probe per milliliter hybridization buffer (50% formamide, 4 x sodium citrate, 1 x Denhardt, 10% dextran sulfate and 500 lag single-stranded salmon sperm DNA per milliliter hybridization buffer). The sections were hybridzed as free-floating sections at 37~ C for 40 h.

dendrites tapered from the poles of the ovoid s o m a t a ; the dendrites of the p l e o m o r p h i c perikarya were thick, not as regularly placed at the poles of the cell body, and varied from one to four in number. The elongated p l e o m o r p h i c perikarya were also located in layer VI but became flattened, i.e., oriented horizontal to the pial surface. The sizes of s o m a t a were g r o u p e d by visual inspection into large, medium, and small only for convenience of discussion; there was a gradation in size of the neurons. Typically, the p l e o m o r p h i c cell bodies were large to m e d i u m in size; the ovoid somata, small to medium. We observed two relative contrasts of labeling: faint and intense. The larger cells appeared uniformly stained t h r o u g h o u t the perikarya and often into the proximal regions of thick dendrites. In the 50-gin-thick sections, we observed nuclei only infrequently in the large n e u r o n s ; it seemed that the density of the hybridization signal, either in front of or behind our line of view obscured the nuclei, except when the plane of sectioning cut t h r o u g h the nucleus. The perikarya of the typical medium-sized neurons also stained intensely; however, the cells exhibited clear, r o u n d nuclei within the dark cytoplasm. The small cell bodies presented clear nuclei s u r r o u n d e d by a rim of faint staining. However, we wish to emphasize that the size and labeling were not strictly correlated. Some of the intensely labeled neurons were small, and some faintly labeled cells were m e d i u m in size.

Posthybridization. Posthybridization treatment routinely consisted of washing for 3 x 30 min in 1 x sodium citrate at 55~ C. The washing was followed by a brief rinse in water at 37~ C, and rinsing for 2 x 5 rain in TRIS-HC1 buffer, pH 9.5, at room temperature, prior to the application of the AP developer.

Detection procedure. The AP developer was freshly prepared immediately before use with commercial reagents (Sigma or Dupont) by adding 13.2 lal nitroblue tetrazoleum and 9.9 lal bromo-chloro-indolyl-phosphate to 1 ml detection buffer. The AP histochemical development took place in complete darkness at room temperature for up to 48 h (Augood et al. 1991). The color reaction was stopped by rinsing in distilled water. Finally, the sections were mounted on gelatin-coated glass slides, air dried and dehydrated in graded acetone solutions, cleared in xylene, softened in xylene-phenolecreosote and coverslipped with Eukitt.

Control reactions. As controls, some sections were (1) hybridized with hybridization buffer only, or (2) hybridized with an excess of unlabeled probe ( x 100), or (3) pretreated with RNAase A (50 lag/ ml; Pharmacia) prior to hybridization with the probe. None of these tissue samples displayed any specific neuronal staining.

Results

Delineation of cortical areas The terminology of the rat neocortical areas has been designated by Zilles (1985). The distribution of cells expressing somatostatin m R N A within the coronal sections was indicative of the area (Figs. 1, 2). F r o m one area to the next, the spatial a r r a n g e m e n t of the cells formed a pattern characteristic of the region. Each area could be clearly recognized by the correspondence of the sections labeled by in situ hybridization to its c o u n t e r p a r t in Nissl stains. C o m p a r i s o n of somatostatin m R N A - r e a c t i v e cells and their m o r p h o l o g y in the s u p r a g r a n u l a r laminae in the p r i m a r y sensory areas allowed one to identify the visual and a u d i t o r y cortices from a small strip of neocortex. However, the parietal region maintained two different configurations within the p r i m a r y s o m a t o s e n s o r y area and presented m o r e difficulty in identification of the various areas (Parl, HL, FL, Par2). Thus, we could not rely u p o n cell m o r p h o l o g y within the s u p r a g r a n u l a r laminae for identification of each division; it was necessary to examine the parietal region as a whole.

Note on cell morphology and labeling technique We f o u n d two shapes of perikarya labeled for the expression of somatostatin m R N A : p l e o m o r p h i c and ovoid. The p l e o m o r p h i c s o m a t a were sometimes elongated, especially in the parietal cortex. Both the elongated p l e o m o r p h i c and the ovoid s o m a t a were aligned vertically, i.e., perpendicular to the pial surface in layers II and III. The difference between the two forms lay in the structure of their dendrites proximal to the soma. Two thin

Occipital region In the occipital cortex the p r i m a r y visual area (Ocl) was characterized by m o r e labeled cells in layers V and VI than in layer I I / I I I and very few in layer IV. The general appearance of O c l was rather stratified due to the paucity of cells in layer IV and the occurrence of cells along the mid-region of layer V, which created space between the

391

Fig. 1. Coronal section through parietal region after in situ hybridization for somatostatin with alkaline phosphatase probe illustrates the frontal (Fr), hindlimb (HL), parietal primary area (Parl)

and parietal secondary area (Par2),retrosplenial cortex (*). Section at bregma -2.8 mm

labeled cells in layers V and VI. The monocular (OclM) and binocular (OclB) regions of the primary visual cortex could be distinguished by the narrower layer IV in the monocular area. Small, faintly stained cells were abundant throughout layers V and VI and were apparent in layer II/III although fewer in number. As mentioned above, in layer V these faintly stained cells were situated along the middle of the layer. Large to medium-sized neurons, intensely labeled, were observed in layers II/III and VI and, occasionally, in layer V. Of the intensely stained cells, pleomorphic perikarya predominated; however, some medium-sized somata were ovoid. The pleomorphic and ovoid cells within layer II/III were oriented with their long axis perpendicular to the pial surface and were dispersed throughout the layer, although preferentially in the upper region (Fig. 3 a). In addition to the vertical orientation of the perikarya, two or more cells were occasionally in vertical proximity or alignment in layer II/III. The characteristic distribution of cells in layer II/III (i.e., vertical orientation of somata, vertical clustering of cells, and preference for the upper region) was a marker for the borders to the secondary visual cortices (Oc2M and Oc2L). At both medial and lateral borders, the cells,

both intensely and faintly stained, became dispersed throughout layer II/III in the secondary visual cortices. In addition to the greater compactness of layer II/III, Oc2L demonstrated more of the intensely stained cells.

Temporal region The primary auditory area (Tel) displayed numerous large to medium-sized cells, with either pleomorphic or ovoid perikarya, which were intensely labeled in layers II, III and VI. The oval cells were typically of medium size, with clear nuclei, and were apt to maintain a vertical orientation. The dispersion of the intensely labeled neurons within layers II, III and VI appeared random. Layers II, III and VI also demonstrated faintly stained small cells with clear round nuclei. These smaller cells were numerous within layer V and they, as well as a few intensely stained cells, were scattered throughout the layer. There was no obvious break or line of demarcation between the layers, but there were noticeably fewer cells labeled in layer IV and the lower part of layer III. In general, the appearance of Tel was an open latticework of predominantly intensely labeled cells in layers II and

392

III (Fig. 3 b), faint cells in layer V, and intensely labeled cells in layer VI. The two secondary auditory cortices (Te2 and Te3) contrasted with Tel by a thinner width of the laminae, especially layers II, III and IV. Although the basic pattern of alternation between intense/faint/intense labeling obvious in Tel could still be detected in Te2 and Te3, the faintly and intensely labeled cells were considerably more mixed among the layers.

Parietal region Within the parietal areas, large to medium-sized intensely labeled cells with either pleomorphic or ovoid somata were abundant within layers III and VI. Typically, clear nuclei were seen in the medium-sized cells, which were more frequent in layer III than layer II and were often visible in layers IV, V and VI. Of the intensely stained cells within layers III and VI, the larger ones were more likely to be situated in the upper region of layer III or the lower part of layer VI, whereas the medium-sized neurons displayed a preference for the lower part of layer III

and the upper part of layer VI. The ovoid and elongated pleomorphic perikarya in the supragranular layers (Fig. 3 c), and often those in layers IV and V, were oriented vertically, i.e., perpendicular to the pial surface. Faintly labeled cells were scattered from layer III through the upper region of layer VI. The parietal region differed from the occipital in a greater cell dispersion and a more pronounced tendency of the cells to cluster vertically, which could be observed even in layer V. In contrast to the compact stratification of the somatostatin mRNA-reactive neurons of the occipital areas, the parietal areas exhibited only the previously mentioned gradients of large intense, medium intense, small faint, medium intense, large intense cells. Also the profusion of small, faint cells in layer V in the occipital region differed from the relatively few within that layer in the parietal areas. Comparing the two primary areas, the numbers of the intensely labeled cells were approximately balanced between the supragranular and infragranular layers in Parl, whereas in Ocl most of the of cells expressing somatostatin m R N A were located in layer VI.

Fig. 3a-c. High-magnification micrograph illustrates the variety of perikaryal conformations within layer III; upper border is adjacent to layer II. a Occipital primary area (Ocl); b temporal primary area (Tel); c parietal primary area (Parl)

394

Fig. 4. Comparison of a Nissl staining and b in situ hybridization for somatostatin mRNA in a coronal section of parietal area (Parl)

Of the parietal areas, Parl displayed the most depth in the cortical strip. The effect of the added depth was to create more open space, especially within layers III and IV (Fig. 4). Parl could be distinguished from HL and FL by the amount of space between the cells in layers III and IV, a thicker layer VI, and fewer of the medium-sized intensely labeled neurons in layer III. The abrupt halt of layer IV granularity from Parl to Par2, apparent in Nissl stains, was not obvious here. However, the density of cells expressing somatostatin mRNA was greater in Par2 than Parl.

and VI, which created a three-tiered spatial pattern. The cells in Frl were located at any point between layers II and VI with little regard for size or intensity of labeling. The small, faintly labeled cells which gathered toward the middle of the laminae in Parl were scattered throughout the laminae within Frl. By contrast, Fr2 exhibited large to medium-sized intensely labeled cells visible in the upper region of layer II-IV and scattered throughout the wide layer VI and a scarcity of cells in layer V. Faint cells were observed dispersed throughout the laminae and were especially noticeable in layer V.

Frontal region

Discussion

Within the frontal region, two areas (Frl and Fr2) could be discerned. The frontal area (Frl, Fig. 5) medially adjacent to the parietal region displayed large and intensely labeled cells that were numerous in layers II-IV and VI, and several in layer V, a layer in which most regions exhibited only a few. Intensely labeled cells of medium size with clear nuclei were plentiful in layers II through VI, and faintly labeled cells were dispersed throughout the laminae. The major difference between the parietal area, Parl, and frontal area (Frl) was the lack of stratification within Frl. Parl displayed fewer intensely labeled cells along the borders between layers III and V and layers V

Areal boundaries The main observation in the present study is that the rodent neocortex may be parcellated by in situ hybridization for somatostatin mRNA. The neocortex is appreciably differentiated by cytoarchitecture, and with Nissl stains one may examine the size of somata and their laminar location. Even though cells with somatostatin gene expression are a subpopulation, the labeling of subpopulations within the laminae may reflect the area's dedication to its sensory and motor connections. We found the elements of definition in the cell labeling for somatostatin

395

Fig. 5. Comparison of a Nissl staining and b in situ hybridization for somatostatin mRNA in a coronal section of frontal area (F~I)

mRNA expression to be intensity of labeling and laminar placement of cells labeled. Intensity was an indicator by itself and also in combination with laminar placement. For instance, the low dispersion of intense cells within the supragranular layers of the primary visual cortex readily distinguished it from the secondary visual cortices. Also, layer V differentiated between occipital and parietal secondary regions because it contained small, faintly labeled cells. However, in the visual areas these cells were located along the mid-region of layer V, whereas they were dispersed throughout layer V of the parietal region. Laminar placement of cells was of assistance when we compared the parietal and frontal region. The latter was identified by the concentration of cell labeling within layers III to V. The parietal region was more stratified in appearance, because the intensely labeled cells aggregated toward the upper portion of layer III, and also there was a "break" with fewer intensely labeled cells along the border between layers V and VI. As with cytoarchitecture revealed by Nissl stains, the labeling for somatostatin mRNA expression was clearest in the perception of the primary sensory cortices. Common to all three of the primary sensory areas is a wide layer IV of small cells, densely packed together, which are visible in Nissl staining. Few of the cells in layer IV expressed somatostatin mRNA and, therefore, the primary sensory cortices were conspicuous because the layer, with a sparsity of cells

labeled, was so wide. Thus the distinction of the primary sensory areas from the adjacent cortical regions also rested upon laminar placement.

Cell morphology Our observations are consistent with the descriptions of somatostatinergic cells as nonpyramidal in the rat (McDonald et al. 1982; Eadie et al. 1987; Mizukawa et al. 1987). Although somata with a single apical dendrite were visible, there were no means by which to determine whether they were small pyramidal neurons or bipolar or bitufted cells which had been transected. Typically somatostatin is found in nonpyramidal cells (review, Zilles et al. 1990) with pleomorphic or ovoid perikary in the rat, cat, or primate species (McDonald et al. 1982; Somogyi et al. 1984; Mizukawa et al. 1987; Feldman et al. 1990; Doetsch et al. 1993; Wahle 1993). In the present study we observed cells with two shapes of somata (ovoid and pleomorphic) along two gradients: size and intensity of labeling. The cells described in the present study correspond approximately to the types described by Mizukawa and colleagues (1987). Their Type A (multipolar) and B (bipolar) neurons are similar to our pleomorphic and ovoid somata respectively. The Type C cells, which they described as small to medium,

396 overlap the gradients we found of medium, intensely-tofaintly stained and small, intensely-to-faintly labeled somata.

Function The function of somatostatin within the neocortex has not been fully explained. At least four somatostatin receptor subtypes have been characterized (Breder et al. 1992; O'Carroll et al. 1992; Yasuda et al. 1992). The action of somatostatin depends upon the subtype of receptor (Wang et al. 1989, 1990; Bonanno et al. 1991) and interaction with other neurotransmitters (Robbins and Landon 1985; Schettini et al. 1989). A variety of neurotransmitters/modulators are colocalized with somatostatin: G A B A (Schmechel et al. 1984; Foley et al. 1992), ChAT (Foley et al. 1992), VIP (Papadopoulos et al. 1987), AAP (Vincent et al. 1982), calbindin (Rogers 1992), and N A D P H (Dawson et al. 1991). Supporting the pharmacology, anatomical investigations have shown that the laminar binding sites of at least two of the subtypes differ (Campbell etal. 1987; Martin etal. 1991), and that neocortical regional differentiation is apparent from the laminar dispersion of receptors (Rosier et al. 1991). Culture of neocortical neurons and the present observations suggest that somatostatin may be involved in intracortical circuitry. Cultured cortical cells have established that somatostatin is endogenous to the cerebral cortex (Robbins and Reichlin 1983; Naus and Durand 1990; de Los Frailes et al. 1991). The cultured neurons exhibit similar neuroactivity to those in vivo (Robbins et al. 1982; Tapia-Arancibia and Reichline 1985; Chneiweiss et ak 1987; Alho et al. 1988; Nawa et al. 1993) and similar bipolar and multipolar cell morphology (Jordan and Thomas 1987). Our present observations in the primary sensory areas are that more and larger neurons are stained intensely within layers III and VI than within layers IV and V. In that layers III and VI project to and receive from cortical areas and subcortical connections predominate in layers IV and V (Miller and Vogt 1984), our observations would not preclude the role of somatostatin as an intracortical neuromediator. The most obvious anatomical evidence for intracortical involvement is that the morphology of the somatostatin immunoreactive and mRNA-reactive cells appear nonpyramidal. What is not obvious is whether somatostatin works as a means of synergistic control with other neuropeptides to establish a milieu to limit oscillations within the cortical areas, or if these cells stabilize the cellular environment as a whole, or if they have some other purpose. Reflecting upon the heterogeneity of perikaryal morphology and axonal arborization, de Lima and Morrison (1989) suggest that somatostatin may be a modulatory source for more than one element in the intracortical circuitry. Deprivation studies lead us to propose that the function of somatostatin does not include the modulation of thalamic nor callosal afferents. Neonatal monocular enucleation increases the number of somatostatin-immunoreactive cells within the primary visual cortex as compared to sighted rats (Jeffery and Parnavelas 1987).

The increase in somatostatin-immunoreactive cells in the somatosensory cortex following neonatal vibrissae removal matches the enucleation paradigm (Parnavelas et al. 1990). However, dark rearing produces a much greater increase within the primary visual cortex than either of the first two (Parnavelas et al. 1990). A c o m m o n denominator is deactivation of sensory stimulation. Neonatal monocular enucleation results in only thalamic deafferentation, because the callosal afferents remain. Neonatal vibrissae removal also results in only thalamic deafferentation because there are no callosal afferents within the barrel fields. Dark rearing, however, would result in both callosal and thalamic deactivation, which would explain why this form of deprivation is a more powerful source of somatostatin cell induction or, more probably, viable continuation of cells from an early development stage. Considering the above argument, one wonders how deprivation would affect the axonal arborization complementary to the cells. Fibers immunoreactive to somatostatin-28(1.12) have been shown to be mainly axons; Campbell and colleagues (1987) found that these radial fibers in layers III and IV of the monkey brain were less dense in the primary visual cortex than in the secondary visual area which, in turn, was less dense than in an association visual area (AIT). However, we do not know whether the Parnavelas group has a study incorporating somatostatin-28(l_12). Anatomically, cell bodies expressing somatostatin m R N A remain outside of the thalamic layer (layer IV) and exhibit ovoid and pleomorphic morphology characteristic to nonpyramidal neurons (present observations).

Acknowledgements. We are grateful to Dorte Lyholmer and Inger Merete Thomsen for technical assistance and to Albert Meier for microphotography. Funding was provided by the Danish Medical Research Council, Danish State Biotechnology Program and the Lundbeck Foundation. References Alho H, Ferrarese C, Vicini S, Vaccarino F (1988) Subsets of GABAergic neurons in dissociated cell cultures of neonatal rat cerebral cortex show co-localization with specific modulator peptides. Brain Res 467:193-204 Augood SJ, Kiyama H, Faull RL, Emson PC (1991) Dopaminergic D 1 and D 2 receptor antagonists decreases prosomatostatin mRNA expression in rat striatum. Neuroscience 44:35-44 Bonanno G, Parodi B, Cafaggi S, Raiteri M (1991) Somatostatin release from rat cerebral cortex synaptosomes. J Neurochem 57:1258-1264 Breder CD, Yamada Y, Yasuda K, Seino S, Saper CB, Bell GI (1992) Differential expression of somatostatin receptor subtypes in brain. J Neurosci 12:3920-3934 Campbell MJ, Lewis DA, Benoit R, Morrison JH (1987) Regional heterogeneity in the distribution of somatostatin-28- and somatostatin-28(1 12)-immunoreactive profiles in monkey neocortex. J Neurosci 7:1133-1144 Chneiweiss H, Bertrand P, Epelbaum J, Kordon C, Glowinski J, Premont J, Enjalbert A (1987) Somatostatin receptors on cortical neurones and adenohypophysis: comparison between specific binding and adenylate cyclase inhibition. Eur J Pharmacol 138:249-255 Dawson TM, Bredt DS, Fotuhi M, Hwang PM, Snyder SH (1991) Nitric oxide synthase and neuronal NADPH diaphorase are

397 identical in brain and peripheral tissues. Proc Natl Acad Sci USA 88:7797-7801 Doetsch GS, Norelle A, Mark EK, Standage GP, Lu SM, Lin RC (1993) Immunoreactivity for GAD and three peptides in somatosensory cortex and thalamus of the raccoon. Brain Res Bull 31:553-563 Eadie LA, Parnavelas JG, Franke E (1987) Development of the ultrastructural features of somatostatin-immunoreactive neurons in the rat visual cortex. J Neurocytol 16:445~459 Feldman SC, Harris MR, Laemle LK (1990) The maturation of the somatostatin systems in the rat visual cortex. Peptides 11 : 1055 1064 Finsen BR, Tonder N, Augood S, Zimmer J (1992) Somatostatin and neuropeotide Y in organotypic slice cultures of the rat hippocampns: an immunocytochemical and in situ hybridization study. Neuroscience 47:105-113 Fitzpatrick-McElligott S, Card JP, Lewis ME, Baldino F (1988) Neuronal localization of Prosomatostatin mRNA in the rat brain with in situ hybridization histochemistry. J Comp Neurol 273:558-572 Fitzpatrick-McElligott S, Card JP, O'Kane TM, Baldino F (1991) Ontogeny of somatostatin mRNA-containing perikarya in the rat central nervous system. Synapse 7:123-134 Foley P, Hughes PD, Bradford HF, Ghatei MA, Khandanian N, Bloom SR (1992) The presence of neuropeptides in GABAergic and cholinergic rat cerebrocortical synaptosome sub-populations. Neuropeptides 23 :67-72 Goodman RH, Aron DC, Roos BA (1983) Rat pre-prosomatostatin: structure and processing by microsomal membranes. J Biol Chem 258 : 5570-5573 Hendry SH, Jones EG, Emson PC (1984) Morphology, distribution, and synaptic relations of somatostatin- and neuropeptide Y-immunoreactive neurons in rat and monkey neocortex. J Neurosci 4: 2497-2517 Jablonski E, Moomaw EW, Tullis RH, Ruth JL (1986) Peparation of oligodeoxynucleotide-alkaline phosphatase conjugates and their use of hybridization probes. Nucleic Acids Res 14:61156128 Jeffery G, Parnavelas JG (1987) Early visual deafferentation of the cortex results in an asymmetry of somatostatin-labelled cells. Exp Brain Res 67:651 655 Jordan FL, Thomas WE (1987) Identification of somatostatin-containing neurons in primary cultures of rat cerebral cortex. Neurosci Lett 77:249-254 Kiyama H, Emson PC (1990) Distribution of somatostatin mRNA in the ratnervous system as visualized by a novel nonradioactive in situ hybridization histochemistry procedure. Neuroscience 38:223-244 Krieg WJS (1946) Connections of the cerebral cortex. I. The albino rat. J Comp Neurol 84:221-323 Laemle LK, Feldman SC (1985) Somatostatin (SRIF)-like immunoreactivity in subcortical and cortical visual centers of the rat. J Comp Neurol 233:452-462 Lima AD de, Morrison JH (1989) Ultrastructural analysis of somatostatin-immunoreactiveneurons and synapses in the temporal and occipital cortex of the macaque monkey. J Comp Neurol 182:212-227 LosFrailes MT de, Sanchez Franco F, Lorenzo M J, Tolon RM, Lara JI, Cacicedo L (1991) Endogenous vasoactive intestinal peptide (VIP) regulates somatostatin secretion by cultured fetal rat cerebral cortical and hypothalamic cells. Regul Pept 34:261274 Martin JL, Chesselet MF, Raynor K, Gonzales C, Reisine T (1991) Differential distribution of somatostatin receptor subtypes in rat brain revealed by newly developed somatostatin analogs. Neuroscience 41:581-593 McDonald JK, Parnavelas JG, Karamanlidis AN, Brecha N, Koenig JI (1982) The morphology and distribution of peptidecontaining neurons in the adult and developing visual cortex of the rat. I. Somatostatin. J Neurocytol 11:809-824

Miller MW, Vogt BA (1984) Direct connections of rat visual cortex with sensory, motor, and association Cortices. J Comp Neurol 226:184-202 Mizukawa K, McGeer PL, Vincent SR, McGeer EG (1987) The distribution of somatostatin-immunoreactiveneurons and fibers in the rat cerebral cortex: light and electron microscopic studies. Brain Res 426:28-36 Naus CC, Durand MM (1990) Ontogeny of somatostatin expression in primary cultures of cortical neurons parallels that seen in vivo. Brain Res Bull 25:749-754 Naus CC, Miller FD, Morrison JH, Bloom FE (1988) Immunohistochemical and in situ hybridization analysis of the development of the rat somatostatin-containing neocortical neuronal system J Comp Neurol 269:448 463 Nawa H, Bessho Y, Carnahan J, Nakanishi S, Mizuno K (1993) Regulation of neuropeptide expression in cultured cerebral cortical neurons by brain-derived neurotrophic factor. J Neurochem 60:772-775 O'Carroll AM, Lolait SJ, Konig M, Mahan LC (1992) Molecular cloning and expression of a pituitary somatostatin receptor with preferential affinity for somatostatin 28. Mol Pharmacol 42:939-946 Papadopoulos GC, Parnavelas JG, Cavanagh ME (1987) Extensive coexistence of neuropeotides in the rat visual cortex. Brain Res 420:95-99 Parnavelas JG, Jeffery G, Cope J, Davies SW (1990) Early lesion of mystaciai vibrissae in rats results in an increase of somatostatinlabelled cells in the somatosensory cortex. Exp Brain Res 82:658-662 Paxinos G, Watson C (1985) The rat brain in stereotaxic coordinates. Academic Press, New York Priestley JV, Rethelyi M, Lund PK (1991) Semi-quantitative analyis of somatostatin mRNA distribution in the rat central nervous system using in situ hybridization. J Chem Neuroanat 4:131153 Robbins RJ, Reichlin S (1983) Somatostatin biosynthesis by cerebral cortical cells in monolayer culture. Endocrinology 3:574581 Robbins RJ, Landon RM (1985) The effects of neurotensin, vasoactive intestinal polypeptide and other neuropeptides on the secretion of somatostatin from cerebral cortical cells. Brain Res 332:161-164 Robbins RJ, Sutton RE, Reichlin S (1982) Effects of neurotransmitters and cyclic AMP on somatostatin release from cultured cerebral cortical cells. Brain Res 234:377-386 Rogers JH (1992) Immunohistochemical markers in rat cortex: colocalization of calretinin and calbindin-D28k with neuropeptides and GABA. Brain Res 587:147-157 Rosier AM, Leroux P, Vaudry H, Orban GA, Vandesande F (1991) Distribution of somatostatin receptors in the cat and monkey visual cortex demonstrated by in vitro receptor autoradiography. J Comp Neurol 310:189-199 Schettini G, Florio T, Meucci O, Landolfi E, Grimaldi M, Ventra C, Marino A (1989) Somatostatin inhibition of adenylate cyclase activity in different brain areas. Brain Res 492:65 71 Schmechel DE, Vickrey BG, Fitzpatrick D, Elde RP (1984) GABAergic neurons of mammalian cerebral cortex: widespread subclass defined by somatostatin content. Neurosci Lett 47: 227-232 Somogyi P, Hodgson AJ, Smith AD, Nunzi MG, Gorio A, Wu JY (1984) Different populations of GABAergic neurons in the visual cortex and hippocampus of cat contain somatostatin- or cholecystokinin-immunoreactivematerial. J Neurosci 4:25902603 Tapia-Arancibia L, Reichlin S (1985) Vasoactive intestinal peptide and PHI stimulate somatostatin release from rat cerebral cortical and diencephalic cells in dispersed cell culture. Brain Res 336: 67-72 Tavianini MA, Hayes TE, Magazin MD, Minth CD, Dixon JE (1984) Isolation, characterization, and DNA sequence of the rat somatostatin gene. J Biol Chem 259:11798-11803

398 Vincent SR, Skirboll L, H6kfelt T, Johansson O, Lundberg JM, Elde RP, Terenius L, Kimmel J (1982) Coexistence of somatostatinand avian pancreatic polypeptide (APP)-like immunoreactivity in some forebrain neurons. Neuroscience 7:439-446 Vincent SR, McIntosh CH, Buchan AM, Brown JC (1985) Central somatostatin systems revealed with monoclonal antibodies. J Comp Neurol 238:169-186 Wahle P (1993) Differential regulation of substance P and somatostatin in Martinotti cells of the developing cat visual cortex. J Comp Neurol 329:519-538 Wang HL, Bogen C, Reisine T, Dichter M (1989) Somatostatin-14 and somatostatin-28 induce opposite effects on potassium currents in rat neocortical neurons. Proc Natl Acad Sci USA 86:9616 9620 Wang HL, Dichter M, Reisine T (1990) Lack of cross-desensitization of somatostatin-14 and somatostatin-28 receptors coupled to potassium channels in rat neocortical neurons. Mol Pharmacol 38:357-361

Wree A, Finsen BR, Zimmer J (1992) Arealspezifisches Verteilungsmuster der Somatostatin-Messenger-RNA markierten kortikalen Neurone der Ratte. Ann Anat (Anat Anz) 174:181-182 Yasuda K, Rens Domiano S, Breder CD, Law SF, Saper CB, Reisine T, Bell GI (1992) Cloning of a novel somatostatin receptor, SSTR3, coupled to adenylylcyclase. J Biol Chem 267: 20422-20428 Zilles K (1985) The cortex of the rat: a stereotaxic atlas. Springer, Berlin Heidelberg New York Zilles K, Wree A (1985) Cortex: areal and laminar structure. In: Paxinos G (ed) The rat nervous system, vol 1. Forebrain and midbrain. Academic Press, New York, pp 375-415 Zilles K, Wree A, Dausch ND (1990) Anatomy of the neocortex: neurochemical organization. In: Kolb B, Tees RC (eds) The cerebral cortex of the rat. MIT Press, Cambridge, Massachusetts