Relationship between structure and function of JWA in the modulation of cell differentiation 1

1

1

XIA Wei , ZHOU Jianwei , CAO Haixia , 2 3 4 ZOU Changping , WANG Chengya , SHEN Qun 3 & LU Hua 1. Department of Molecular Genetic Toxicology, School of Public Health, Nanjing Medical University, Nanjing 210029, China; 2. Department of OB/GYN, Gynecologic Oncology, UT-Houston Medical School, Houston, TX 77225, USA; 3. Department of Hematology and Oncology, the First Affiliate Hospital of Nanjing Medical University, Nanjing 210029, China; 4. Department of Hematology and Oncology, the Second Affiliate Hospital of Nanjing Medical University, Nanjing 210029, China Correspondence should be addressed to Zhou Jianwei (e-mail: jwzhou@ njmu.edu.cn)

Abstract To elucidate the structure characteristic, regulation of expression and the potential function of JWAüüa novel retinoic acid responsible and cytoskeleton associate gene, a rat JWA homologue gene and a 621-bp JWA promoter fragment were cloned and analyzed. Using reverse transcription-polymerase chain reaction (RT-PCR), JWA mRNA expression in NIH3T3, K562 and human primary acute promyelocytic leukaemia (APL) cells have been investigated after treatment with all trans retinoic acid (ATRA), N-4-hydroxyphenyl-retinamide (4HPR), arsenic trioxide (As2O3), Phorbol-12-myristate-13-acetate (TPA) and dimethyl sulfoxide (DMSO). The results showed that there is a complete TPA responsive element (TRE) existed in the promoter of JWA at 437 to 443 bp; rat JWA homologue gene showed that there are four nucleotides different from human JWA within coding region. After treatment with TPA, an uneven pattern of JWA transcription existed in different cell lines, suggesting that even TPA induces cell differentiation in different cell lines, and it may be referred to different signal pathways. In ATRA pretreated APL cells, all the above chemicals induce cellular differentiation and down regulate JWA transcription in vitro. This suggests that pretreatment of ATRA on APL cells seems a precondition for turning on JWA involved signal pathway. Keywords: JWA, cell differentiation, ATRA, TPA, structure and function.

Retinoids, including retinol and retinoic acid derivatives, maintain the normal growth and differentiation of human bronchial epithelial cells and are under investigation as agents for cancer prevention. JWA is a novel putative cytoskeleton associated and retinoic acid responsible gene which was firstly isolated from human tracheal bronchial epithelial cells by Zhou et al.[1] (GenBank: AF070523), although several JWA homologue genes have been identified recently, little is known about the critical Chinese Science Bulletin Vol. 46 No. 24

December 2001

biological function of the gene. In this study, a JWA homologue gene has been identified from rat tracheal epithelial cells, and four nucleotides in its coding regional sequence are different from that of human. A 621-bp promoter fragment of the gene was also cloned from human samples and a complete TRE (TGACTCA) was identified. Several in vitro cell culture models have been done to make sense the relationship between structure and function. It is well known that retinoic acid is one of the effective drugs for remission APL. To further elucidate if JWA is associated with APL, we conducted an in vitro cell culture model for primary APL cells. 1

Materials and methods

(ν) Materials and reagents. MMLV transcription kit and pGEM vector were purchased from Promega. DNA extract kit was ordered from QIAGEN. The restrict enzymes (Nco ĉ , Not ĉ ) were ordered from MBI (Shanghai). RNA extract kit and PCR reagents were ordered from the Biological and Technological Inc. (Shanghai). Phorbol-12-myristate-13-acetate (TPA), all trans retinoic acid (ATRA), dimethyl sulfoxide (DMSO) and N-4-hydroxyphenyl-retinamide (4HPR) were purchased from Sigma (St. Louis, MO). These chemicals were dissolved in ethanol at a concentration of 10 mmol/L as a stock solution and stored at 20ć. The human genomic DNA samples were provided kindly from Chen Jianfeng. The primers and sequencing were ordered from the Boya Biotechnology Inc. of Shanghai. Adult rat (SD, male, with 200 g bodyweight) was provided by the Center of Experimental Animals of Nanjing Medical University. (ξ) Cell culture and growth conditions. The primary APL cells were isolated from the born marrow sample of a clinical diagnosed APL patient (M3) by equal volume of Ficoll solution. Both NIH3T3 and K562 cell lines were purchased from the Institute of Cell Biology of Shanghai. Cells were cultured in RPMI1640 supplemented with 15% FBS under 37ć with 5% CO2, and treated with differentiation chemicals when reached up to 90% confluence. (ο) Total RNA extraction and reverse transcriptase-polymerase chain reaction (RT-PCR). Following the instruction of manufacturer, the extracted total RNA was diluted with DEPC treated ddH2O at a concentration of 1 Pg/PL. The RT-reaction was performed in a final volume of 30 PL containing 4 Pg of total RNA, 3 PL of oligodT(36)AGC primer, 9 PL of ddH2O, mixed and denatured at 70ć for 4 min. Then the samples were transferred on ice-water bath, added with 5 u buffer 6 PL, 5 mmol/L of dNTPs 1 PL, 0.5 PL (200 U) of Moloney Murine Leukemia (M-MLV) Virus reverse Transcriptase (Promega), and 8.5 PL of ddH2O. The mixture were then transferred into heat block at 42ć for 90 min, followed 2063

NOTES by 70ć for 5 min. (π) Primer synthesis and polymerase chain reaction (PCR). Based on the JWA cDNA sequence, primers were designed for amplifying a 600-bp fragment which contains full length coding region sequence of JWA. The sense chain primer sequence was 5Ą -cttgcggcgcgatggac gttaatatcg-3Ąand the antisense primer was 5Ą -actggtacctttttccttcacttgctg-3 Ą. PCR was performed in a PE 480 Thermal Cycler as follows: 95ć for 5 min, then 35 cycles consisting of 30 s at 95ć, 45 s at 60ć and 60 s at 72ć. After the last cycle, incubation at 72ć was prolonged for 10 min[1,2]. PCR products (15 PL) were analyzed on 1% agarose gel in TAE buffer (40 mmol/L Tris, 40 mmol/L sodium acetate, 1 mmol/L EDTA, pH 8.4) and with DNA ladder 100-bp marker. The recombinant cloning for PCR products was performed following a T-A cloning protocol (Promega). 600 bp of PCR products were inserted into pGEM vector, after transformation into DH5-D E. coli bacterial and X-gal blue-white screening. 6 white clones were picked out for amplification and sequencing. For understanding the promoter sequence of JWA, primers were designed based on a potential JWA relative genomic clone sequence (AC012521). The sense chain primer is located at proposed JWA promoter region with a following sequence: 5Ą -gcccagctcaggactgaagtgg-3Ą ; and the antisense chain primer is located within JWA cDNA 5Ą end and with a sequence at 5Ą -ccgggaagaaatcgtcccaggcg3Ą . Using the PCR conditions above except that the annealing temperature was replaced by 45 s for 58ć, the PCR products showed a predicted size of 800 bp. E-actin PCR products were used as normalizing control for semi-quantitative JWA expression at transcription level[3]. The quantification of RT products on agarose gel was performed with Bandscan software system following the manufacturer’s instruction. The triplicate values of total gray were measured on each band and the mean was used for normalization; all samples were carried out through duplicate PCR. (ρ) Clinical cases collection. According to procedure of FAB leukemia classification, before and after clinical treatment with all trans retinoic acid (40 mg/d), bone marrow samples were taken from a primarily diagnosed acute non-lymphocyte leukemia patient (M3 subtype). Leukemia cells were isolated by Ficoll solution, and cultured in 10-cm-diameter plates and with RPMI1640 supplemented 15% FBS, 37ć and with 5% of CO2. When the cells reached 90% confluence, they were treated with DMSO (0.3%, v/v), TPA (107 mol/L), ATRA(105 mol/L), 4HPR (107 mol/L) and AS2O3 (107 mol/L) for 48 h before harvest. Total RNA extraction and RT-PCR were performed by the described protocols. 2064

2

Results

(ν) Rat JWA homologue gene coding region sequence and its structure analysis. Rat JWA homologue gene was identified from rat tracheal tissues. Briefly, three white clones were picked for sequencing. According to the pGEM vector characteristics, both T7 and sp6 primers dual directional sequencing technique were performed by Boya Biotech Inco. A verified 564 bp rat JWA gene coding region sequence was submitted to GenBank in NCBI (AF242391). Compared with the human JWA sequence, four necleotides were different. So we coded the four different amino acids versus to human gene (fig. 1). (ξ) Sequencing and structure analysis of partial JWA promoter sequence. In this study, we identified a 621 bp human JWA promoter sequence (data not shown). Further analysis showed that a complete TRE sequence (TGACTCA) was presented between 437 and 443 bp. It is suggested that JWA gene may be regulated by TPA at transcription level. On the other hand, several RARE semi-sites were also identified (data not shown). (ο) Regulation of JWA mRNA expression after treatment with TPA. Both NIH3T3 and K562 cells were treated with 107 mmol/L of TPA for 48 h and JWA mRNA expressions were analyzed by RT-PCR. The results showed that TPA down-regulated JWA expression in NIH3T3 to 50% of the control. In contrast, K562 cells showed an increased JWA transcription (up to 137% of the control) after TPA treatment. It is suggested that TPA regulating JWA expression might be via different pathways between tumor and non-tumor cells. (π) JWA mRNA expression in primary M3 leukemia cells after treatment with differentiation chemicals. After giving retinoic acid at a dose of 40 mg/d for 10 d, as a rapid white blood cell release effect of RA treatment, the peripheral white blood cell total counts of the patient increased from 16.6u109/L to 112u109/L; in contrast, the percentage of promyelocytes in total white blood cells was down from 90% to 83%. The morphology analysis showed that some promyelocytes were tending to mature cells (data not shown). These results suggested that leukemia cells were differentiated and the clinical features of the patient were being remission. At the points of both before and after treatment, the leukemia cells of the patient showed different responses on variant differentiation chemicals in vitro (fig. 2). Fig. 2 shows that before RA treatment, JWA transcription in promyelocytes had no response to all differentiation chemicals; in contrast, after 10 d of RA treatment in vivo at 40 mg/d, JWA transcription in promyelocytes of M3 patient showed a significant down-regulation pattern in all differentiation reagents treated samples. 3

Discussion Since we cloned JWA at 1998, several strategies have

Chinese Science Bulletin

Vol. 46 No. 24 December 2001

been done to explore the relationship between the strucfurther analysis revealed that both JWA and ARL-6 have a ture and the related function of the gene. Based on the 88% homologue in their amino acids sequences. ARL-6 JWA cDNA sequence, several pairs of gene specific primmay be involved in the process of DNA repair. Our recent ers were designed to amplify the overlapped JWA genomic data have shown that JWA is involved in chemicals and sequence fragments within cDNA length. The results UV induced DNA injury and repair (data not shown). showed that JWA does not contain intron sequences (data We previously used RNA protection assay and showed not shown) in human being. In November 1999, Ingley et that JWA has an alternative splicing in its transcription and al.[4] published the first JWA homologue gene, ARL-6 two transcripts can be identified under Northern blotting[1]. (AF133912). They used yeast two-hybridization assay and In December 1999 and February 2000, these two JWA identified that JWA is an interaction protein with ARL-6, transcripts (1447, 2112 bp) were published again in Rat(R) 1 atggacgttaatatcgccccactccgcgcctgggacgatttcttcccgggttccgatcgc M D V N I A P L R A W D D F F P G S D R Human(H)1 atggacgttaatatcgccccactccgcgcctgggacgatttcttcccgggttccgatcgc M D V N I A P L R A W D D F F P G S D R R 61 tttgcccggccggacttcagggacatttccaaatggaacgaccgcgtagtgagcaacctg F A R P D F R D I S K W N D R V V S N L H 61 tttgcccggccggacttcagggacatttccaaatggaacaaccgcgtagtgagcaacctg F A R P D F R D I S K W N N R V V S N L R 121 ctctattaccagaccaactacctggtggtggctgccatgatgatttccattgtggggttt L Y Y Q T N Y L V V A A M M I S I V G F H 121 ctctattaccagaccaactacctggtggtggctgccatgatgatttccattgtggggttt L Y Y Q T N Y L V V A A M M I S I V G F R 181 ctgagtcccttcaacatgatcctgggaggaatcgtggtggtgctggtgttcacagggttt L S P F N M I L G G I V V V L V F T G F H 181 ctgagtcccttcaacatgatcctgggaggaatcgtggtggtgctggtgttcacagggttt L S P F N M I L G G I V V V L V F T G F R 241 gtgtgggcagcccacaataaagacgtccttcgccggatgaagaagcgctaccccacgacg V W A A H N K D V L R R M K K R Y P T T H R H R H R H R H R H

241 gtgtgggcagcccacaataaagacgtccttcgccggatgaagaagcgctaccccacgacg V W A A H N K D V L R R M K K R Y P T T 301 ttcgttatggtggtcatgttggcgagctatttccttatctccatgtttggaggagtcatg F V M V V M L A S Y F L I S M F G G V M 301 ttcgttatggtggtcatgttggcgagctatttccttatctccatgtttggaggagtcatg F V M V V M L A S Y F L I S M F G G V M 361 gtctttgtgtttggcattacttttcctttgctgttgatgtttatccatgcatcgttgaga V F V F G I T F P L L L M F I H A S L R 361 gtctttgtgtttggcattacttttcctttgctgttgatgtttatccatgcatcgttgaga V F V F G I T F P L L L M F I H A S L R 421 cttcggaacctcaagaaccaactggagaataaaatggaaggaataggtttgaagaggaca L R N L K N Q L E N K M E G I G L K R T 421 cttcggaacctcaagaacaaactggagaataaaatggaaggaataggtttgaagaggaca L R N L K N K L E N K M E G I G L K R T 481 ccgatgggcattgtcctggatgccctagaacagcaggaagaaggcatcaacagactcact P M G I V L D A L E Q Q E E G I N R L T 481 ccgatgggcattgtcctggatgccctagaacagcaggaagaaggcatcaacagactcact P M G I V L D A L E Q Q E E G I N R L T 541 ggctgtatcagcaaagtgaaggaa G C I S K V K E 541 gactatatcagcaaagtgaaggaa D Y I S K V K E

Fig. 1. Comparison of the coding region sequence between human and rat JWA homologue genes. Opened square marker showed the different nucleotides; single baseline marked amino acids are predicted phosphorylated protein kinase C sites; double baseline marked amino acids are predicted transmembrane domains. The results showed 4 changed nucleotides between human and rat JWA coding region sequences (100aog, 439aoc, 542aog and 545aog); correspondingly, there are four changed amino acids (34NoD, 147KoQ, 181DoG and 182YoC).

Chinese Science Bulletin Vol. 46 No. 24

December 2001

2065

NOTES GenBank (AF125530, AF161476) by Jiang, C. and Ye, M. et al. separately. In this study, we identified the coding region sequence of a rat JWA homologue gene and with four different nucleotides and four comparatively amino acids compared to human JWA. The structure analysis showed that these four amino acids locations are out of the predicted two phosphorylation sites and the three transmembrane domains. We presume that JWA gene in rat may have a similar biological function in human. We also found a clone (AAA81495) from C. elegans which contains a fragment and has a 35% homologue with JWA protein. It is unclear that if the fragment is an independent

gene in C. elegans. We conclude that JWA may be a relatively conserved gene in evolution. TRE is a common cis-effect element and has been identified in promoter regions of metalthiol and collegenase genes respectively[5]. TPA is also known as a protein kinase C (PKC) activater, its biological effects are usually realized via PKC involved intracellular signal transduction pathway. Both Jun and Fos familily members can directly bind to the TRE sequence, so as to exert their roles in intracellular signal transduction pathways. In this study, when NIH3T3 cells were treated by 100 Pmol/L of TPA, JWA transcription was obviously inhibited, this result is in agreement with our previous data, that was,

Fig. 2. Regulation of JWA transcription in primary M3 leukemia cells. (a) Data before clinical RA treatment (ƶ) and after treatment (Ƶ). Leukemia cells were isolated from bone marrow samples. 5u106 cells were seeded in 10-cm-diameter plates and followed by treatment of variant reagents for 48 h. 1, Control; 2, DMSO; 3, TPA; 4, ATRA; 5, 4HPR; 6, AS203. The ratios were normalized by E-actin. (b) The bands 1ü6 and 1Ą ü6Ąrepresent before and after RA treatment respectively. The upper bands represent JWA RT products and the lower bands show E-actin RT products. For the samples’ loading orders see (a).

after treatment with TPA, both HBE and S-6 cells (human resource cells) revealed a down regulation pattern in transcription level (by Northern blotting)[1]. It is suggested that, in non-tumour cells, TPA may usually inhibit JWA transcrption. In this study, when K562 cells were treated with TPA for 48 h, a reversed regulation was shown in JWA mRNA expression (increased up to 1.3-fold). It is suggested that cellular malignant transformation might change the JWA involved signal pathway. In primary APL cells, however, TPA still showed an inhibition role in regulating JWA transcription. Therefore, JWA may be involved in different molecular mechanisms in regulating cell differentiation in different cell lines. How does TPA regulate JWA transcription? Our recent data showed that H7, a PKC inhibitor, cannot change TPA-induced JWA expression. It is suggested that TPA may regulate JWA via binding to the TRE directly. ATRA is commonly used for APL treatment, it induces leukaemia cells differentiation via binding to RA receptors (RARs/RXRs) in nuclear and furtherly regulate the expression of down-stream genes. Although RA has a relatively high remission ratio for APL, it also has obvious side-effects and tolerance in clinical. In recent years, 2066

both As2O3 and 4HPR have been used to APL clinical treatment and showed a better effect and a decreased side-effects[6,7]. It is believed that both As2O3 and 4-HPR, like TPA, may have dual functions in inducing lekaemia cell differentiation and apoptosis[8,9]. In this study, JWA gene in primary APL cells seems not sensitive to As2O3, 4HPR, DMSO and TPA in the early stage of on set; however, after the patient was treated by RA for 10 d in vivo, JWA expression can be down-regulated in vitro by these chemicals. It is suggested that the pretreatment of RA on APL cells in vivo induced initial cell differentiation seems a precondition for turning on JWA involved signal pathway. The further question is whether the downregulation of JWA is necessary or not for these chemicals to induce cells differentiation and/or apoptosis. The relative work is under way in this group. Acknowledgements This work was supported in part by the National Natural Science Foundation of China (Grant No. 30070664), the Natural Science Foundation of Jiangsu Province (Grant No. BK99133), and the Creative Foundation of Nanjing Medical University (Grant No. Cx9902).

References 1. Zhou, J. W., Di, Y. P., Zhao, Y. H. et al., A novel cytoskeleton associate gene üü cloning, identification, sequencing, regulation

Chinese Science Bulletin

Vol. 46 No. 24 December 2001

2. 3.

4.

5.

of expression and tissue distribution of JWA, in Investigation on Cell Modulation: Signal Transduction, Apoptosis and Gene Expression (in Chinese) (eds. Ye, X. S., Shen, B. F., Tang, X. F. et al.), Beijing: Military Medical Sciences Press, 1999, 110. Mullis, K. B., Ferre, F., Gibbs, R. A., The polymerase chain reaction, Boston: Birkhauser, 1994, 93. Mi, Y. C., Wang, L., The expression of WT1 gene on regulation of leukaemia cell P53 independent apoptosis, in Investigation on Cell Modulation: Signal Transduction, Apoptosis and Gene Expression (in Chinese) (eds. Ye, X. S., Shen, B. F., Tang, X. F. et al.), Beijing: Military Medical Sciences Press, 1999, 163. Ingley, E., Williams, J. H., Walker, S. T. et al., A novel ADPribosylation like factor(ARL-6), interacts with the protein-conducting channel SEC6 beta subunit, FEBS letters, 1999, 459: 69. Tao, X., Martin, B., Xu, Y. H. et al., ARE- and TRE-mediated regulation of gene expression, J. Biol. Chem., 1995, 270(12):

Chinese Science Bulletin Vol. 46 No. 24

December 2001

6894. 6. Lu, S. Q., Advances in malignant hematology disease treatment with arsenic agents, J. Clinical Hematology (in Chinese), 2000, 13(4): 186. 7. Kitareenan, S., Spinella, M. J., Allopenna, J. et al., 4HPR triggers apoptosis but not differentiation in retinoid sensitive and resistant human embryonal carcinoma cells through an RARgamma independent pathway, Oncogene, 1999, 18(42): 5747. 8. Sordet, O., Bettaieb, A., Bruey, J. M. et al., Selective inhibition of apoptosis by TPA-induced differentiation of U937 leukemic cells, Cell Death Differ., 1999, 6(4): 351. 9. Anisimov, A. G., Bolotnikov, I. A., Volkova, T. O., Changes in the K562 cell sensitivity to nonspecific lysis by human and rat leukocytes under the influence of sodium butyrate, dimethyl sulfoxide and phorbol-12-myristate-13-acetate, Oncogene, 2000, 31(1): 47. (Received July 23, 2001)

2067