World J Microbiol Biotechnol (2009) 25:205–213 DOI 10.1007/s11274-008-9882-4
ORIGINAL PAPER
Purification and characterization of an antimicrobial peptide produced by Pseudomonas sp. strain 4B Roberta Fontoura Æ Jordana Corralo Spada Æ Silvana Terra Silveira Æ Siu Mui Tsai Æ Adriano Brandelli
Received: 9 July 2008 / Accepted: 9 October 2008 / Published online: 25 October 2008 Ó Springer Science+Business Media B.V. 2008
Abstract An antimicrobial peptide produced by a bacterium isolated from the effluent pond of a bovine abattoir was purified and characterized. The strain was characterized by biochemical profiling and 16S rDNA sequencing as Pseudomonas sp. The antimicrobial peptide was purified by ammonium sulfate precipitation, gel filtration, and ion exchange chromatography. Direct activity on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) was observed. A major band on SDS-PAGE suggested that the antimicrobial peptide has a molecular mass of about 30 kDa. The substance was inhibitory to a broad range of indicator strains, including pathogenic and food spoilage bacteria such as Listeria monocytogenes, Bacillus cereus, Staphylococcus aureus, among other. The partially purified antimicrobial substance remained active over a wide temperature range and was resistant to all proteases tested. This substance showed different properties than other antimicrobials from Pseudomonas species, suggesting a novel antimicrobial peptide was characterized. Keywords Antimicrobial Bacteriocin Bioactive peptide Pyocin
R. Fontoura J. C. Spada S. T. Silveira A. Brandelli (&) Laborato´rio de Bioquı´mica e Microbiologia Aplicada, Departamento de Cieˆncia e Tecnologia de Alimentos, ICTA, Universidade Federal do Rio Grande do Sul, Av. Bento Gonc¸alves 9500, 91501-970 Porto Alegre, Brazil e-mail:
[email protected] S. M. Tsai Centro de Energia Nuclear na Agricultura, Universidade de Sa˜o Paulo, Piracicaba, Brazil
Introduction Production of antimicrobial substances seems to be a general phenomenon for most bacteria. An admirable array of microbial defense systems is produced, including broadspectrum classical antibiotics, metabolic by-products such as organic acids, and lytic agents such as lysozyme. In addition, several types of protein exotoxins, and bacteriocins, which are biologically active peptide moieties with bactericidal mode of action, were described (Riley and Wertz 2002; Yeaman and Yount 2003). Antimicrobial peptides have been isolated from many different kinds of organisms including bacteria, fungi, plants, arthropods, and vertebrates (Duax et al. 1996; Hancock and Chapple 1999). Bacteria produce ribosomally synthesized antimicrobial polypeptides generally called bacteriocins, and non-ribosomally synthesized peptides, such as gramicidins, polymixins, bacitracins and other (Hancock and Chapple 1999; Nissen-Meyer and Nes 1997). Gram-negative and Gram-positive bacteria produce small heat-stable bacteriocins. However, they are less frequent in Gram-negative bacteria, and Gram-positive lactic acid bacteria (LAB) seem to produce a large variety of such compounds (Diep and Nes 2002). Relatively few information is available on antimicrobial peptides produced by pseudomonads. Pseudomonas aeruginosa strains produce three types of bacteriocins, denominated pyocins (Michel-Briand and Baysse 2002). The R-type pyocins resemble non-flexible and contractile tails of bacteriophages, being composed of a contractile sheath, a core, and tail fibers. F-type pyocins also resemble phage tails, but they are curved rods with distal filaments, flexible and non-contractile. Both, R and F-type pyocins, are nuclease- and protease-resistant. S-type pyocins are like colicins in their structure, mode of action and protease-
123
206
sensitivity (Parret and De Mot 2002). They are constituted of two components: a large component that carries the killing activity and a small component that is an immunity protein. Although several bacteriocins are encoded on plasmids, pyocin genes are encoded exclusively on the chromosome. The production of pyocins is widespread in P. aeruginosa, but spontaneous production is low. The culture treatment with mutagenic agents, like ultraviolet irradiation and mitomycin C, greatly increases the production rate (Michel-Briand and Baysse 2002). In this study, a Pseudomonas sp. was isolated from the effluent pond of a bovine abattoir located at southern Brazil. This strain produces an antimicrobial substance with a broad inhibitory spectrum, including several pathogenic bacteria. The aim of this study was to determine some properties of this antimicrobial substance.
Materials and methods Reagents and media Agar-agar and de Man Rogosa Shape agar were from Vetec (Rio de Janeiro, Brazil), Brain Heart Infusion (BHI) broth was from Himedia (Mumbai, India), Trypticase Soy Broth (TSB) was from Mast Diagnostics (Merseyside, UK), Mu¨ller Hinton agar and bacteriological peptone were from Oxoid (Basingstoke, UK), and yeast extract was from Biobras (Montes Claros, Brazil). Papain and trypsin were from Merck (Darmstadt, Germany), pronase E was from Sigma (St. Louis, MO, USA) and proteinase K was from Invitrogen (Carlsbad, CA, USA). Isolation of microorganism The producer strain 4B was isolated from a lagoon where effluent from an abattoir is dumped, localized at Rio Pardo valley area, Brazil (28–29° S, 51° W). Samples were collected in sterile flasks from the top of 20 cm of water and diluted in peptone (0.1% w/v). After incubation for 24 and 48 h at 37°C, 1 ml of each suspension were inoculated onto BHI agar plates, incubated at 37°C, and single colonies were isolated and screened for antimicrobial activity. Taxonomical studies Bacteria were identified based on cytomorphological, biochemical and physiological tests (MacFaddin 2000). Morphological and physiological characteristics of the isolated bacterium were compared with data from Bergey’s Manual of Systematic Bacteriology (Krier and Holt 1984). The sequence of 16S rDNA was obtained after genomic extraction, PCR amplification and sequencing based on
123
World J Microbiol Biotechnol (2009) 25:205–213
previous work (Riffel et al. 2003). The bacterial 16S rRNA sequencing primers were 63f (50 CAGGCCTAACACATG CAAGTC 30 ), 907r (50 CCGTCAATTCCTTTGAGTTT 30 ) and 1389r (50 ACGGGCGGTGTGTACAAG 30 ), corresponding to Escherichia coli 16S rRNA gene position. PCR products were purified using the columns from Wizard PCR prep DNA purifications systems (Promega). Sequencing reactions were carried out in a 7.5 ll reaction volume with 15 ng of purified DNA, 1.5 ll of 1 lM primer 63f, 3 ll of BigDye Terminator 3.0 (ABI Prism, PE Applied Biosystems), and 0.5 ll of distilled water. The DNA was amplified using a Geneamp PCR System 2400 (Perkin Elmer, Norwalk, USA) by denaturation at 96°C (3 min), 30 cycles consisting of 94°C (1 min), 55°C (30 s) and 72°C (2 min), and a final extension step at 72°C (7 min). The PCR-amplified 16S rDNA was sequenced by the ABI Prism 377 DNA Sequencer (Perkin Elmer) based on fluorescent-labeled dideoxynucleotide terminators. The 1435-bp sequence was submitted to GenBank (bankit1088939, accession number EU692758). The BLAST algorithm was used to search for homologous sequences in GenBank. The sequence was reversed, aligned, and compared to similar database sequences using the softwares Clustal X 2.0 and GeneDoc (Nicholas and Nicholas 1997; Larkin et al. 2007). The phylogenetic tree was inferred from Jukes-Cantor distances using the neighbor-joining method (Saitou and Nei 1987) on the software PAUP* 4.0 (Swofford 1998). The branching pattern was checked by 1000 bootstrap replicates (Felsenstein 1985).
Production of antimicrobial substance For the production of antimicrobial substance, the strain 4B was grown in 100 ml TSB medium at 37°C in a rotary shaker at 125 cycles min-1 for desired times. Determination of the number of viable cells (cfu ml-1) was carried out as described by Motta and Brandelli (2002). After cultivation for 108 h, the cells were harvested by centrifugation at 10,000g for 15 min. The supernatant was precipitated with ammonium sulfate at 70% (w/v) saturation. The precipitate was dissolved in 10 mM Tris buffer pH 7.5 and denominated fraction I. This solution was further purified by gel filtration chromatography on Sephadex G-100 column. Two peaks exhibiting antimicrobial activity were separately pooled and denominated fractions II and III. Fraction II was applied to a DEAESepharose column, eluted with the same buffer followed by a gradient from 0 to 1 M NaCl. Fractions positive for antimicrobial activity were pooled and denominated as fraction IV. Fractions were also monitored for A280 nm using a spectrophotometer UV-mini 1240 Shimadzu (Tokyo, Japan). The determination of soluble protein was
World J Microbiol Biotechnol (2009) 25:205–213
carried out by the Folin phenol reagent method (Lowry et al. 1951), with bovine serum albumin as standard. Direct detection on polyacrylamide gels Antimicrobial activity was detected on polyacrylamide gels as described by Bizani et al. (2005). Briefly, the samples were applied to 12% polyacrylamide gels and run at 25 mA per gel, using a Mighty Small II apparatus (Hoefer Scientific, San Francisco, CA, USA). The gels were then washed with sterile distilled water to remove SDS and antimicrobial activity was tested on BHI agar plates inoculated with 106 cfu ml-1 Bacillus cereus ATCC 14579. Other gels were silver stained to observe peptide bands (Switzer et al. 1979). The kit BenchMarkTM protein ladder (Invitrogen, Carlsbad, CA, USA) was used as molecular weight standard, following the instructions of manufacturer. Antimicrobial activity Antimicrobial activity was determined by the agar-disk diffusion assay in both fractions of gel filtration chromatography (Motta and Brandelli 2002). An aliquot of 20 ll of partially purified antimicrobial substance was applied to disks (6 mm) placed on agar plates previously inoculated with a swab submerged in a indicator strain suspension which corresponded to a 0.5 McFarland turbidity standard solution. Plates were incubated at the optimal temperature of the test organisms (Table 1) and inhibitory zones were measured after 24 h. The antimicrobial activity titre was determined by the serial twofold dilution method previously described by Mayr-Harting et al. (1972). Activity was defined as the reciprocal of the dilution after the last serial dilution giving an inhibition zone and expressed as activity unit (AU) per mililitre. The AU ml-1 were determined against B. cereus ATCC 14579 as indicator strain. Effects of proteolytic enzymes, heat, pH and chemical substances on antimicrobial activity Samples of the antimicrobial peptide were treated with papain, trypsin, proteinase K or pronase E (Sigma, St. Louis, USA) at final concentrations of 2 and 10 mg ml-1 at 37°C for 1 h. An untreated cell-free supernatant and the enzyme in the buffer alone served as controls. To analyze thermal stability, aliquots of the peptide were exposed to temperatures ranging from 10 to 90°C for 30 min, 100°C for 10–60 min, 121°C for 15 min in a thermal block (Labnet International Inc., Woodbridge, NJ, USA), 121°C/105 kPa for 15 min, and frozen for up to 45 days.
207
Samples of the antimicrobial substance were incubated at different pH values (pH 2–11) for 30 min at 25°C, neutralized to pH 7.0, and tested for antimicrobial activity. Chemicals were added to the antimicrobial substance and the samples were incubated for 60 min at 37°C before being tested for antimicrobial activity. After treatments with TCA, samples were centrifuged at 10,000g for 5 min, pellet was solubilized in 10 mM Tris pH 8.0 and the supernatant was neutralized to pH 7.0, before testing for antimicrobial activity. After each treatment the samples were tested for antimicrobial activity against B. cereus ATCC 14579. Hydrolytic activities The assay of murein hydrolytic activity was carried out on peptidoglican agar plates (Beukes et al. 2000). Commercial lysozyme (Merck, Darmstadt, Germany) was used as positive control. To check whether the compound had lypolytic activity, the peptide was spotted onto tributyrin agar plates (Merck, Darmstadt, Germany), using commercial lipase (Novozymes, Bagsvaerd, Denmark) as the control. The proteolytic activity was assayed with azocasein as substrate (Riffel et al. 2003), using proteinase K as positive control. Hemolysis and hemmaglutination The hemolytic and hemmaglutination properties were verified using human erythrocytes, essentially as described elsewhere (Bizani and Brandelli 2001). Hemolysis was observed by visual inspection of human blood agar plates. An isolate of P. aeruginosa with known hemolytic activity was used as positive control. For hemagglutination tests, a volume of 50 ll was mixed with the same volume of a 6% (v/v) washed erythrocyte suspension on white porcelain tile. A negative control of erythrocytes suspension and PBS was done. The reactions were visualized in a bright-field microscope, and considered positive if agglutination occurred within 10–15 min incubation. Biosurfactant activity To analyze biosurfactant activity, fractions of the antimicrobial peptide were tested for determinate the emulsification index (Willumsen and Karlson 1997) with the following hydrocarbons: xylol, toluene, sunflower oil, hexane and mineral oil. The mixture contained 2 ml of the hydrocarbon and 2 ml of the antimicrobial peptide. Samples were homogenized for 2 min and allowed to stand for 24 h at room temperature. After this time the emulsifying index (E24) was determined by the following equation:
123
208 Table 1 Antimicrobial activity spectrum of antimicrobial peptide
World J Microbiol Biotechnol (2009) 25:205–213
Indicator organism
T (°C)
Inhibition zone (mm)
Bacillus cereus ATCC14579
37
15
Bacillus cereus 8A (soil isolate)
37
12
Gram-positive bacteria
Strains of the following microorganisms were not inhibited by both fractions: Aeromonas hydrophila ATCC7966, Escherichia coli ATCC25922, Salmonella enteritidis ATCC13076, Proteus vulgaris, Pseudomonas aeruginosa, Xanthomonas axenopodis, Enterobacter aerogenes, Streptococcus pneumoniae, Candida kefir, Malassezia paquidermathis
Bacillus subtilis (food isolate)
37
11
Corynebacterium fimi NCTC7547
37
12
Listeria monocytogenes ATCC7644
37
13
Listeria monocytogenes (food isolate)
37
8
Enterecoccus faecalis (food isolate)
37
8
Lactobacillus acidophilus ATCC4356
30
9
Leuconostoc mesenteroides (food isolate)
30
8
Pediococcus sp. (food isolate) Micrococcus luteus (clinical isolate)
30 37
14 15
Staphylococcus aureus ATCC25923
37
17
Staphylococcus aureus (food isolate)
37
15
Staphylococcus aureus (clinical isolate)
37
16
Staphylococcus haemolyticus (clinical isolate)
37
13
Staphylococcus intermedius (clinical isolate)
37
13
Streptococcus agalactiae (clinical isolate)
37
14
Streptococcus sp. (soil isolate)
37
10
Rhodococcus sp. (clinical isolate)
37
21
Escherichia coli (food isolate)
37
8
Salmonella gallinarium (clinical isolate)
37
8
Pasteurella haemolytica (clinical isolate)
37
10
Proteus mirabilis (clinical isolate)
37
10
Pseudomonas fluorescens (clinical isolate) Serratia marcescens (clinical isolate)
37 37
14 10
Salmonella sp. (food isolate)
37
13
Candida utilis CCT3469
25
10
Kluyveromyces marxianus CBS6556
25
7
Gram-negative bacteria
Yeast
E24 ¼ height of the emulsion layer= height of the total layer 100 Results Strain isolation and characterization The identification of the isolated strain 4B was based on cell and colony morphology, growth characteristics, biochemical tests and 16S rDNA sequence. Microscopic observation of the isolate showed a non-sporulating Gramnegative rod; the bacterium grew aerobically and formed typical blue-green, flat, large, grape-like odor colonies. The strain showed positive reactions for catalase, oxidase, citrate, nitrate, glucose, motility, and production of pyoverdin and pyocyanin. Negative reactions were
123
observed for indole, lactose and maltose, and oxidative in the O/F test. These phenotypic characteristics suggest the Pseudomonadaceae family, genus Pseudomonas. The genus determination based on physiological traits was confirmed by phylogenetic analysis of the 16S rRNA gene. The isolate 4B shared 98% sequence similarity with P. aeruginosa (EF102844) and 100% similarity with Pseudomonas thermaerum (AB088116) (Fig. 1). Bootstrap analysis resulted in relatively high values for the branching of 4B within the P. aeruginosa cluster. Production of antimicrobial substance Pseudomonas sp. 4B was aerobically incubated in TSBmedium at 30°C in a rotary shaker. It was observed that the pH values were nearly constant (pH 7.5–8.0) during cultivation. The maximum antibacterial activity was observed
World J Microbiol Biotechnol (2009) 25:205–213
Fig. 1 Phylogenetic position of strain 4B within the genus Pseudomonas. The branching pattern was generated by the neighbour-joining method. The number of each branch indicates the bootstrap values
209
II and III (Fig 3a). These fractions showed similar bands in the gel electrophoresis analysis, suggesting that both fractions have the same composition. Fraction II was further purified by ion exchange chromatography (DEAE-Sepharose), resulting in a single peak of antimicrobial activity (fraction IV, Fig. 3b). The results of the purification are summarized in Table 2. The final specific activity was approximately 35-fold greater than in the culture supernatant and the final recovery was 5.4%. The purified peptide was analyzed by SDS-PAGE, revealing a major band of about 30 kDa (Fig. 4a, lane 1). The antibacterial activity could be demonstrated by overlaying the other part of the gel, containing the same purified peptide, with media containing the indicator strain B. cereus ATCC 14579. An inhibitory zone was observed at the same region that was visualized in the silver stained gel (Fig. 4b, lane 4). When the crude preparation was analyzed, two broad inhibitory zones were observed, corresponding to about 30 kDa and to the bottom of the gel (Fig. 4b, lane 3).
from 108 h (Fig. 2). The production of antimicrobial activity started during the exponential grown phase, reaching maximum values at the stationary phase. Purification of antimicrobial substance The antimicrobial substance produced by P. aeruginosa 4B was partially purified from the culture supernatant by combination of ammonium sulfate precipitation, gel filtration, and ion exchange chromatography. The result of the gel filtration chromatography has showed the antimicrobial activity eluted in two peaks, denominated fraction
Fig. 2 Production of antimicrobial activity during growth of Pseudomonas sp. 4B in Trypticase Soy Broth medium at 30°C. Turbidity (black circles) and antibacterial activity (white circles) were monitored. Each point represents the mean of three independent experiments
Fig. 3 Bacteriocin purification from Pseudomonas sp. 4B. a Gel filtration chromatography on Sephadex G-100 column. b Ion exchange chromatography of the fraction II collected from the gel filtration column using a DEAE Sepharose column. –, Protein elution profile; d, antimicrobial activity; - - -, 0–1 M NaCl gradient
123
210
World J Microbiol Biotechnol (2009) 25:205–213
Table 2 Purification of an antimicrobial peptide produced by P. aeruginosa 4B Purification fold
Yield (%)
Step
Total protein (mg)
Total activity (AU)
Specific activity (AU mg-1)
Crude
291.3
119,200
409.2
1.0
100 8.0
Fraction I
9,600
812.2
1.9
Fraction II
11.8 4.03
12,000
2,963
7.3
10.1
Fraction IV
0.5
6,400
14,545
34.9
5.4
Antimicrobial spectrum The antimicrobial activity of the peptide was tested against a panel of bacteria and yeast. The results are shown in Table 1. Antimicrobial activity was observed against Gram-positive, Gram-negative bacteria and yeasts, including important pathogenic and spoilage microorganisms. The inhibitory activity was observed on B. cereus, Listeria monocytogenes, Staphylococcus aureus, Streptococcus agalactiae, Pseudomonas fluorescens, among other. B. cereus ATCC 14579 was used as indicator strain in subsequent experiments. Considering that a single antimicrobial substance was detected after purification (fraction IV), but it was obtained in small quantities, subsequent experiments were carried out with the partially purified substance from gel filtration chromatography (fraction II). Effects of enzymes, chemicals, temperature and pH The antimicrobial peptide present in fraction II was tested for sensitivity to several proteases, chemicals, heat and pH. The results are summarized in Table 3. Aliquots of antimicrobial substance were treated with trypsin, papain, pronase E, and proteinase K. The antimicrobial activity was partially lost only when treated with pronase E (Table 3). The effect of proteolytic enzymes was also tested on purified fraction IV, and the activity was partially lost after treatment with pronase E (remaining activity 70%). Fig. 4 Gel electrophoresis analysis of antimicrobial peptide. Samples of purified peptide after ion exchange chromatography (fraction IV, lanes 1 and 4), BenchMarkTM molecular weight standards (lane 2), and crude culture filtrate (lane 3) were run on 12% polyacrylamide gels. a Silverstained gel. b Washed gel overlaid with BHI inoculated with B. cereus and incubated for 24 h at 37°C
123
The antimicrobial peptide was active over a pH range of 3.0–10.0, remaining about 100% of its initial activity. The antimicrobial activity was also maintained after heat treatments. The initial activity remained at 90% after 121°C on thermal block and 70% after autoclaving (121°C, 105 kPa). Antimicrobial activity was not lost by cold or freezing storage (data not shown). The substance showed partial loss of activity after treatment with TCA, polysorbate 80 and urea. When treated with organic solvents, the antimicrobial activity was only affected by dimethyl sulfoxide (Table 3). Determination of other bioactivities The antimicrobial peptide was assayed for hemolytic and hemagglutination activities, resulting in positive hemolysis against human erythrocytes. The antimicrobial substance showed absence of biosurfactant activity against the hydrocarbons tested. Negative reactions for hemagglutination, muramidase, protease and lipase were also observed (data not shown).
Discussion In this work, a novel bacteriocin-producing bacterium was isolated and characterized. The strain 4B was identified based on phenotypic and genotypic characteristics. From the sequence analysis of the 16S rRNA gene, strain 4B was
World J Microbiol Biotechnol (2009) 25:205–213 Table 3 Effect of chemical substances on antimicrobial activity of partially purified fraction II using B. cereus ATCC 14579 as indicator strain Treatment
Concentration
Residual activity (%)
Untreated bacteriocin
–
100
Boiled 5 mina
–
100
Papain Trypsin
10 mg ml-1 10 mg ml-1
100 100
Proteinase K
10 mg ml-1
94
Pronase E
2 mg ml-1
85
10 mg ml-1
77
Acetone
50% (v/v)
83
Chloroform
50% (v/v)
87
Dimethyl sulfoxide
50% (v/v)
47
Ethanol
50% (v/v)
92
Methanol
50% (v/v)
98
Butanol
50% (v/v)
96
Isopropanol
50% (v/v)
86
Xylol
50% (v/v)
87
Toluene
50% (v/v)
80
EDTA
10 mM
71
Trichloroacetic acid Urea
10% (w/v) 4 mol l-1
63 58
8 mol l-1
58
Polysorbate 20
10% (v/v)
96
Polysorbate 80
10% (v/v)
34
Triton X-100
1% (v/v)
89
a
Control, after proteolytic treatment the antimicrobial peptide was boiled for 5 min at 100°C for protease inactivation
found to be clustered with the P. thermaerum. The strain 4B produces pyocyanin, a typical pigment of P. aeruginosa. Because these characteristics, this species can be assigned to the genus level as Pseudomonas sp. The strain 4B belongs to the genus Pseudomonas, which is a taxon with broad distribution on diverse environments. Pseudomonas are widespread distributed and abundant in wastewater (Becker et al. 1998; Hussein et al. 2005; Farhadian et al. 2008). The antimicrobial peptide produced by Pseudomonas sp. 4B was purified by sequential precipitation, gel filtration, and ion-exchange chromatography process. A major peptide band of about 30 kDa was observed by SDS-PAGE analysis, coinciding with antimicrobial activity. This molecular mass is close to the lectin-like bacteriocin LlpA from a Pseudomonas sp. isolated from banana rhizosphere (Parret et al. 2004). Similarly, P. fluorescens Pf-5 encodes the LlpA-like bacteriocins LlpA1Pf-5 and LlpA2Pf-5 with calculated molecular masses of 31,032 and 31,104 Da, respectively (Parret et al. 2005). The molecular mass of 4B is also close to some bacteriocins of unrelated bacteria, like 31 kDa linocin M18 from Brevibacterium linens (Valde´s-Stauber and
211
Scherer 1994) and 32 kDa albusin B from Ruminococcus albus, which shows moderate similarity to LlpA (Chen et al. 2004). An additional activity was observed at the bottom of the gel for the crude culture, indicating strain 4B also produces an antimicrobial compound of low molecular mass. Small antimicrobial substances have been described for Pseudomonas spp., such as the 2.4 kDa bacteriocin of Pseudomonas sp. R-10 (Hubert et al. 1998), pyoverdin and pyocyanin (Baron and Rowe 1981; Visca et al. 2007), these last are already produced by the strain 4B. However, the nature of this substance merits future investigation. The elution of the antimicrobial substance at the void volume in the gel filtration chromatography may indicate that it forms large aggregates. Some bacteriocins molecules present a substantial portion of hydrophobic residues and their association into large aggregates is possibly because of highly hydrophobic nature of the peptides (CladeraOlivera et al. 2004). Formation of aggregates can occur in natural conditions in which a large number of bacteria simultaneously produce antibiotics as the nutrients become limited. These aggregates can prevent diffusion and loss of the antibacterial activity, maintaining its concentration at high levels in the surrounding bacterial population (Motta et al. 2007). Bacteria can produce a variety of inhibitory substances. The pH values of the culture supernatants of the strain 4B indicate that the inhibitory effect was not due to production of organic acids. This antimicrobial substance was partially inactivated by TCA and pronase E, suggesting that a protein moiety is involved in the activity. Antimicrobial activity has been associated with molecules frequently exported by bacteria, such as hemolysins or hydrolytic enzymes (Helmerhorst et al. 1999; Parret and De Mot 2002). However, enzyme activities were not associated with the antimicrobial peptide from strain 4B. Although the antimicrobial peptide 4B showed hemolytic activity, its properties disagree with either the heat-sensitive hemolysin of higher molecular mass 76-78 kDa (Berka and Vasil 1982) or the heat-stable hemolysin composed by two hemolytic glycolipids (Johnson and Boese-Marrazzo 1980). Pseudomonas sp. 4B produces an antimicrobial substance that showed a broad inhibitory spectrum, including several spoilage and pathogenic microorganisms. In addition, the antimicrobial peptide presents a broad antimicrobial spectrum and is more heat-stable than classical pyocins produced by P. aeruginosa (Goodwin et al. 1972; Garcia-Quintana et al. 1979). The antimicrobial activity was resistant to all proteases tested. Protease activity was detected in the crude filtrate, but it was not deleterious to the antimicrobial activity. This indicates that the peptide was resistant to the extracellular proteases of Pseudomonas sp. 4B as well. Resistance to heat and enzymes resembles
123
212
World J Microbiol Biotechnol (2009) 25:205–213
the small 2.4 kDa bacteriocin of Pseudomonas sp. R-10 (Hubert et al. 1998). The bacteriocin isolated from P. syringae NCPPB2355 shown a narrow spectrum of activity and different molecular mass and sensitivity to heat and proteolytic enzymes when compared with Pseudomonas sp. 4B (Lavermicocca et al. 1999). Although the molecular mass of the peptide 4B is very close to bacteriocin LlpA (Parret et al. 2004), the resistance to heat and enzymes is very different (Parret et al. 2003). The antimicrobial peptide of Pseudomonas sp. 4B was more resistant to heat, proteolytic treatments and was stable over a wide pH range. This substance also showed different stability and lower molecular mass than other bacteriocins described for P. aeruginosa (Sano and Kageyama 1981; Sano et al. 1993; Michel-Briand and Baysse 2002). The size and protein stability data and the lack of enzymatic activity of antimicrobial peptide purified by ion exchange chromatography, suggest that this peptide is a novel inhibitory substance. Bacteriocins may play a defensive role to hinder the invasion of ecosystem of other strains or species into an occupied niche (Riley and Wertz 2002). Antibacterial substances produced by different bacteria seem to play an important role in the bacterial antagonism in aquatic ecosystems (Dopazo et al. 1988). The broad inhibitory spectrum of strain 4B may indicate an ecological advantage, since it would be capable to inhibit several competing bacteria. The role of antimicrobial substances produced by Pseudomonas sp. 4B is still under speculation. Pyocins of P. aeruginosa might ensure the predominance of a given strain in a bacterial niche against other bacteria of the same species (most strains are pyocinogenic), or against other species. The effect of pyocins is more likely to preserve the initial predominance of pyocinogenic bacteria against pyocin-sensitive cells (Michel-Briand and Baysse 2002). The rapid rise and spread of multi-resistant bacterial pathogens have forced the consideration of alternative methods of combating infections. Research for new substances with antimicrobial activity is a very important field. The identification and chemical characterization of antimicrobial substances produced by Pseudomonas sp. 4B, and exploration of their potential use in the control of pathogenic and spoilage microorganisms addresses this subject. Acknowledgement
This work was supported by CNPq, Brazil.
References Baron SS, Rowe JJ (1981) Antibiotic activity of pyocyanin. Antimicrob Agents Chemother 20:814–820 Becker PM, Wand H, Martius GG, Weissbrodt E, Stottmeister U (1998) Functional and structural successions in arbitrary samples of heterotrophic bacteria during aerobic treatments of lignite-
123
carbonization wastewater in in situ enclosures. Can J Microbiol 44:211–220. doi:10.1139/cjm-44-3-211 Berka RM, Vasil ML (1982) Phospholipase C (heat labile hemolysin) of Pseudomonas aeruginosa: purification and preliminary characterization. J Bacteriol 152:239–245 Beukes M, Bierbaum G, Sahl HG, Hastings JW (2000) Purification and partial characterization of a murein hydrolase, millericin B, produced by Streptococcus milleri NMSCC 061. Appl Environ Microbiol 66:23–29 Bizani D, Brandelli A (2001) Antimicrobial susceptibility, hemolysis, and hemmagglutination among Aeromonas spp. isolated from wates of a bovine abattoir. Braz J Microbiol 32:334–339. doi: 10.1590/S1517-83822001000400016 Bizani D, Dominguez APM, Brandelli A (2005) Purification and partial chemical characterization of the antimicrobial peptide cerein 8A. Lett Appl Microbiol 41:269–273. doi:10.1111/j.1472765X.2005.01748.x Chen J, Stevenson DM, Weimer PJ (2004) Albusin B, a bacteriocin from the ruminal bacterium Ruminococcus albus 7 that inhibits growth of Ruminococcus flavefaciens. Appl Environ Microbiol 70:3167–3170. doi:10.1128/AEM.70.5.3167-3170.2004 Cladera-Olivera F, Caron GR, Brandelli A (2004) Bacteriocin-like substance production by Bacillus licheniformis strain P40. Lett Appl Microbiol 38:251–256. doi:10.1111/j.1472-765X.2004. 01478.x Diep DB, Nes IF (2002) Ribossomally synthesized antibacterial peptides in Gram positive bacteria. Curr Drug Targets 3:107– 122. doi:10.2174/1389450024605409 Dopazo CP, Lemos ML, Lodeiros C, Bolinches J, Barja JL, Toranzo AE (1988) Inhibitory activity of antibiotic-producing marine bacteria against fish pathogens. J Appl Bacteriol 65:97–101 Duax WL, Griffin JF, Langs DA, Smith GD, Grochulski P, Pletnev V, Ivanov V (1996) Molecular structure and mechanisms of action of cyclic and linear ion transport antibiotics. Biopolymers 40:141–155. doi:10.1002/(SICI)1097-0282(1996)40:1\141::AIDBIP6[3.0.CO;2-W Farhadian M, Duchez D, Vachelard C, Larroche C (2008) Monoaromatics removal from polluted water through bioreactors—a review. Water Res 42:1325–1341. doi:10.1016/j.watres.2007.10.021 Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evol Int J Org Evol 39:783–791. doi:10.2307/ 2408678 Garcia-Quintana H, Asenjo S, Hernandez A, Polette M (1979) Determinacio´n cualitativa de la actividad de piocinas de Pseudomonas aeruginosa. Rev Med Chil 107:471–478 Goodwin K, Levin RE, Doggett RG (1972) Autosensitivity of Pseudomonas aeruginosa to its own pyocin. Infect Immun 6: 889–892 Hancock RE, Chapple DS (1999) Peptide antibiotics. Antimicrob Agents Chemother 43:1317–1323 Helmerhorst EJ, Reijnders IM, van’t Hof W, Veerman ECI, NiewAmerongen AV (1999) A critical comparison of the hemolytic and fungicidal activities of cationic antimicrobial peptides. FEBS Lett 449:105–110. doi:10.1016/S0014-5793(99)00411-1 Hubert E, Lobos O, Brevis P, Padilla C (1998) Purification and characterization of the bacteriocin PsVP-10 produced by Pseudomonas sp. J Appl Microbiol 84:910–913. doi:10.1046/j.13652672.1998.00400.x Hussein H, Farag S, Kandil K, Moawad H (2005) Tolerance and uptake of heavy metals by Pseudomonads. Process Biochem 40:955–961. doi:10.1016/j.procbio.2004.04.001 Johnson MK, Boese-Marrazzo D (1980) Production and properties of heat-stable extracellular hemolysin from Pseudomonas aeruginosa. Infect Immun 29:1028–1033 Krier NR, Holt JG (1984) Bergey’s manual of systematic bacteriology, vol 1. Williams & Wilkins, Baltimore
World J Microbiol Biotechnol (2009) 25:205–213 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948. doi: 10.1093/bioinformatics/btm404 Lavermicocca P, Lonigro SL, Evidente A, Andolfi A (1999) Bacteriocin production by Pseudomonas syringae pv. ciccaronei NCPPB2 355. Isolation and partial characterization of the antimicrobial compound. J Appl Microbiol 86:257–265. doi:10.1046/j.13652672.1999.00656.x Lowry OH, Rosenbrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the phenol reagent. J Biol Chem 193:265–275 MacFaddin F (2000) Biochemical tests for identification of medical bacteria. Williams & Wilkins, Baltimore Mayr-Harting A, Hedges AJ, Berkeley CW (1972) Methods for studying bacteriocins. In: Norris JR, Ribbons D (eds) Methods in microbiology. Academic Press, New York, pp 315–412 Michel-Briand Y, Baysse C (2002) The pyocins of Pseudomonas aeruginosa. Biochimie 84:499–510. doi:10.1016/S03009084(02)01422-0 Motta AS, Brandelli A (2002) Characterization of an antimicrobial peptide produced by Brevibacterium linens. J Appl Microbiol 92:63–71. doi:10.1046/j.1365-2672.2002.01490.x Motta AS, Lorenzini DM, Brandelli A (2007) Purification and partial characterization of an antimicrobial peptide produced by a novel Bacillus sp. isolated from Amazon basin. Curr Microbiol 54: 282–286. doi:10.1007/s00284-006-0414-x Nicholas KB, Nicholas HB (1997) GeneDoc: a tool for editing and annotating multiple sequence alignments. Multiple sequence alignment and shading utility, version 2.6.002. http://www.psc. edu/biomed/genedoc Nissen-Meyer J, Nes IF (1997) Ribosomally synthesized antimicrobial peptides: their function, structure, biogenesis, and mechanism of action. Arch Microbiol 167:67–77. doi:10.1007/s002030050 418 Parret AHA, De Mot R (2002) Bacteria killing their own kind: novel bacteriocins of Pseudomonas and other c-proteobacteria. Trends Microbiol 10:107–112. doi:10.1016/S0966-842X(02)02307-7 Parret AHA, Schoofs G, Proost P, De Mot R (2003) Plant lectin-like bacteriocin from a rhizosphere-colonizing Pseudomonas isolate. J Bacteriol 185:897–908. doi:10.1128/JB.185.3.897-908.2003
213 Parret AHA, Wyns L, De Mot R, Loris R (2004) Overexpression, purification and crystallization of bacteriocin LlpA from Pseudomonas sp. BW11M1. Acta Crystallogr D Biol Crystallogr 60:1922–1924. doi:10.1107/S0907444904020153 Parret AHA, Temmerman K, De Mot R (2005) Novel lectin-like bacteriocins of biocontrol strain Pseudomonas fluorescens Pf-5. Appl Environ Microbiol 71:5197–5207. doi:10.1128/AEM.71.9. 5197-5207.2005 Riffel A, Lucas F, Heeb P, Brandelli A (2003) Characterization of a new keratinolytic bacterium that completely degrades native feather keratin. Arch Microbiol 179:258–265 Riley MA, Wertz JE (2002) Bacteriocins: evolution, ecology, and application. Annu Rev Microbiol 56:117–137. doi:10.1146/ annurev.micro.56.012302.161024 Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:945–967 Sano Y, Kageyama M (1981) Purification and properties of an S-type pyocin, pyocin AP41. J Bacteriol 146:733–739 Sano Y, Matsui H, Kobayashi M, Kageyama M (1993) Molecular structures and functions of pyocins S1 e S2 in Pseudomonas aeruginosa. J Bacteriol 175:2907–2916 Switzer RC, Merril CR, Shifrin SA (1979) Highly sensitive silver stain for detecting proteins and peptides in polyacrilamide gels. Anal Biochem 98:321–237 Swofford DL (1998) PAUP* phylogenetic analysis using parsimony (*and other methods) version 4. Sinauer Associates, Sunderland Valde´s-Stauber N, Scherer S (1994) Isolation and characterization of Linocin M18, a bacteriocin produced by Brevibacterium linens. Appl Environ Microbiol 60:3809–3814 Visca P, Imperi F, Lamont IL (2007) Pyoverdine siderophores: from biogenesis to biosignificance. Trends Microbiol 15:22–30. doi: 10.1016/j.tim.2006.11.004 Willumsen PA, Karlson U (1997) Screening of bacteria isolated from PAH-contaminated soils for production of biosurfactants and bioemulsifiers. Biodegradation 7:415–423. doi:10.1007/BF000 56425 Yeaman MR, Yount NY (2003) Mechanism of antimicrobial peptide action and resistance. Pharmacol Rev 55:27–55. doi:10.1124/ pr.55.1.2
123
