Transgenic Research 13: 59–67, 2004. © 2004 Kluwer Academic Publishers. Printed in the Netherlands.
59
Peanut stripe potyvirus resistance in peanut (Arachis hypogaea L.) plants carrying viral coat protein gene sequences Colleen M. Higgins1,∗∗, Rhonda M. Hall1 , Neena Mitter1 , Alan Cruickshank2 & Ralf G. Dietzgen1,∗ 1 Biotechnology, Department
of Primary Industries, Queensland Agency for Food and Fibre Sciences, Queensland Bioscience Precinct, 306 Carmody Road, The University of Queensland, St. Lucia, Qld 4072, Australia 2 Farming Systems Institute, Goodger Road, Kingaroy, Qld 4619, Australia Received 29 January 2002; revised 10 July 2003; accepted 28 August 2003
Key words: peanut, potyvirus, RNA-mediated virus resistance, transformation
Abstract Peanut (Arachis hypogaea L.) lines exhibiting high levels of resistance to peanut stripe virus (PStV) were obtained following microprojectile bombardment of embryogenic callus derived from mature seeds. Fertile plants of the commercial cultivars Gajah and NC7 were regenerated following co-bombardment with the hygromycin resistance gene and one of two forms of the PStV coat protein (CP) gene, an untranslatable, full length sequence (CP2) or a translatable gene encoding a CP with an N-terminal truncation (CP4). High level resistance to PStV was observed for both transgenes when plants were challenged with the homologous virus isolate. The mechanism of resistance appears to be RNA-mediated, since plants carrying either the untranslatable CP2 or CP4 had no detectable protein expression, but were resistant or immune (no virus replication). Furthermore, highly resistant, but not susceptible CP2 T0 plants contained transgene-specific small RNAs. These plants now provide important germplasm for peanut breeding, particularly in countries where PStV is endemic and poses a major constraint to peanut production.
Introduction Peanut (Arachis hypogaea L.) is one of the world’s most important oilseed crops and food legumes, providing an excellent source of high quality protein, oil and other nutrients in many sub-tropical countries. Peanut stripe virus (PStV), a strain of Bean common mosaic virus (genus Potyvirus, family Potyviridae) is a major constraint to peanut production in south-east Asia and China. Seed quality and yield are reduced significantly with yield losses under dry season, broad acre production frequently reaching 75–80% (Higgins et al., 1999). There are many biologically distinct PStV strains, which cause a wide range of symptoms on peanut (Wongkaew & Dollet, 1990). Sequence analysis of the coat protein (CP) gene revealed that ∗ Author for correspondence
E-mail:
[email protected] ∗∗ Present address: Genesis R&D Corporation, PO Box 50, Auckland, New Zealand
PStV isolates from Indonesia, Thailand, China and the USA are related according to their geographic origin, independent of symptom type. Sequence variation is limited, up to 3.5% within and 7.3% between geographic groups (Higgins et al., 1999). Control of this virus is difficult, because PStV is efficiently transmitted by aphids in a non-persistent manner (Demski et al., 1984) and seed transmission rates of up to 50% can occur (Xu et al., 1991). Further, no sources of resistance to PStV were found in more than 11,000 accessions of the world peanut germplasm collection (ICRISAT, 1988). This is probably due to the extremely narrow genetic base of commercial peanut cultivars which are allotetraploid and apparently derived from a single hybridization event between diploid parents Arachis duranensis and A. ipaensis (Kochert, 1996). Breeding programs aimed at incorporating resistance genes from wild Arachis relatives (Culver et al., 1987) have proven largely unsuccessful due to genetic incompatibility.
60 Expression of potyvirus CP gene sequences in transgenic plants is a well-established and effective strategy to protect plants from potyvirus infection (Fitch et al., 1992; Lindbo & Dougherty, 1992; Smith et al., 1995; Jan et al., 1999; Sonoda et al., 1999). Indeed, it has been demonstrated that transgenic PStV CP sequences can protect the model plant Nicotiana benthamiana from PStV infection (Cassidy & Nelson, 1995; CM Higgins et al., unpublished). Both, proteinand RNA-mediated resistance mechanisms have been observed in many different studies of transformed plants carrying viral sense transgenes (e.g., Fitch et al., 1992; Smith et al., 1995). High level resistance or lack of virus replication and the presence of 21–25 nt smallinterfering (si) RNAs are hallmarks of RNA-mediated, homology-dependent, post-transcriptional gene silencing (PTGS) (Scorza et al., 2001; Waterhouse et al., 2001; Kalantidis et al., 2002), while delayed symptoms and varying degrees of resistance have been observed for protein-mediated protection (Lomonossoff, 1995). Peanut is considered a difficult species to transform, and only few confirmed stably transformed peanut plants have been described (reviewed in Livingstone & Birch, 1999). The first virus-resistant transgenic peanut plants were generated using tomato spotted wilt virus sense and antisense nucleocapsid gene sequences (Li et al., 1997; Yang et al., 1998; Magbanua et al., 2000). A recent report by Livingstone and Birch (1999) describes an efficient transformation and regeneration system for the routine transfer of useful genes into commercial peanut cultivars of both Spanish and Virginia botanical types. This approach uses microprojectile bombardment of embryogenic callus derived from mature seeds. Here, we report the application of this transformation system to generate several independent transgenic peanut lines, some of which were highly resistant to infection by PStV when challenged by repeated mechanical inoculations in the glasshouse. Materials and methods Vector construction A clone carrying the CP gene and 3 untranslated region (3 UTR) from an Indonesian blotch (Ib) isolate of PStV (Teycheney & Dietzgen, 1994) was used as the source of viral sequence. CP2, a full length, untranslatable version and CP4, a translatable version with a 5 deletion of 156 nt that gave
rise to an N-terminal deletion of 52 amino acids in the gene product, were made by PCR. CP2 was made using the primer CP2 (5 GCGCGCCCATGGCATAATAGTAGCACAACACAACC 3 ) which carried three in frame stop codons immediately downstream of the translational start, and the T3 promoter primer. CP4 was made by amplifying the 3 portion of the PStV CP gene with the upstream primer CP4 (5 CGCGCGCCATGGATGTGAATG CTGGT 3 ), which inserted an in frame ATG and NcoI site, and the T3 promoter primer. PCR products were cloned into pBluescript KS+ (Stratagene) and the recombinant clones were verified by manual sequencing using the Sequenase kit (USB). NcoI/BamHI fragments were excised and cloned between a dual enhanced cauliflower mosaic virus (CaMV) 35S promoter with a tobacco etch virus (TEV) 5 UTR and CaMV 3 terminator in the vector pRTL2 (Restrepo et al., 1990) as shown in Figure 1. Peanut transformation and regeneration Somatic embryos derived from mature seeds of peanut cultivars Gajah (a Spanish market type) and NC-7 (a Virginia market type) were transformed by co-bombardment as described by Livingstone and Birch (1999) with one of the CP constructs and pHygr (CaMV 35S-hph-nos; Finer et al., 1992). Plantlets were regenerated and acclimatized in the glasshouse as described by Higgins and Dietzgen (2000). Virus isolate, maintenance and challenge inoculation PStV inoculations were done under conditions approved by the Australian Quarantine and Inspection Service (AQIS) in aphid-proof cages in a containment glasshouse facility. The PStV-Ib isolate (Teycheney & Dietzgen, 1994) was propagated in A. hypogaea L. cv. Gajah. Infected peanut leaf material, fresh or stored at −80◦ C was used as inoculum following maceration with a mortar and pestle in 10 mM sodium phosphate buffer, pH 7. Plants with 3–4 leaves were dusted with carborundum and mechanically inoculated. Symptoms were assessed 5–6 weeks post inoculation and leaf samples taken for ELISA. Untransformed plants that had been grown from seed to a similar height as the transgenic plants were used as controls, being inoculated with buffer or PStV as above.
61
Figure 1. Schematic representation of PStV CP gene constructs CP2 and CP4 in the pRTL2 backbone used for peanut transformation.
ELISA Accumulation of PStV CP in transgenic plants was assessed using plate-trapped antigen ELISA. One leaf disk was sampled from each of three leaflets of an old, middle or young leaf. Each of the three disks from the same leaf were pooled and ground in 400 µl coating buffer (Clark & Adams, 1977). For each 1:20 diluted sample, 100 µl was transferred to duplicate wells of a microtitre plate (Dynatech) and virus detected using (1) a rabbit polyclonal antiserum to recombinant PStV CP (R.A. Naidu, ICRISAT) diluted 1:10,000 to detect plate-trapped antigen, (2) alkaline phosphatase-conjugated goat anti-rabbit IgG (Sigma) diluted 1:30,000 to detect bound rabbit antibody and (3) a 1 mg/ml solution of p-nitrophenyl phosphate (Roche) as the substrate. Product absorbance signals were measured at 410 nm using a MR7000 plate reader (Dynatech) after 1 h incubation. Molecular analysis of transgenic peanuts Putative transformed embryos and plantlets were identified by ‘leaf soak’ PCR (Higgins et al., 2000). Integration of the transgene was confirmed and the copy number estimated by Southern hybridization. Genomic DNA was extracted from fresh or frozen leaves, using the CTAB method described by Graham et al. (1994). Twenty micrograms of purified plant DNA were digested with NcoI and purified using a BRESAcleanTM DNA purification kit (GeneWorks, Adelaide, South Australia) before transferring to
nylon membrane (Amersham Pharmacia, Sydney) by capillary blotting (Sambrook et al., 1989). A PStV CP gene probe incorporating the CP coding region and viral 3 UTR was prepared by digesting PSTV CP2 with NcoI and XbaI. The PStV fragment was labeled with [32 P]-dCTP using the Megaprime DNA labeling kit (Amersham Pharmacia). Hybridization was done at 65◦ C using Superhyb Solution (Molecular Research Center, Cincinnati, OH, USA). Subsequently, filters were washed at 65◦ C, twice in 2× SSC/0.5% SDS for 10 min each, twice in 1× SSC/0.5% SDS for 10 min each, and once in 0.5× SSC/0.5% SDS for 10 min. The blots were exposed to Agfa Curix X-ray film overnight at −70◦ C with intensifying screens. Total RNA was extracted and enriched for small RNAs as described by Han and Grierson (2002). An antisense riboprobe corresponding to the PStV CP gene was generated using the MAXIscript T7 in vitro transcription kit (Ambion, Austin, TX, USA). Low molecular weight RNAs were visualized on ethidium bromide stained 1% agarose gels as ∼250 bp bands to enable equal loading. RNAs were separated on 15% polyacrylamide/7 M urea/TBE (Sambrook et al., 1989) gels, transferred onto Hybond NX membrane (Amersham Biosciences, Piscataway, NJ, USA) by electrophoretic transfer using a Trans-Blot semi dry apparatus (Bio-Rad, Regents Park, NSW, Australia) and UV-crosslinked. Oligonucleotide size markers of 20, 25 and 30 bp were labeled with 32 P-UTP using T4 polynucleotide kinase (MBI Fermentas, Hanover, MD, USA). Membranes were pre-hybridized at 50◦ C for 2 h and hybridized at 42◦C overnight using
62 Table 1. Properties of PStV-resistant T0 peanut lines cv. Gajah Copy No.
Plant No.
ELISA
Symptoms on young leaves
Assessment
1
12/50/31
Mild mottle and stripe
Reduced virus titre, reduced symptoms
Reinoc. 2
160/–/76 N.d.
Yellowing; dark flecks Blotch
1 Reinoc. 2
10/70/59 0/0/0 N.d.
No symptoms No Symptoms No symptoms up to 5 wpi; mild blotches at 7 wpi
1 Reinoc. 2
15/17/0 N.d. N.d.
No symptoms No symptoms up to 6 wpi No symptoms up to 4 wpi
1
60/31/65
Symptom delay
2
N.d.
No symptoms 4 wpi later, severe blotches on most leaves of axillary shoot Mild blotches
9
1
N.d.
Blotch symptoms on older leaves, younger leaves symptomless
Recovery
130.2
N.d.
1
128/272/288
Severe blotch
Susceptible
CP4 lines 7/11.D1
10
1
N.d.
No symptoms
Highly resistant
15/8.F1
8
1
N.d.
No symptoms ∼4 wpi; severe blotches appeared ∼6 wpi
Symptom delay
7/4.F1
6
1
N.d.
No symptoms
Highly resistant
CP2 lines 116.1M
3/12.E4
3/12.E1
3/12.C1
3/12.H1
6
6
4
3
Susceptible Highly resistant Highly resistant
Highly resistant Highly resistant
Reduced symptoms
ELISA values represent mean of three independent A410 nm samples; readings corrected for untransformed, uninfected leaf controls and multiplied by factor 1000; values are represented in the order ‘young/middle/old’ leaf; wpi, weeks post inoculation; not determined.
Superhyb solution. The blots were washed at 50◦C with 2× SSC, 0.5% SDS for 10 min, 1× SSC, 0.5% SDS for 15 min and 0.5× SSC, 0.5% SDS for 10 min, and exposed to X-ray film as described above.
Results Generation of transgenic peanut lines Transgenic plants were regenerated from 21 and 20 independent bombardments with CP2 and CP4, respectively. The majority of plants regenerated were cv. Gajah except for some cv. NC7 plants regenerated following two bombardments with CP4. Hygromycin resistant calli were regenerated from 67% of the CP2 bombardments and 80% of the CP4 bombardments
representing an average of 2.2 and 2.5 hygromycin resistant callus lines per bombardment. Of these, 63 and 60% were positive for the CP sequence by PCR. All CP-positive lines produced multiple shoots in culture, however, only eight CP2 and seven CP4 lines were acclimatized to the glasshouse and challenged with PStV.
Molecular analysis and PStV resistance Resistance to PStV in transgenic peanut plants was tested by mechanical rub inoculation with the homologous PStV-Ib isolate under glasshouse conditions. Untransformed control plants were inoculated with either sap from PStV-infected leaves or with buffer. PStV-Ib had been reported previously as causing ob-
63 vious ‘blotch’ symptoms on cv. Gajah, 1–2 weeks after inoculation (Teycheney & Dietzgen, 1994). This PStV isolate also caused similar blotch symptoms on untransformed peanut cv. NC7. Young, unfurled leaves of cv. NC7 sometimes had a yellow stripe appearance similar to that observed in plants infected with a ‘stripe’ strain of PStV. However, in healthy plants this appearance disappeared while in fully developed diseased plants, it changed to the ‘blotch’ phenotype. Thus, it was important to wait until leaves had developed fully before scoring PStV symptoms. The striping was transient and possibly due to nutritional factors, because neither PStV nor Peanut mottle virus (a related seed-borne potyvirus giving similar symptoms to those caused by PStV) were detected by ELISA or RT-PCR (data not shown). Transgenic peanut plants were regenerated carrying one of two modified forms of the PStV CP gene and 3 UTR sequence. A previous study had shown that CP2 did not yield a protein, while CP4 gave rise to the expected truncated CP in vitro. Furthermore, these two constructs were the most efficient of four CP transgenes at conferring immunity to several genetically diverse strains of PStV in the model host species N.benthamiana (CM Higgins et al., unpublished). While blotch disease symptoms following infection with PStV-Ib were a definite indicator of a susceptible phenotype, ELISA was used to confirm the presence of PStV in the leaves. Samples from three leaflets per leaf were pooled to avoid potential uneven virus distribution or the possibility that resistance may be sectored within leaves. In all cases, the inoculated untransformed control plants included in each experiment showed 100% infection. ELISA analysis of different leaves of plants, which had been inoculated in the glasshouse with PStVIb showed whether or not virus was present within inoculated old leaves, as well as systemic (middle and young) leaves. Fifteen CP2 and CP4 transgenic lines were challenged with PStV-Ib in the glasshouse and eight of those were found to be partly or highly resistant (Table 1). Susceptible lines showed clear systemic blotch symptoms and PStV was detected throughout the plants, when assayed by ELISA. Three resistance phenotypes were observed; high level resistance, delayed or reduced symptoms and recovery (Table 1). Highly resistant plants were obtained with both constructs (e.g., 3/12.E1 and 7/11.D1). The difference in phenotype between a highly resistant line (3/12.E4) and an untransformed control can be seen in Figure 2. In some cases, non-symptomatic plants were
re-inoculated with PStV and assessed again (Table 1). Plants of lines 3/12.E1 and 3/12.E4 in particular did not develop symptoms following re-inoculation and appeared to be highly resistant to the virus. A delay of symptom appearance by 1–2 weeks was observed
Figure 2. Appearance of (1) highly resistant 3/12.E4 No. 2 and (2) susceptible, untransformed peanut plant cv. Gajah, 6 weeks post mechanical inoculation with PStV-Ib.
Figure 3. Southern blot analysis of NcoI-digested peanut genomic DNA probed with a NcoI/XbaI fragment from CP2. Lane 1, untransformed; lanes 2–4, CP2 plants 116.1M, 3/12.E1 and 3/12.E4; lane 5, CP4 plant 7/4.F1; lane 6, CP2 plant 3/12.H1; lane 7, blank; lane 8, 200 pg of NcoI/XbaI PStV CP2 fragment of 1.1 kb size. Sizes of selected molecular weight markers (kb) are indicated on the right.
64
Figure 4. RNA blot analysis of small RNAs extracted from original transgenic (A) and progeny (B) peanut plants. (A) 3/12.E7 (lane 1), 3/12.E4 (lane 2), 3/12.E1 (lane 3) and 130.2 (lane 4); lanes 5 and 6, PStV CP-specific oligonucleotide primers of 19 and 30 nt, respectively. (B) T2 progeny of 3/12.E4 derived from T1 plants No. 1 (lanes 1–3) and No. 4 (lanes 4 and 5). Blots were probed with PStV CP antisense RNA. Migration and size (nt) of 32 P-labeled oligonucleotides (A; lane M) is indicated on the left margin.
in one line each of CP2 (3/12.C1) and CP4 (15/8.F1) (Table 1). One CP2 line (3/12.H1) with a recovery phenotype was observed, since older leaves showed clear blotch symptoms but young leaves remained symptomless. All resistant and recovery T0 lines produced flowers and went on to produce pegs and seed. T1 plants were germinated for several lines (e.g., 3/12 H1), which have themselves gone on to produce seed. Southern hybridization analysis was carried out by using a PStV CP probe against NcoI digested genomic DNA from the regenerated peanut plants used in the virus challenge. This restriction enzyme cuts the transgene once at the translation start site (Figure 1). An example of this analysis is shown in Figure 3. There was no correlation between transgene copy number and phenotype in this study. All regenerated plants analyzed, with resistant and susceptible phenotypes, carried three or more transgene copies. The minimum expected size for the intact PStV CP gene was 1.1 kb (Figure 3, lane 8). All of the plants shown in Figure 3 have bands greater than this size, indicating integration of the CP gene into the peanut genome. Bands
smaller than the expected size can also be seen in lanes 2 and 3, indicating the presence of a truncated form of the transgene in addition to the full-length copies. None of the uninoculated transgenic peanut plants tested expressed detectable amounts of CP from the transgene (data not shown). This applies to ELISAtested leaf samples from plants grown in tissue culture as well as those grown in soil in the glasshouse. Selected CP2 T0 plants were analyzed by RNA blot for the presence of transgene-specific small RNAs. RNAs of ∼21 nt were detected in two highly resistant lines (see Table 1), but not in a susceptible line (Figure 4(A), compare lanes 2 and 3 with 4). A larger RNA species of ∼25 nt was only detected in the highly resistant line 3/12.E4 (Figure 4(A), lane 2). Line 3/12.E7, the resistance status of which has not been determined and which carries 10 copies of the CP2 transgene, would be predicted to have PTGS activated (i.e., to be resistant), based on the presence of these small RNAs (Figure 4(A), lane 1). Small RNAs were also analyzed in T2 progeny plants, derived from two T1 plants of line 3/12.E4. The transgenesis of
65 these plants was confirmed by PCR. All five plants accumulated small RNAs of ∼21 nt (Figure 4(B)). The progeny plants from one T1 line also contained the larger small RNA species, similar to that observed in the T0 plant of 3/12.E4 (Figure 4(B), lanes 4 and 5; compare with Figure 4(A), lane 2). No small RNAs were detected in untransformed cv. Gajah plants (data not shown).
Discussion We report the regeneration of transgenic peanut plants, some of which show high level resistance to PStV infection under glasshouse conditions. These plants have been transformed with one of two modified forms of the PStV CP gene, one untranslatable, the other coding for an N-terminal truncated CP. This provides another example of transformation of a crop plant with viral sense transgenes to yield virus-resistant germplasm. This technology has been successfully applied to protect several other plant species against a number of different viruses (e.g., Fang & Grumet, 1993; Jones et al., 1998; Ingelbrecht et al., 1999; Scorza et al., 2001). Indeed, transgenic papaya and squash plants resistant to the potyviruses papaya ringspot and zucchini yellow mosaic, respectively, are now commercially grown (James, 1998). In the last 5 years others have regenerated several transgenic peanut lines carrying TSWV nucleocapsid protein (N) gene sequences. Expression of TSWV N gene mRNA and protein resulted in delayed symptom development (Li et al., 1997), but this type of resistance was apparently not useful under field conditions (Yang et al., 1998). Divergent levels of transgene expression in peanut were seen in other lines, where single copy transgenes gave rise to detectable protein levels and multiple copies led to gene silencing (Yang et al., 1998). However, no resistance testing data have been reported. Recently, progeny of a transgenic peanut plant carrying two copies of an antisense TSWV N gene sequence showed some resistance to TSWV infection in the field (Magbanua et al., 2000). No resistance to PStV appears to exist within A. hypogaea germplasm (ICRISAT, 1988), thus, the use of transgenic technology appears appropriate for the development of virus-resistant peanut. A large proportion of the peanut plants that we were able to regenerate, acclimatize and challenge showed some level of resistance to PStV infection. This supports observations we had made for these constructs in the
model species N. benthamiana (CM Higgins et al., unpublished). It appears that the PStV CP constructs containing the viral 3 UTR we have engineered are particularly suitable for conferring PStV resistance. Others have shown that full length CP genes and genes containing the core region of the CP are suitable for conferring resistance (e.g., Lindbo & Dougherty, 1992; Cassidy & Nelson, 1995; Scorza et al., 2001). In our study, CP2 had the sequence for the full length CP, albeit untranslatable, whilst CP4 carried the core and C-terminal regions. Varying effects of the 3 UTR have been observed by others for different potyviruses (Chu et al., 1999, and the references therein). Chu et al. (1999), reported that CP-based constructs containing the 3 UTR of Bean yellow mosaic virus (BYMV) did not confer resistance in subterranean clover, whereas CP only or CP core constructs did. In contrast, Cassidy and Nelson (1995) and our studies observed resistance phenotypes using constructs incorporating the 3 UTR of PStV in N. benthamiana and peanut, respectively. Studies of viral transgene-mediated resistance have shown that the resistance mechanism may be based on the expression of the transgene-encoded protein or be RNA-mediated (e.g., Lomonossoff, 1995). RNAmediated resistance may be affected by PTGS leading to the cytoplasmic degradation of transgene and viral RNA. The presence of multiple copies of a transgene has been associated with RNA-mediated resistance. Indeed, Goodwin et al. (1996) showed a correlation between gene copy number and phenotype – one copy of the transgene induced a slow recovery, whilst three induced high level resistance. Presence of at least three copies in all resistant lines and of complex multi-copy integration patterns including some aberrant partial copies presented in this study appears to support an RNA-mediated resistance mechanism (Scorza et al., 2001). However, multiple copies alone did not seem to be sufficient for a resistant phenotype because we also obtained multi-copy lines which were susceptible to PStV (Table 1). RNA-mediated protection has been linked to high level resistance and immunity (Goodwin et al., 1996), whereas protein-mediated protection has been associated with delayed symptoms and varying degrees of resistance (Lomonossoff, 1995). The CP2 transgene is an untranslatable form of the CP gene and thus would be expected to confer resistance via an RNA-mediated mechanism. Plants carrying this gene showed high level resistance to PStV infection, suggesting such a mechanism.
66 Further evidence for an RNA-mediated mechanism in highly resistant original transformants was provided by the presence of transgene-specific small RNAs (Figure 4(A)), which are indicators of PTGS-based transgenic virus resistance (Kalantidis et al., 2002). Presence of small RNAs in T2 progeny of the highly resistant 3/12.E4 line (Figure 4(B)) indicates heritability of the resistance. However, due to quarantine restrictions, this could not be confirmed by challenge inoculation of these progeny plants with PStV in Australia. The progeny of a CP2 line, challenged with PStV in Indonesia confirms segregation and heritability of the resistance provided by the CP2 transgene in T2 progeny (D. Hapsoro and Sudarsono, personal communication). The CP4 transgene can yield a protein product, but none was detected in any of the resistant lines. Plants carrying this transgene were either highly resistant or showed delayed symptoms. It is therefore likely that both transgenes provide protection against PStV infection by an RNA-mediated mechanism, although involvement of a protein-mediated mechanism for the CP4 transgene cannot be excluded. Interestingly, the CP of potyviruses has several functions in the viral replication process. These include virion assembly, aphid transmission, regulation of viral RNA amplification, and cell-to-cell as well as systemic movement functions in concert with other viral proteins (Revers et al., 1999; Urcuqui-Inchima et al., 2001). Transgenic expression of the PStV CP gene may therefore potentially interfere with one or several important stages in the viral life cycle. We also report the application of a robust transformation system for the transfer of commercially important genes into peanut. This species has been difficult to transform. Livingstone and Birch (1999) developed a transformation system based on microprojectile bombardment of somatic embryos. In this system, approximately, 50% co-expression was observed for the co-bombarded hygromycin and reporter genes. Co-transformation frequency was not reported but would be expected to be higher. Indeed from our study, we observed a 63 and 60% co-transformation frequency for CP2 and CP4, respectively. We also observed, approximately, 50% co-expression rate of the hygromycin resistance gene with the resistance phenotype. Livingstone and Birch (1999) also reported 53% of regenerated plants being fertile. All of the plants we tested for resistance produced seed under glasshouse conditions, indicating a high level of fertility using this method of transformation. These
findings are in contrast to Magbuana et al. (2000), who reported a 71% co-transformation frequency of cv. VC1, but only 31% for AT120. Further, none of the VC1 plants were fertile and only 13% fertility was observed in AT120 plants carrying both genes. The system of Livingstone and Birch (1999) has also proven useful for at least four different commercial cultivars since collaborating laboratories in China and Indonesia also use this system with their local peanut varieties (Xu, unpublished; Sudarsono, unpublished). We now report the use of this system for the transfer of genes of commercial relevance to peanut cvs. Gajah and NC7 and the regeneration of fertile plants with an agriculturally useful phenotype, that is, high level resistance to PStV. The high level resistance provided in a CP2 line was inherited for at least five generations in Indonesia (D. Hapsoro and Sudarsono, personal communication). These plants will be useful in peanut breeding programs for the transfer of the PStV resistance phenotype throughout commercial A. hypogaea germplasm. The genetic improvement of the major Indonesian cv. Gajah for PStV resistance is of particular significance, since this cultivar is also resistant to bacterial wilt, another economically important disease in southeast Asia (Mehan et al., 1994). Additional transgenes providing insect pest and fungal disease resistance have been introduced into various peanut germplasm sources (Singit et al., 1997; Rohini & Rao, 2001), and might be used for gene pyramiding for further cultivar improvement.
Acknowledgements We thank Phil LaBrie for technical assistance with peanut tissue culture and acclimatization, Pierre-Yves Teycheney for PStV constructs and Robert G. Birch for continued expert advice and helpful discussions. This work was supported by the Australian Centre for International Agricultural Research (ACIAR project 9439).
References Cassidy BG and Nelson RS (1995) Differences in protection phenotypes in tobacco plants expressing coat protein genes from peanut stripe potyvirus with and without an engineered ATG. Mol Plant Microbe Interact 8: 357–365. Chu PWG, Anderson BJ, Khan MRI, Shukla D and Higgins TJV (1999) Production of Bean yellow mosaic virus resistant subterranean clover (Trifolium subterraneum) plants by transformation with the viral coat protein gene. Ann Appl Biol 135: 469–480.
67 Clark MF and Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J Gen Virol 34: 475–483. Culver JN, Sherwood JC and Melouk HA (1987) Resistance to peanut stripe virus in Arachis germplasm. Plant Dis 71: 1080–1082. Demski JW, Reddy DVR, Sowell Jr G and Bays D (1984) Peanut stripe virus – a new seed-borne potyvirus from China infecting groundnut (Arachis hypogaea). Ann Appl Biol 105: 495–501. Fang G and Grumet R (1993) Genetic engineering of potyvirus resistance using constructs derived from the zucchini yellow mosaic virus coat protein gene. Mol Plant Microbe Interact 6: 358–367. Finer JJ, Vain P, Jones MW and McMullen MD (1992) Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Rep 11: 323–328. Fitch MMM, Manshardt RM, Gonsalves D, Slightom JL and Sanford JC (1992) Virus resistant papaya plants derived from tissues bombarded with the coat protein gene of papaya ringspot virus. Biotechnology 10: 1466–1472. Graham G, Mayers P and Henry RJ (1994) A simplified method for the preparation of fungal genomic DNA for PCR and RAPD amplification. BioTechniques 16: 48–50. Han Y and Grierson D (2002) Relationship between small antisense RNAs and aberrant RNAs associated with sense transgene mediated gene silencing in tomato. Plant J 29: 509–519. Higgins CM and Dietzgen RG (2000) Genetic transformation, regeneration and analysis of transgenic peanut. ACIAR Technical Report No. 48. Australian Centre for International Agricultural Research, Canberra. Higgins CM, Dietzgen RG, Mat Akin H, Sudarsono, Chen K and Xu Z (1999) Biological and molecular variability of peanut stripe potyvirus. Curr Topics Virol 1: 1–26. Higgins CM, Hall RM, Campbell PR and Dietzgen RG (2000) PCR rescue and analysis of transgene sequences directly from crude extracts of transgenic embryos and plants. Plant Mol Biol Rep 18: 285. ICRISAT (1988) Coordination of Research on Peanut Stripe Virus: Research on Peanut Stripe Virus Disease of Groundnut, 9–12 June 1987. Malang, Indonesia. ICRISAT, Pantcheru, India. Ingelbrecht IL, Irvine JE and Mirkov TE (1999) Posttranscriptional gene silencing in transgenic sugarcane. Dissection of homologydependent virus resistance in a monocot that has a complex polyploid genome. Plant Physiol 119: 1187–1198. James C (1998) Global review of commercialized transgenic crops. In: ISAAA Briefs No. 8. ISAAA, Ithaca, NY. Jan F-J, Pang S-Z, Fagoaga C and Gonsalves D (1999) Turnip mosaic potyvirus resistance in Nicotiana benthamiana derived by post-transcriptional gene silencing. Transgenic Res 8: 203–213. Jones AL, Johansen IE, Bean SJ, Bach I and Maule AJ (1998) Specificity of resistance to pea seed-borne mosaic potyvirus in transgenic peas expressing the viral replicase (Nlb) gene. J Gen Virol 79: 3129–3137. Kalantidis K, Psaradakis S, Tabler M and Tsagris M (2002) The occurrence of CMV specific short RNAs in transgenic tobacco expressing virus derived dsRNA is indicative of resistance to the virus. Mol Plant Microbe Interact 15: 826–833. Kochert G (1996) Molecular markers and genome mapping. In: Darussamin A (ed), Current Status of Agricultural Biotechnology in Indonesia. (pp. 89–108). Agency for Agricultural Research and Development, Jakarta. Li Z, Jarret RL and Demski JW (1997) Engineered resistance to tomato spotted wilt virus in transgenic peanut expressing the viral nucleocapsid gene. Transgenic Res 6: 297–305.
Lindbo JA and Dougherty WG (1992) Pathogen-derived resistance to a potyvirus: immune and resistant phenotypes in transgenic tobacco expressing altered forms of a potyvirus coat protein nucleotide sequence. Mol Plant Microbe Interact 5: 144–153. Livingstone MJ and Birch RG (1999) Efficient transformation and regeneration of diverse cultivars of peanut (Arachis hypogaea) by particle bombardment into embryogenic callus produced from mature seeds. Mol Breed 5: 43–51. Lomonossoff GP (1995) Pathogen-derived resistance to plant viruses. Annu Rev Phytopathol 33: 323–343. Magbanua ZV, Wilde HD, Roberts JK, Chowdhury K, Abad J, Moyer JW et al. (2000) Field resistance to tomato spotted wilt virus in transgenic peanut (Arachis hypogaea L.) expressing an antisense nucleocapsid gene sequence. Mol Breed 6: 227–236. Mehan VK, Liao BS, Tan YJ, Robinson-Smith A, McDonald D and Hayward AC (1994) Bacterial wilt of groundnut. Info Bull No. 35, ICRISAT, India. Restrepo MA, Freed, DD and Carrington JC (1990) Nuclear transport of plant potyviral proteins. Plant Cell 2: 987–998. Revers F, Le Gall O, Candresse T and Maule AJ (1999) New advances in understanding the molecular biology of plant/potyvirus interactions. Mol Plant Microbe Interact 12: 367–376. Rohini VK and Rao KS (2001) Transformation of peanut (Arachis hypogaea L.) with tobacco chitinase gene: variable response of transformants to leaf spot disease. Plant Sci 160: 889–898. Sambrook J, Fritsch EF and Maniatis T (1989) Molecular Cloning, a Laboratory Manual. 2nd edn, Cold Spring Harbour Laboratory Press, New York. Scorza R, Callahan A, Levy L, Damsteegt V, Webb K and Ravelondro M (2001) Post-transcriptional gene silencing in plum pox virus resistant transgenic European plum containing the plum pox potyvirus coat protein gene. Transgenic Res 10: 201–209. Singit C, Adang MC, Lynch RE, Anderson WA, Wang A, Cardineau G et al. (1997) Expression of a Bacillus thuringiensis cryIA gene in transgenic peanut plants and its efficacy against lesser cornstalk borer. Transgenic Res 6: 169–176. Smith HA, Powers H, Swaney S, Brown C and Dougherty WG (1995) Transgenic potato virus Y resistance in potato: evidence for an RNA-mediated cellular response. Phytopathology 85: 864–870. Sonoda S, Mori M and Nishigushi M (1999) Homology-dependent virus resistance in transgenic plants with the coat protein gene of sweet potato feathery mottle potyvirus: target specificity and transgene methylation. Phytopathology 89: 385–391. Teycheney P-Y and Dietzgen RG (1994) Cloning and sequence analysis of the CP gene of an Australian strain of peanut mottle and an Indonesian ‘blotch’ strain of peanut stripe potyviruses. Virus Res 31: 235–244. Urcuqui-Inchima S, Haenni A-L and Bernardi F (2001) Potyvirus proteins: a wealth of functions. Virus Res 74: 157–175. Waterhouse PM, Wang M-B and Lough T (2001) Gene silencing as an adaptive defence against viruses. Nature 411: 834–842. Wongkaew S and Dollet M (1990) Comparison of peanut stripe virus strains using symptomatology on particular hosts and serology. Oleagineaux 45: 267–278. Xu Z, Chen K, Zhang Z and Chen J (1991) Seed transmission of peanut stripe virus in peanut. Plant Dis 75: 723–726. Yang H, Singsit C, Wang A, Gonsalves D and Ozias-Akins P (1998) Transgenic peanut plants containing a nucleocapsid protein gene of tomato spotted wilt virus show divergent levels of gene expression. Plant Cell Reps 17: 693–699.
