ISSN 00268933, Molecular Biology, 2013, Vol. 47, No. 6, pp. 879–884. © Pleiades Publishing, Inc., 2013. Original Russian Text © O.A. Vasil’eva, V.D. Yakushina, N.V. Ryazantseva, V.V. Novitsky, L.A. Tashireva, E.G. Starikova, A.P. Zima, T.S. Prokhorenko, T.Yu. Krasnova, I.S. Nebesnaya, 2013, published in Molekulyarnaya Biologiya, 2013, Vol. 47, No. 6, pp. 1004–1010.

CELL MOLECULAR BIOLOGY UDC 616008.853.2:576.5:577.11:576.385.5

Regulation of Gene Expression of CD4+ T Lymphocyte Differentiation Transcription Factors by Galectin3 in vitro O. A. Vasil’eva, V. D. Yakushina, N. V. Ryazantseva, V. V. Novitsky, L. A. Tashireva, E. G. Starikova, A. P. Zima, T. S. Prokhorenko, T. Yu. Krasnova, and I. S. Nebesnaya Siberian State Medical University, Tomsk, 634050 Russia; email: Vasiljeva[email protected] Received June 25, 2013; in final form, July 15, 2013

Abstract—Several groups of CD4+ T lymphocytes, known as Th1, Th2, Treg, and Th17, have currently been identified and well studied. Methods based on targeted regulation of differentiation of Th lymphocytes, which perform the immune response polarization, attract attention of scientists dealing with correction of immune mediated diseases. In the present study, endogenous βgalactosidebinding protein of the lectin family, galec tin3, was investigated as a regulator of Tcell homeostasis. Galectin3 is known to be actively produced by tumor cells in malignant transformation and able to influence the processes of signal transduction, cell–cell cooperation, and the implementation of programmed cell death. As cell differentiation processes are directly connected with the regulation of gene expression, we investigated the effect of recombinant galectin3 on expression of mRNA of transcription factors that guide differentiation of CD4+ lymphocytes. The study was performed using mononuclear cells from the peripheral blood of healthy individuals. The levels of gene expres sion were evaluated by realtime PCR. In the in vitro experiments, recombinant galectin3 (0.5 mg/mL) up regulated mRNA expression of transcription factors Gala3 and Rorc and downregulated mRNA expression of transcription factors Tbet and FoxP3. Up to a concentration of 1 μg/mL, recombinant galectin3 stimulated Thcell in a dosedependent manner, whereas at higher concentrations, the stimulating effect weakened and inhibitory effect started prevailing. Thus, one can suppose that, through the regulation of lymphocyte differ entiation, galectin3 promotes the development of allergic, autoimmune, and neoplastic diseases, which allows us to consider galectin3 as a potential target for therapy of these diseases. DOI: 10.1134/S0026893313060150 Keywords: galectin3, lymphocyte differentiation, transcription factors, Thelpers

The wide range of diseases associated with the impaired regulation of the immune system determine the urgent need for studies in search for new technol ogies that allows for the selective modulation of activ ity of different populations of immunocompetent cells. Interest in galectin studies is due to the fact that the proteins are involved in many processes associated with cell vital functions, i.e., the regulation of the cell cycle, intercellular adhesion, and signal transduction. Besides, some galectins are markers of cell transfor mation and mediate inflammation [1, 2]. Galectin3 is a lowmolecular protein of 30 kDa [3] belonging to the family of animal lectins capable of βgalactose recog nition. It comprises two functional domains. Ntermi nal domain performs regulatory function. It contains many peptide sequence repeats reach in proline, gly cine, and tyrosine [4]. The Cterminal domain of galectin3 is carbohydrate binding [5]. Galectin3 is secreted by cells of the lymph nodes, thymus, and spleen, as well as lymphocytes, macrophages, den drite, and tumor cells [1, 6, 7]. Abbreviations: Th, helper T lymphocyte; Treg, regulatory T lym phocyte.

Today, galectin3 is considered to be a marker of tumor transformation. Its involvement in the regula tion of all stages of tumor progression has been dem onstrated, i.e., it promotes the tumor transformation of cells, stimulates their proliferation, mediates adhesion and aggregation to extracellular matrix, increases migra tion capability, and enhances angiogenesis [1, 6, 8]. Galectin3 studies are mainly aimed at evaluating the relationship between the presence of galectin3 and the rate of a cell’s malignant transformation of a cell. However, the literature data indicate that galec tin3, along with other representatives of the family, may influence immune response and, thus, promote the escape of immunological surveillance by tumor cells. Studies of the regulatory mechanisms of galectin3 effects on helper Tlymphocytes (Th) is essential for problems of applied medicine, as well as to acquire knowledge on immune response modulation by this protein, which will lay the groundwork for new phar macology approaches to treating oncological diseases accompanied by increased levels of galectin3 secre tion.

879

880

VASIL’EVA et al.

% 100 90 80 70 60 50 40 30 20 10 0

1

0.5

1.0

2.0

2 2.5

Concentration of recombinant galectin3, μg/mL Fig. 1. Number of apoptotic (1, annexin +7AAD+) and viable (2, annexin –7AAD–) lymphocytes in function of con centration of recombinant galectin3 in culture medium.

Since cell differentiation, including differentiation of subpopulation of helper T cells, rely on processes associated with regulation of gene expression, in this work, we focused on studying the effects of recombi nant galectin3 on the level of mRNA expression of transcription factors genes determining directions of CD4+ lymphocyte differentiation. MATERIALS AND METHODS In the study, we used the peripheral blood of healthy individuals of both genders (n = 15) who were, on average, 26 ± 4 years old. Fasting blood samples of 20 mL were collected in the morning from median cubital vein into vacuum tubes over anticoagulant (К3EDTA). Mononuclear leukocytes were isolated from blood by gradient centrifugation [9]. The number of isolated cells was standardized to 2.0 × 106/mL by diluting with complete nutrient medium comprising 90% RPMI1640 (ZAO Vektor, Russia), 10% inacti vated embryonic fetal bovine serum (JSC Biolot, Rus Table 1. Nucleotide sequences of primers used to evaluate gene expression of CD4+ T lymphocyte transcription factors Gene tbx21 gata3 rorc foxp3 βactin

Sequence of nucleotides in forward (F) and reverse (R) primers F: 5'CCAACACGCATATCTTTACTTTCC3' R: 5'ACTCAAAGTTCTCCCGGAATC3' F: 5'GCGGGCTCTATCACAAAATG3' R: 5'TCCCCATTGGCATTCCTC3' F: 5'TGGTGCTGGTTAGGATGTG3' R: 5'GGAGTGGGAGAAGTCAAAGATG3' F: 5'CTGGCAAATGGTGTCTG3' R: 5'GTGCCCTGCCCTTCTCAT3' F: 5'CATTTCCGAAGCGAGTGTCT3' R: 5'GAGCGATTCCGGACTACCTT3'

sia), 0.3 mg/mL Lglutamine, and 50 µg/mL gentam icin. Cultured cells were inoculated into special 48well sterile plates with a cover (BD FalconTM, United States). Determination of effective galectin3 dose. The abil ity of recombinant galectin3 (RnDSystems, United States) to induce apoptosis in lymphocytes was evalu ated in the range of concentrations of 0.1–5.0 µg/mL. Galectin3 was introduced into culture medium for mononuclear leukocytes, and cells were incubated at 37°С in the atmosphere of 5% СО2 for 18 h. The number of apoptotic lymphocytes was determined with an Annexin V Apoptosis Detection kit I (BD Pharmingen, United States) on a BD FacsCantoII flow cytometer. The number of lymphocytes having bound double label (Annexin+7AAD+) and the num ber of viable cells (Annexin–7AAD–) were registered (Fig. 1). For further experiments, two concentrations of recombinant galectin3, 0.5 and 1.0 µg/mL, were chosen. Cultivation of mononuclear leukocytes with galec tin3. Isolated cells were cultured for 72 h with recom binant galectin3 (0.5 and 1.0 µg/mL) together with activating monoclonal antibodies: antiCD3 and anti CD28 (BD Pharmingen) at concentrations of 1 and 2 µg/mL, respectively. Four hours before the incuba tion was terminated, stimulators, i.e., phorbol myristyl acetate (50 ng/mL) and calcium ionomycin (1 µg/mL), were added to cell culture. Then, cells and the medium were transferred to test tubes and centrifuged for 10 min at 1500 rpm. Supernatant was removed, and precipitated cells were used to isolate RNA. Mononu clear leukocytes cultured under similar conditions without the addition of galectin3 in the nutrient medium were used as control. Quantitative determination of mRNA expression. The isolation of RNA from mononuclear leukocytes was performed by sorbent–column method according to the manufacturer’s instructions (RNeasy Plus Mini Kit, Qiagen, Germany). Using reverse transcriptase MMuLVRT (Promega, United States), we synthe sized cDNA of relevant mRNA. The cDNA fragment was then amplified by realtime PCR using intercalat ing fluorescent dye SYBR Green I (Medigen, Russia) on a Mini Opticon (BioRad, United States) ampli fier. Primers that allow for the specific amplification of cDNA of gene fragments are presented in Table 1. Amplification of each of the sample series was accom panied by internal control, namely the mixture of cDNA isolated from cells of 20 healthy donors (five twofold dilutions in two repeats). The quality of amplification reaction was considered acceptable if the following conditions were met: —Сt value (number of cycles before kinetic curve reaches the threshold level) variation exceeded 0.5 cycles; —correlation index between calculated values of cDNA (five consecutive twofold dilutions) and experimental values for five points is more than 0.95; MOLECULAR BIOLOGY

Vol. 47

No. 6

2013

REGULATION OF GENE EXPRESSION OF CD4+ T LYMPHOCYTE

881

Table 2. Level of mRNA expression of CD4+ T lymphocyte transcription factors under the effect of recombinant galectin3 mRNA expression rate, Me(Q25–Q75)*

Gene control tbx21 gata3 rorc foxP3

5.35(2.89–6.88) 1.61(0.29–10.06) 0.24(0.09–0.35) 0.32(0.17–0.99)

galectin3 dose of 0.5 µg/mL

galectin3 dose of 1.0 µg/mL

1.11(0.74–1.85) P = 0.011 4.11(1.57–14.21) P = 0.011 0.43(0.14–0.74) P = 0.026 0.17(0.06–0.23) P = 0.011

2.09(0.56–2.98) P = 0.011 2.61(0.41–6.04) P = 0.325 0.15(0.05–0.25) P = 0.325 0.23(0.11–0.33) P = 0.011

* Results are reported as median (Me) values and interquartile spread (Q25–Q75); P is the level of statistical significance of differences with control.

—amplification reaction efficiency was above 90%; —amplification reaction was specific (no addi tional peaks on melting curve). The temperature of primer melting was determined empirically in the course of PCR performed in the mode when temperature gradient may be controlled over the amplifier block. The temperature of amplifi cation product melting was calculated based on an analysis of the melting curve. The ΔΔCt method was used to determine the relative amount of cDNA in the sample. The results were expressed in arbitrary units as the ratio between the number of threshold amplifica tion cycle of studied gene to the number of threshold amplification cycle of a housekeeping gene, β actin. The normalcy of the distribution of results was evaluated using the Shapiro–Wilk test. The signifi cance of differences (Р < 0.05) was evaluated with nonparametric Wilcoxon criterion for dependent sam ples. Data are presented as median (Me) and upper and lower quartiles (Q25–Q75). RESULTS By now, it has been found that the development of Th1 cells is determined by the transcription factor Tbet [10], while that of Th2 cells is determined by factor Gata3 [11], the development of Th17 cells is determined by the Rorc factor [12], and the develop ment of T regulatory cells (Treg) is determined by fac tor FoxP3 [13, 14]. These factors are encoded by genes tbx21, gata3, rorc, and foxP3, which are expressed almost exclusively in cells of corresponding T lympho cyte subpopulations. For example, tbx21 gene is spe cific only for Th1 lymphocytes and foxP3 for Treg cells. Genes gata3 and rorc may be expressed in vari ous cells of the organism; however, in blood, they only control the development of Th2 and Th17 lympho cytes. This allows for the evaluation of the expression of these factors in total mononuclear leukocyte frac tion without its further fractionation [13, 14]. Figure 2 presents an example of PCR application for evaluating the transcription factors’ mRNA expression. Our study demonstrated that the expression level of transcription factor Tbet responsible for Th1 lym phocyte differentiation in control group was 5.34 AU. MOLECULAR BIOLOGY

Vol. 47

No. 6

2013

Treatment with galectin3 at concentrations of 0.5 µg/mL and 1 µg/mL resulted in 4.8 and 2.5fold decrease in Tbet mRNA level (to 1.11 and 2.09 AU), respectively, which is statistically different from values in control group (Р < 0.05; Table 2). The addition of galectin3 at a concentration of 0.5 µg/mL to culture medium resulted in 2.5fold increase (Р = 0.011) in the mRNA expression level of Gata3 transcription factor in lymphocytes with respect to control group. The stimulatory effect decreased upon an increase in the concentration of galectin3 to 1 µg/mL and the level of mRNA expres sion did not differ significantly from the control level (Table 2). An analysis of the data demonstrated that mRNA expression level of the Rorc factor characteristic of Th17 lymphocytes upon treatment with 0.5 µg/mL galectin3 was 0.43 AU, which is significantly (Р = 0.026) higher than that of the control group (0.24 AU). Upon the addition of 1 µg/mL galectin3, Rorc mRNA expression level was 0.15 AU, which is lower than the control value, but is not statistically reliable (Р = 0.3245, Table 2). The influence of the lectin under study on regula tory T lymphocyte differentiation was evaluated based on the mRNA expression of the FoxP3 transcription factor. In the control, FoxP3 mRNA level corre sponded to 0.32 AU, while galectin3 at concentra tions of 0.5 µg/mL and 1.0 µg/mL induced 1.8 and 1.6fold decrease in FoxP3 expression, to 0.17 and 0.23 AU, respectively (Р < 0.05; Table 2). Therefore, at a concentration of 0.5 µg/mL, recombinant galectin3 induces the activation of gene expression of Rorc and Gata3 transcription factors and the suppression of gene expression of reciprocal transcription factors FoxP3 and Tbet in vitro. It should be noted that with the increase in recombinant galectin3 concentration to 1 µg/mL, its stimulatory effect weakens and the inhibitory effect starts to pre vail. DISCUSSION Diseases accompanied by increased levels of endogenous galectin3 in the organism are mostly rep

882

VASIL’EVA et al. (a) 1.00 0.75 0.50

Fluorescence intensity

0.25 0 5

10

15

20

25

30

35

25

30

35

(b) 0.50

0.25

0 5

10

15

20 Cycle

Fig. 2. Accumulation curves of gene amplification products. (a) Reference gene, βactin; (b) transcription factor gene rorc.

resented by malignant neoplasms [8]. Galectin3 not only plays a role in metastasis [6, 8], but may also modulate the differentiation of Th lymphocytes, which favors the escape of transformed cells from immune surveillance. As follows from the analysis of the results, the acti vation of one Th lymphocyte population and the sup pression of a functionally opposite cell group occurs under the effect of galectin3. For example, an increase in the level of mRNA expression of transcrip tion factor Gata3 under the effect of galectin3 is accompanied by a decrease in the mRNA expression of another transcription factor, Tbet. It is known that Gata3 causes considerable competition between the Th2 cells with other subpopulations of helper T cells. It actively inhibits the expression of the tbx21 gene, which determines the development of Th1 lympho cytes, and ifng gene, which codes for its major product, interferon γ [15]. The suppressive effect of galectin3 on Th1 type of immune response was demonstrated by Bernardes et al. [16] in experiments on mice deficient in the galectin3 gene (lgals3–/–). It turned out that dendrite cells of knockout animals produce consider ably more IL12 compared to wildtype cells, which indicates the negative effect of galectin3 on the pro duction of the cytokine [16]. Since IL12 is necessary

for the stimulation of the Th1 response, the results mean that galectin3 may suppress the Th1 pathway through the impairment of cytokine regulation between dendrite cells and T lymphocytes, which allows for tumor cells to remain unnoticed by cells of the immune system. The imbalance between Th1 and Th2mediated immune reactions towards the domination of the Th2 pathway is considered to be a key factor in the forma tion of a disposition to the development of immediate hypersensitivity reactions. The weakening of tbx21 gene expression is related to bronchial hyperrespon siveness and associated with bronchial asthma, which is correlated with the hyperproduction of Th2 cytok ines [17]. Galectin3 involvement in Th2 polarization of immune response was demonstrated in vivo experi ments in galectin3 knockout mice (lgals3–/–) with atopic dermatitis. Considerably decreased level of IgE was registered in the animals compared to wildtype animals (lgals3+/+), while immune response developed via Th1 pathway. Authors supposed that galectin3 plays an important role in the development of Th2 response in atopic dermatitis [18]. Therefore, data on galectin3 effect on Th1/Th2 polarization of immune response obtained using knockout mice agree with our evaluation of the MOLECULAR BIOLOGY

Vol. 47

No. 6

2013

REGULATION OF GENE EXPRESSION OF CD4+ T LYMPHOCYTE

expression of transcription factors Tbet and Gata3 under the effect of galectin3 in vitro. It is known that Treg cells may prevent allergies at various stages of pathogenesis, including the sensitiza tion, progression, remodeling, hyperresponsiveness of airways, and allergic inflammation persistence. Our data indicate a suppressor effect of galectin3 on Treg, which is manifested through the suppression of mRNA expression of gene foxp3. FoxP3 is a transcrip tion factor that not only controls the expression of cer tain genes, but also stabilizes patterns of expressed genes and genes available for induction, that is, it induces the differentiation of Treg cells [19]. Accord ing to modern perceptions, Treg factors provide for peripheral immunologic tolerance to autoantigens, which prevents the development of autoimmune dis eases; they also suppress the proliferation of various clones of helper T cells, which control the excessive reaction of immune cells to antigen; furthermore, they remove autoreactive lymphocytes, which control the intensity and duration of immune response through regulation of effector T cell functions. Finally, they suppress the antitumor immune response, which pro motes tumor progression [20, 21]. According to our results, the negative effect of galectin3 on Treg cells may promote the development of autoimmune dis eases. In a model of experimental autoimmune encephalomyelitis, Jiang et al. [22] demonstrated that knockout mice (lgals3–/–) develop a less severe form of the disease compared to wildtype mice, while the level of infiltration of nervous system by macrophages and dendritic cells is lower compared to control. Fur thermore, in knockout mice, the low production of antiinflammatory cytokines by both isolated T cells and nervous tissue was observed. In addition, a high content of FoxP3+Tregs was detected in the spleen and nervous tissue of these mice. Researchers sug gested that immunosuppressive effect of Treg cells should cause light form of autoimmune process in lgals3–/– mice, while galectin3 is involved in the deve lopment of Treg lymphocytes and has an antiinflamma tory effect on autoimmune encephalomyelitis. The ratio between the numbers of Th17 and Treg cells plays crucial role in the development of autoim mune diseases. Spontaneous type I diabetes in diabe tesprone BioBreeding rats (DPBB) has been shown [23] to be caused by misbalance between subpopula tions of Th17 and Treg cells. Treg and Th17 are mutu ally regulated by positive and negative regulatory net works. The equilibrium between the expression of transcription factors Rorc and FoxP3 is a key factor that determines the differentiation of naive CD4+ lym phocytes into either Treg of Th17. According to our results, galectin3 decreases mRNA expression of the Rorc transcription factor in lymphocytes in vitro. A growing body of data is being accumulated on the role of Th17 lymphocytes in various pathological condi tions. The pathogenetic role of Th17 and the cytokines they produce in the progression of autoimmune dis MOLECULAR BIOLOGY

Vol. 47

No. 6

2013

883

eases, primarily autoimmune colitis, Crohn’s disease, multiple sclerosis (in a mouse model of experimental autoimmune encephalomyelitis), rheumatoid arthri tis, and psoriasis, has been established. The expression of rorс gene is increased in various allergic conditions, in particular in allergic asthma in humans with increased rorс expression that corresponds to more severe diseases [14]. In a mouse autoimmune hepatitis model, galectin3 has been shown to enhance IL17A production; to decrease the IL10 concentration; to promote the activation of Tlymphocytes, NK, and dendritic cells; and to induce the apoptosis of mono nuclear leukocytes, which is accompanied by increased severity of the condition [24]. The involvement of Th17 lymphocytes in tumor progression is an issue worthy of attention because of their ability to secrete cytokines with pronounced antiinflammatory and damaging effects, as well as due to the involvement of IL17 in neovascularization of tumors [25]. According to our data, galectin3 acti vates expression of the Rorc transcription factor, which is responsible for the differentiation of Th17 lymphocyte in vitro and, thus, can favor the progres sion of diseases, in the pathogenesis of which the Th17 cell population plays a role. The results broaden modern concepts on the molecular mechanisms of the modulating effects of galectin3 on Tlymphocyte functions. The establish ment of the nature of factors that control the func tional activity of T cells involved in the pathogenesis of autoimmune, allergic, and tumor diseases consider ably broadens the spectrum of targets for pharmaco logical treatment. ACKNOWLEDGMENTS The study was supported by the Ministry of Educa tion and Science of the Russian Federation in frames of the Federal Target Program “Scientific and Scien tificTeaching Staff of Innovative Russia” for 2009–2013 (project no. 16.740.11.0636; agreement no. 8302), as well as the Council on Grants of the President of the Russian Federation (project nos. 16.120.11.614NSh and 16.120.11.1233MD) and Russian Foundation for Basic Research (project no. 120431224 mol_a). REFERENCES 1. Vasil’eva O.A., Yakushina V.D., Ryazantseva N.V., Novitsky V.V. 2011. Prospects for using galectin3 in laboratory diagnosis: A minireview. Klin.Lab. Konsi lium. 38, 12–16. 2. Yakushina V.D., Vasil’eva O.A., Ryazantseva N.V., et al. 2012. Galectin1: Role in formation of specific features of innate and acquired immunity. Med. Immunol. 14, 21–32. 3. Dumic J., Dabelic S., Flögel M. 2006. Galectin3: An openended story. Biochim. Biophys. Acta. 1760, 616– 635.

884

VASIL’EVA et al.

4. Maldonado C.A., Sundblad V., Salatino M., Elia J., Garcia L.N., Leimgruber C., Croci D.O., Rabinovich G.A. 2011. Celltype specific regulation of galectin3 expres sion by glucocorticoids in lung Clara cells and mac rophages. Histol. Histopathol. 26, 747–759. 5. Krzeslak A., Lipinska A. 2004. Galectin3 as a multi functional protein. Cell. Mol. Biol. Lett. 9, 305–328. 6. Rapoport E.M., Kurmyshkina O.V., Bovin N.V. 2008. Mammalian galectins: Structure, carbohydrate speci ficity, and functions. Biochemistry (Moscow). 73, 393– 405. 7. Lippert E., Gunckel M., Brenmoehl J., Bataille F., Falk W., Scholmerich J., Obermeier F., Rogler G. 2008. Regula tion of galectin3 function in mucosal fibroblasts: Potential role in mucosal inflammation. Clin. Exp. Immunol. 152, 285–297. 8. Liu F.T., Rabinovich G.A. 2005. Galectins as modula tors of tumour progression. Nature Rev. Cancer. 5, 29–41. 9. Goldberg E.D., Dygai A.M., Shakhov V.P. Metody kul’tury tkanei v gematologii (Tissue Culture Methods in Hematology). Tomsk: Tomsk. Gos. Univ. 10. Szabo S.J., Kim S.T., Costa G.L., Zhang X., Fathman C.G., Glimcher L.H. 2000. A novel transcription factor, Tbet, directs Th1 lineage commitment. Cell. 100, 655–669. 11. Ko L.J., Engel J.D. 1993. DNAbinding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13, 4011–4022. 12. Manel N., Unutmaz D., Littman D.R. 2008. The dif ferentiation of human T(H)17 cells requires trans forming growth factorbeta and induction of the nuclear receptor RORgammat. Nature Immunol. 9, 641–649. 13. Donetskova A.D., Nikonova M.F., Yarilin A.A. 2011. Expression of genes for transcription factors controlling differentiation of adaptive CD4+ Tlymphocyte sub populations in quiescent and activated T lymphocytes of healthy subjects. Immunologiya. 4, 184–188. 14. Yarilin A.A. 2010. Transcriptional regulators of Thelper cell differentiation. Immunologiya. 3, 153–168. 15. McMillan R.E., Sikes M.L. 2009. Promoter activity 5' of Dbeta2 is coordinated by E47, Runx1, and GATA3. Mol. Immunol. 46, 3009–3017.

16. Bernardes E.S., Silva N.M., Ruas L.P., et al. 2006. Tox oplasma gondii infection reveals a novel regulatory role for galectin3 in the interface of innate and adaptive immunity. J. Pathol. 168, 1910–1920. 17. Suzuki K., Kaminuma O., Hiroi T., et al. 2008. Down regulation of IL13 gene transcription by Tbet in human T cells. Int. Arch. Allergy Immunol. 1, 33–35. 18. Saegusa J., Daniel K., Chen H. Y., Yu L., Fermin A., Fung M.A., Liu F.T. 2009. Galectin3 is critical for the development of the allergic inflammatory response in a mouse model of atopic dermatitis. Am. J. Pathol. 174, 922–931. 19. Roncador G., Brown P.J., Maestre L. et al. 2005. Anal ysis of FoxP3 protein expression in human CD4+CD25+ regulatory T cells at the signalcell level. Eur. J. Immunol. 35, 1681–1691. 20. Jang E., Cho M.L., Oh H.J., Youn J. 2011. Deficiency of Foxp3+ regulatory T cells exacerbates autoimmune arthritis by altering the synovial proportions of CD4+ T cells and dendritic cells. Immune Netw. 5, 299–306. 21. Faustino L., Mucida D., Keller A.C., et al. 2012. Reg ulatory T cells accumulate in the lung allergic inflam mation and efficiently suppress Tcell proliferation but not Th2 cytokine production. Clin. Dev. Immunol. 2012, doi 10.1155/2012/721817 22. Jiang H.R., Al Rasebi Z., MensahBrown E., et al. 2009. Galectin3 deficiency reduces the severity of exper imental autoimmune encephalomyelitis. J. Immunol. 182, 1167–1173. 23. Van den Brandt J., Fischer H.J., Walter L., Hünig T., Klöting I., Reichardt H.M. 2010. Type 1 diabetes in BioBreeding rats is critically linked to an imbalance between Th17 and regulatory T cells and an altered TCR repertoire. J. Immunol. 185, 2285–2294. 24. Radosavljevic G., Volarevic V., Jovanovic I., Milo vanovic M., Pejnovic N., Arsenijevic N., Hsu D.K., Lukic M.L. 2012. The roles of Galectin3 in autoim munity and tumor progression. Immunol. Res. 52, 100– 110. 25. Berezhnaya N.M. 2009. Role of immune system cells in tumor microenvironment: Cells and cytokines involved in inflammation. Onkologiya. 11, 6–17.

Translated by N. Kuznetsova

MOLECULAR BIOLOGY

Vol. 47

No. 6

2013