ISSN 0026-8933, Molecular Biology, 2008, Vol. 42, No. 1, pp. 91–97. © Pleiades Publishing, Inc., 2008. Published in Russian in Molekulyarnaya Biologiya, 2008, Vol. 42, No. 1, pp. 102–109.

CELL MOLECULAR BIOLOGY UDC 577.2:616_006

Reversal of Multidrug Resistance of Gastric Cancer Cells by Downregulation of CIAPIN1 with CIAPIN1 siRNA1 X. Li, R. Fan, X. Zou, L. Hong, L. Gao, H. Jin, R. Du, L. He, L. Xia, and D. Fan State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, the Fourth Military Medical University, 17 Changle Western Road, Xi’an, 710032 China e-mail: [email protected], [email protected] Received February 19, 2007; in final form, April 18, 2007

Abstract—The overexpression of a new cytokine-induced apoptosis inhibitor 1 (CIAPIN1) gene has been shown previously to promote a multidrug resistant phenotype in gastric cancer cells through the upregulation of MDR1 and MRP1. In the present study, we constructed the siRNA eukaryotic expression vectors of CIAPIN1 and transfected them into SGC7901/VCR cells to examine whether the downregulation of CIAPIN1 increased cell sensitivity towards chemotherapeutic drugs. After transfection, the expression of CIAPIN1 was dramatically decreased in CIAPIN1 siRNA transfectants compared with that in parental cells and empty vector control cells. The downregulation of CIAPIN1 significantly enhanced the sensitivity of SGC7901/VCR cells to vincristine (VCR), adriamycin (ADR), and etoposide (VP-16), but not to 5-fluorouracil (5-Fu) and cisplatin (CDDP). Cell capacity to efflux adriamycin decreased markedly in CIAPIN1 siRNA transfectants, and the correlation between CIAPIN1 downregulation and decreased MDR-1 transcriptional activity was observed. CIAPIN1 siRNA could significantly downregulate the expression of Bcl-2, and upregulate the expression of Bax, but does not alter the expression of PTEN in gastric cancer cells. These observations suggested that the siRNA constructs of CIAPIN1 we obtained could effectively downregulate the expression of CIAPIN1 and reverse the resistant phenotype of gastric cancer cells. Further study of the biological functions of CIAPIN1 may be helpful for understanding the mechanisms of multidrug resistance of gastric cancer and in developing possible strategies to treat gastric cancer. DOI: 10.1134/S0026893308010135 Key words: CIAPIN1, multidrug resistance, apoptosis, gastric cancer, RNAi 1 INTRODUCTION

roporine, but the mechanism(s) by which CIAPIN1 confers resistance in Ba/F3 cells to these apoptosisinducing factors is still unclear [7], so is whether CIAPIN1 exerts similar function in other mouse tissues and human cells, especially in malignant cells.

Multidrug resistance (MDR) was a major impediment to the effective chemotherapy of many human malignancies. Molecular investigations discovered diverse mechanisms of MDR, such as extrusion of the drug by cell membrane pumps including P-glycoprotein (P-gp) and multidrug resistance-associated protein (MRP), enhanced drug detoxification, increased DNA damage repair, redistribution of intracellular accumulation of drugs, modification of drug target molecules, suppression of drug-induced apoptosis, and upregulation of lipids and other biochemical changes [1–6]. However, the precise mechanisms of MDR have not yet been completely elucidated, suggesting that there exist unknown molecules and mechanisms responsible for the development of MDR.

Previously, it has been shown that CIAPIN1 expression is related to the multidrug resistance of stomach cancer. CIAPIN1 has been shown to be an upregulated gene in the multidrug-resistant gastric cancer cell line SGC7901/VCR by subtractive hybridization, reverse-transcriptase polymerase chain reaction (RT–PCR), and Western blot [8]. In vitro drug sensitivity assay and Western and Northern blot techniques showed that overexpression of CIAPIN1 could promote a multidrug resistant phenotype of gastric cancer cells through upregulation of multidrug resistance gene-1 (MDR-1) and multidrug related protein1 (MRP-1) expression [9].

CIAPIN1 is a newly identified apoptosis inhibitor with no homology to apoptosis regulatory molecules of the Bcl-2 family, caspase family, or signal transduction molecules [7]. In addition, CIAPIN1 protects Ba/F3 cells against etoposide, γ radiation, and stau1 The

The results of these studies indicate that the CIAPIN1 gene might affect the occurrence and development of a multidrug resistant phenotype in gastric carcinoma. Further analysis of biological functions of CIAPIN1 in the multidrug resistance of gastric cancer

text was submitted by the authors in English.

91

92

LI et al.

might be helpful for further understanding the mechanisms of multidrug resistance and the development of possible strategies to reverse it in gastric carcinoma.

were chosen, identified by restriction digestion with BamHI and HindIII and further confirmed by DNA sequencing.

In the present study, the eukaryotic expression vectors of CIAPIN1 small interference RNA (siRNA) were constructed and the role of CIAPIN1 in the modulation of drug resistance of gastric cancer was examined. The results suggested that CIAPIN1 mediates multidrug resistance of gastric cancer cells through regulation of P-gp, Bcl-2, and Bax.

SGC7901/VCR cells were seeded in six-well plates and grew in drug-free medium. At 70–80% confluence, cells were washed twice with phosphate buffer saline (PBS) and grew in 2 ml of RPMI1640 without antibiotics. pSiCIAPIN1 siRNA plasmids (2 μg) were transfected into SGC7901/VCR cells using LipofectamineTM 2000 reagent (Invitrogen), according to the manufacturer’s instructions. SGC7901/VCR cells transfected with pSilencerTM 3.1-H1 Neo vector alone were utilized as a negative control (named SGC7901-VCR-pSi). Forty-eight h later, cells were placed in growth medium containing G418 (GIBCO) at a final concentration of 400 μg/ml for clone selection. The expression levels of CIAPIN1 in G418-resistant clones were evaluated by Western blot analysis.

EXPERIMENTAL Cell culture. The human VCR-resistant gastric adenocarcinoma cell line SGC7901/VCR was developed by exposing the parental SGC7901 cells to stepwise increasing concentrations of anticancer drugs [10]. The cells were routinely cultured in RPMI 1640 medium (Life Technologies, Gaithersburg, MD) supplemented with 10% FBS (Life Technologies, Gaithersburg, MD) at 37°ë in a 5% ëé2 incubator. For SGC7901/VCR cells, the medium also contained 1 μg/ml VCR to maintain its drug-resistance phenotype. Before use, the SGC7901/VCR cells were cultured in drug-free medium for two weeks. Plasmid construction and transfection. Two pairs of hairpin siRNA oligos for CIAPIN1 containing BamHI and HindIII sites were designed with the aid of the software package siRNA Target Finder (available at http:/www.ambion.com/techlib/misc/siRNA_finder.html). For oligo-1, sense: 5'-AGCTTTTCCAAAAAATGAGAACTGCACCGTCTGTTCTCTTGAAACAGA-CGGTGCAGTTCTCACG-3', antisense: 5'-GATCCGTGAGAACTGCACCGTCTGTTTCAAGAGAACAGACGGTGCAGTTCTCATTTTTTGGAAA-3'; for oligo-2, sense: 5'-GATCCGCTTCAG-CACTTTCCATGATTCAAGAGATCATGGAAAGTGCTGAAGCTTTTTTGGAAA-3', antisense: 5'-AGCTTTTCCAAAAAAGCTTCAGCACTTTCCATGATCTCTTGAATCATGGAAAGTGCTGAAGCG-3'. Target sequences were aligned to the human genome database in a BLAST search to ensure that the chosen sequences were not highly homologous with other genes. For annealing to form DNA duplexes, 100 μM each of sense and antisense oligos were used. Oligos were incubated at 95°C water for 5 min and then cooled naturally down to room temperature. Some of the duplexes were diluted by 1 : 4000 in 0.5 × annealing buffer and 1 μl of the dilution was used for ligation with a 50-ng pSilencerTM 3.1-H1 Neo vector (previously digested by the BamHI and HindIII restriction enzyme and purified gel), carrying a geneticin (G418) resistance gene Neo for selection of stable transfectants, in a 10-μl volume at room temperature for 30 min., yielding pSiCIAPIN1-1 and pSiCIAPIN1-2, respectively. The products were transformed into DH5α competent cells. Ampicillin-resistant colonies

RT–PCR analysis. Total RNA was isolated from 2 × 106 cells using TRIzol reagent as recommended by the manufacturer (Life Technologies, Inc.). Reverse transcription was performed on 1 μg of total RNA from each sample using oligo(dT)18 primers and 200 units of SuperScript II (Life Technologies, Inc.) for extension. cDNAs were amplified using Ex Taq polymerase (TakaRa) with the following primer pairs as described previously: CIAPIN1, 5'- CGGAATTCATGGCAGATTTTGGGATCTC -3' and 5'- GGTCGACCTAGGCATCAAGATTGCTATC-3'; β-actin, 5'-AGCGGGAAATCGTGCGTG-3' and 5'-CAGGGTACATGGTGGTGCC-3' [14]. The PCR conditions of CIAPIN1 were 95°ë for 50 s, 58°ë for 50 s, and 72°ë for 50 s. Thirty cycles were performed. All of the PCR products were separated on ethidium bromide stained agarose and visualized with UV. Western blot analysis. Cells were trypsinized and total cellular proteins were prepared with lysis buffer (pH 8.0) containing 1% NP-40, 50 mmol/l Tris-HCl, 150 mmol/l NaCl, 0.1 mmol/l phenylmethylsulfonyl fluoride, and 1 μg/ml aprotinin. The total protein was quantified by the Bradford method. A measure of 80 μg of lysates were electrophoresed in 12% SDSPAGE and blotted on a nitrocellulose membrane (Immoblin-P, Millipore, Bedford, MA, United States). Membranes were blocked with 5% fat-free milk powder at room temperature for 2 h and incubated overnight with the primary antibody at 4°C. After three washes for 15 min in PBST, the membrane was incubated with the HRP-conjugated goat antimouse IgG antibody (Santa Cruz Corp., Santa Cruz, CA, United States) for 1 h at room temperature. The membrane was washed again in PBST; enhancer of chemiluminescence (Amersham Life Science, Piscataway, NJ, United States) was added and monitored for the development of color. The following antibodies were used: monoclonal antibody against CIAPIN1 prepared by MOLECULAR BIOLOGY

Vol. 42

No. 1

2008

REVERSAL OF MULTIDRUG RESISTANCE OF GASTRIC CANCER CELLS

our group (11), anti-P-gp, anti-PTEN, anti-Bcl2, and anti-Bax polyclonal antibodies (Santa Cruz Corp.); anti-actin antibody (Wuhan, Hubei, China). Drug sensitivity assay. Vincristine (VCR), adriamycin (ADR), etoposide (VP-16), 5-fludrouracil (5-Flu), and cisplatin (CDDP) were all freshly prepared before each experiment. Drug sensitivity was evaluated using a 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl-tetrazolium bromide (MTT) assay as described previously [12]. Briefly, cells were trypsinized and diluted with culture medium to the seeding density (8 × 103 cells/well), suspended in 96-well flat-bottomed plates (200 μl/well; Costar), and incubated at 37°C for 24 h. Cells were then incubated for 72 h in the absence or presence of various concentrations of the anticancer agents in 200-μl medium. Each condition was assayed in triplicate. After cells were cultured for 72 h, 50 μl of 2 mg/ml MTT (Sigma, St. Louis, MO, United States) was added into each well, and cells were cultured for another 4 h. Then, supernatants were discarded and 150 μl of DMSO (Sigma) was added into each well to dissolve crystals. Absorbance at 490 nm was measured with a microplate reader BP800 (BIOHIT). Cell survival rates were calculated according to the following formula: survival rate = (mean A490 of treated wells/mean A490 of untreated wells) 100%. Finally, dose-effect curves of anticancer drugs were drawn on semilogarithm coordinate paper and IC50 values were determined. Intracellular adriamycin concentration analysis. Fluorescence intensity of intracellular adriamycin was determined by flow cytometry. Briefly, gastric cancer cells in log phase were seeded into six-well plates (1 × 106 cells/well) and cultured overnight at 37°ë. After the addition of adriamycin to the final concentration of 5 μg/ml, cells continued to be cultured for 1 h. Cells were then harvested (for detection of adriamycin accumulation) or cultured in drug-free RPMI 1640 for another 1 h followed by harvesting (for detection of adriamycin retention). Then, cells were washed with PBS and the mean fluorescence intensity of intracellular adriamycin was detected using flow cytometry with an exciting wavelength of 488 nm and emission wavelength of 575 nm. The experiment was independently done thrice. Finally, the adriamycin-releasing index of the gastric cancer cells was calculated using the following formula: releasing index = (accumulation value – retention value)/accumulation value. Reporter gene assay. SGC7901/VCR cells were plated in six-well dishes and grown in maintenance medium. At 70–80% confluence, cells were cotransfected with the siRNA complexes and pGL3-MDR1. Cells cotransfected with the siRNA complexes and empty pGL3 vector served as a negative control. After 48 h, cells were lysed and luciferase activity was MOLECULAR BIOLOGY

Vol. 42

No. 1

2008

93

determined using the Dual-Luciferase system. The pGL3-MDR1 vector (MDR1 promoter) and the control vector were established previously by Dr. Changcun Guo in our laboratory [13]. Annexin V staining. After having been treated with 1.5 μg/ml of ADR for 24 h, cells were washed twice with cold PBS and resuspended in 100 μl of binding buffer at a concentration of 1 × 106 cells/ml. Then, 5 μl of annexin VFITC (PharMingen, San Diego, CA, United States) and 10 μl of 20 μg/ml PI (Sigma) were added to these cells. After incubation at room temperature for 15 min, 400 μl of annexin-binding buffer was added to each sample, and the samples were kept on ice for counting the stained cells by flow cytometry. Annexin V binds to those cells that express phosphatidylserine on the outer layer of the cell membrane, and propidium iodide stains the cellular DNA of those cells with a compromised cell membrane [14]. Statistical analysis. Each experiment was repeated at least three times. Bands from Western blot or RT–PCR were quantified by Quantity One software (BioRad). Relative protein or mRNA levels were calculated by referring them to the amount of β-actin. The difference between means was performed with ANOVA and then a post-hoc test. All statistical analyses were performed using SPSS11.0 software (Chicago, IL, United States). P < 0.05 was considered as statistically significant. RESULTS Downregulation Effect of CIAPIN1 siRNA on Endogenous CIAPIN1 CIAPIN1siRNA expression vectors were transiently transfected into SGC7901/VCR cells, which had a high expression of CIAPIN1. The expression level of CIAPIN1 in SGC7901/VCR cells and the transfectants was detected by RT–PCR (Fig. 1a) and Western blot (Fig. 1b). Both CIAPIN1 siRNA1 and CIAPIN1siRNA2 could downregulate the expression of CIAPIN1, but CIAPIN1 siRNA2 significantly downregulated CIAPIN1 expression by almost 87%, compared with that obtained with CIAPIN1 siRNA1 (Fig. 1), so we chose the CIAPIN1 siRNA2 transfected cell line for the following experiments. In Vitro Drug Sensitivity Assay Table 1 shows that SGC7901/VCR-pSiCIAPIN1 cells exhibited significantly decreased IC50 values (P < 0.05) for vincristine, adriamycin, and etoposide (P-gp-related drugs). However, the IC50 values for 5-fluorouracil and cisplatin (not P-gp-related drugs) showed no significant difference among these cell lines (P > 0.05). The data indicated that lower

94

LI et al.

Downregulation of CIAPIN1 Decreases MDR1 Transcriptional Activity To elucidate the regulatory effects of CIAPIN1 on the promoter activity of MDR1 [13], luciferase reporter assays were done. As shown in Fig. 2a, cotransfection of the MDR1 reporter gene with decreasing amounts of the CIAPIN1 expression vector resulted in an essentially linear decrease in MDR1 promoter activity, suggesting that CIAPIN1 might be involved in regulation of MDR1 transcription.

(a) CIAPIN1 (254 bp) β-actin (310 bp)

(b) CIAPIN1 (39 kDa) β-actin (43 kDa)

1

2

3

4

Fig. 1. Identification of siRNA vector by Western blot and RT–PCR, total RNA and protein of SGC7901/VCR and transfected cells were extracted and subjected to reverse transcription-PCR analyses (a) and Western blot (b) analyses. Lane 1: SGC7901/VCR; lane 2: SGC7901/VCR-pSi; lane 3: SGC7901/VCR-pSiCIAPIN1-1; lane 4: SGC7901/VCR-pSiCIAPIN1-2. Expression of CIAPIN1 was found overexpressed in SGC7901/VCR cells and decreased in SGC7901/VCR cells transfected with CIAPIN1 siRNA (lane 3 and lane 4) compared with their corresponding empty vector transfected control cells (lane 2). β-actin was used as an internal control. Representative of three independent experiments.

Effect of CIAPIN1 on Classical MDR Molecules To study the possible molecular mechanisms involved in CIAPIN1-related MDR of gastric cancer, the protein level of P-gp were detected. As shown in Fig. 2b, the relative expression level of P-gp to β-actin was markedly higher in SGC7901/VCR cells and significantly decreased in SGC7901/VCR-pSiCIAPIN1 cells (65%) compared with empty vector transfected control cells.

CIAPIN1 expression correlated with a decreased cellular ability to resist the chemotherapeutic drugs. Adriamycin Content in CIAPIN1 siRNA Transfectants Accumulation of adriamycin in SGC7901/VCR cells transfected with CIAPIN1 siRNA showed a marked increase compared with that in empty vector control cells (Table 2). Downregulation of CIAPIN1 was accompanied by a reduction in the amount of adriamycin being pumped out of the cell. The adriamycin-releasing index of CIAPIN1 siRNA transfectants was significantly lower than that of empty vector control cells (P < 0.05).

Effects of CIAPIN1 on Apoptosis As the blockade of apoptosis was another important mechanism of MDR, we investigated the capacity of gastric cancer cells to undergo ADR-induced apoptosis by Annexin V staining. After treatment of cells with 1.5 μg/ml of ADR for 24 h, the apoptosis index of SGC7901/VCR-pSiCIAPIN1 cells (Fig. 3c) was significantly higher than that of control cells (Figs. 3a and 3b) (32.3% vs. 12.3 and 10.6%). Effect of CIAPIN1 on Proteins Regulating Apoptosis To gain insight into the molecular mechanisms involved in CIAPIN1-mediated apoptosis, CIAPIN1related transfectants were treated with 0.4 μg/ml of

Table 1. IC50s (μg/ml) of anticancer drugs for gastric cancer cells IC50 mg/l (means ± SD) Drugs

ADR 5-Flu VCR VP16 CDDP

Relative resistance

SGC7901-VCR

SGC7901-VCR-pSi

SGC7901-VCRpSiCIAPIN1

0.571 ± 0.123 4.612 ± 0.765 18.336 ± 0.077 2.475 ± 0.152 0.874 ± 0.149

0.526 ± 0.145 5.081 ± 0.534 17.245 ± 0.529 2.838 ± 0.531 0.912 ± 0.156

0.134 ± 0.021* 4.156 ± 0.347 1.679 ± 0.383* 0.642 ± 0.177* 0.845 ± 0.075

SGC7901-VCRSGC7901-VCRpSiCIAPIN1/SGC79 pS/SGC7901-VCR 01-VCR 0.92 1.10 0.94 1.15 1.04

0.23 0.47 0.90 0.26 0.97

Notes: Cells (8 × 103) were seeded into 96-well plates, and anticancer drugs at various concentrations were added. Cell viability was determined 72 h later, with MTT reagent. The test for each drug concentration was performed three times, and cell viability was measured in quadruplicate in each test. Drug sensitivity was represented by the IC50 values. Relative resistance = the IC50 value of the transfected gastric cells/the IC50 value of the nontransfected gastric cells. * P < 0.05, compared with SGC7901-VCR cells and SGC7901/VCR-pSi cells. MOLECULAR BIOLOGY

Vol. 42

No. 1

2008

REVERSAL OF MULTIDRUG RESISTANCE OF GASTRIC CANCER CELLS

95

Table 2. Fluorescence intensity (mean ± SD) of intracellular ADM accumulation and retention and the ADM-releasing index in gastric cancer cells Fluoresence intensity Cell line

Releasing index accumulation

retention

SGC7901-VCR

2.16 ± 0.21

0.93 ± 0.10

0.573 ± 0.08

SGC7901-VCR-pSi

2.16 ± 0.21

0.91 ± 0.17

0.579 ± 0.07

SGC7901-VCR-pSiCIAPIN1

2.53 ± 0.19*

1.64 ± 0.12*

0.352 ± 0.09*

Notes: Adriamycin accumulation and retention were measured by flow cytometry and intracellular adriamycin concentration was represented by average fluorescence intensity. Values were represented as mean ± SD. * p < 0.05, compared with SGC7901-VCR and SGC7901-VCR-pSi cells.

DISCUSSION The biological function of CIAPIN1, a newly identified molecule, is far from being fully elucidated. The only study on its function demonstrated that CIAPIN1 expression protected IL-3-dependent Ba/F3 cells, not only against cytokines withdrawal, but also against other apoptosis stimuli such as etoposide, γ-radiation, and staurosporine [7]. Our previous study demonstrated that CIAPIN1 distributed ubiquitously in normal adult and fetal human tissues [6]. Moreover, we also observed that CIAPIN1 was localized in both the cytoplasm and the nucleus and accumulated in the nucleoli in normal human and mouse cells [15]. Recently, CIAPIN1 expression was found to be related to the multidrug resistance of gastric cancer cells [8, 9] and might play potential roles in mediating some physiological and pathological functions. Multidrug resistance is the main obstacle to effective chemotherapy for malignant tumor, especially gastric cancer. In previous work, four resistant sublines from the human gastric cancer cell line SGC7901 were established [10]. The studies also revealed that the VCR-resistant cell line SGC7901/VCR overexpressed P-gp, with cross-resistance to several anticancer drugs, suggesting MDR1/P-gp-mediated classical multidrug resistance. CIAPIN1 was found to be overexpressed in SGC7901/VCR cells and might influence the multiMOLECULAR BIOLOGY

Vol. 42

No. 1

2008

drug-resistant phenotype of gastric cancer cells through regulation of P-gp [9]. However, the role of the CIAPIN1 gene in the multidrug resistance of gastric cancer remains unclear and the present study sought to examine whether or not its downregulation Relative luciferease activity (fold induction)

ADR for 0, 4, and 16 h, then the expressions of PTEN, Bcl-2, and Bax were assessed in CIAPIN1-related transfectants. As shown in Fig. 4, the expression of Bcl-2 protein was decreased and the expression of Bax protein was increased in SGC7901/VCRpSiCIAPIN1 cells, but not significantly altered in response to the increased time of drug treatment. However, relatively equal levels of PTEN were detected in all SGC7901/CVR derived cell lines. These data strongly suggested that downregulation of CIAPIN1 might enhance drug-induced apoptosis by decreasing the Bcl-2/Bax ratio in gastric cancer cells.

12 (a) 9

6

3

0

0.8

0.5 0.3 0 Amount of CIAPIN1 expression vector (μg) (b)

P-gp (170 kDa) β-actin (43 kDa)

1

2

3

Fig. 2. (a) Luciferase reporter assay to determine the regulatory effect of CIAPIN1 on MDR1 promoter activity. Transcriptional activity of the MDR1 promoter fused to the luciferase gene in the pGL3Basic vector was assayed by cotransfection of this reporter gene (0.2 μg/well) with increasing amounts of the CIAPIN1 siRNA expression vector (0.3, 0.5, and 0.8 μg) in SGC7901-VCR cells [13]. Luciferase activities were normalized against the activities of the control vector pRL-TK. Columns, mean (n = 3); bars, SD. (b) Expression of P-gp in SGC7901/VCR and transfected cells. β-actin was used as an internal control. Results were representative of three independent experiments. Lane 1: SGC7901/VCR; lane 2: SGC7901/VCR-pSi; lane 3: SGC7901/VCR-pSiCIAPIN1.

96

LI et al. (b) (c) SGC7901/VCR-pSi SGC7901/VCR-pSiCIAPIN1 2 1 2 1

PI

1000

(a) SGC7901/VCR 2 1

3 0.1

12.3% Annexin V

4 1000 0.1

3

4

10.6% Annexin V

1000 0.1

3 32.3% Annexin V

4 1000

Fig. 3. The effects of CIAPIN1 on the induction of apoptosis in response to ADR. Cells were incubated with 1.5 μg/ml of ADR for 24 h, then Annexin V/propidium iodide binding analyses of cells were presented. The apoptosis index of SGC7901/VCRpSiCIAPIN1 cells (c) was significantly higher than that of control cells (a and b) (32.3% vs. 12.3 and 10.6%). Results were representative of three independent experiments.

increased the sensitivity of cells to chemotherapeutic drugs. To obtain a better model in which cells of the same origin could be compared, we utilized siRNA technology and successfully designed CIAPIN1 siRNA eukaryotic expression vectors and established the effective transient transfectants. MTT assay revealed that the sensitivity to chemotherapeutic agents of SGC7901/VCR cells transiently transfected CIAPIN1 siRNA was increased in comparison with empty vector cells (P < 0.05). It should be noted that VCR and ADR are the common substrates for P-gp. To clarify the association of P-gp with CIAPIN1-related MDR, we investigated the SGC7901/VCR-pSi SGC7901/VCR-pSiCIAPIN1 0h 4h 16 h 0h 4h 16 h CIAPIN1 (39 kDa)

PTEN (55 kDa)

Bc1-2 (26 kDa)

Bax (23 kDa)

β-actin (43 kDa)

Fig. 4. Expression of CIAPIN1, Bcl-2, Bax, and PTEN in SGC7901/VCR transfected cells. β-actin was used as an internal control. The blot was visualized by enhanced chemiluminescence system. Results were representative of three independent experiments.

effects of CIAPIN1 on its expression. The results showed that P-gp might mediate the CIAPIN1-related MDR of gastric cancer. Each case of P-gp-related multidrug resistance has been related to an increased human MDR1 mRNA level, which can be linked to gene amplification and/or increased gene transcription [16]. It is believed that alterations in the MDR1 promoter are important for P-gp function [17]. Present results suggest that CIAPIN1 might regulate transcription of the chromosomal MDR1 gene through direct binding to the MDR1 promoter, which suggests an alternative approach to the control of multidrug resistance. Apoptosis was a common pathway that finally mediated the killing functions of anticancer drugs, which was an important cause of MDR. The Bcl-2 family, including Bcl-2, Bcl-xL, Bax, Bad, and Bak, was a rapidly expanding family of proteins involved in apoptosis and responses of tumor cells to chemotherapy [18]. These proteins were believed to modulate apoptosis by forming homodimers or heterodimers with other Bcl-2 family members [19]. A wide variety of human cancers, with poor clinical response to chemotherapy, exhibited high levels of Bcl-2 expression. It was assumed that Bcl-2 family expression provided resistance to a wide variety of cell death stimuli including classical chemotherapeutic drugs and radiation [20]. The changed levels of Bcl-2 and Bax caused by CIAPIN1 might also contribute to promotion effects of CIAPIN1 siRNA on apoptosis and thus CIAPIN1-related MDR of gastric cancer cells. In conclusion, we clearly showed for the first time that downregulation of CIAPIN1 with CIAPIN1 siRNA could reverse multidrug resistance of gastric cancer cells through regulation of P-gp and/or cooperation with Bcl-2/Bax. Further analysis of the mechanism of biological actions of CIAPIN1 in MDR of gastric cancer might help to further understand the mechanisms of MDR in gastric cancer and generate a new approach to reverse MDR. MOLECULAR BIOLOGY

Vol. 42

No. 1

2008

REVERSAL OF MULTIDRUG RESISTANCE OF GASTRIC CANCER CELLS

ACKNOWLEDGMENTS This study was supported by a grant from The National Foundation of Natural Sciences, China (no. 30471989).

10. 11.

REFERENCES 1. Lage H., Perlitz C., Abel R. 2001. Enhanced expression of human ABC-transporter tap is associated with cellular resistance to mitoxantrone. FEBS Lett. 503, 179–184. 2. Litman T., Druley T.E., Stein W.D., Bates S.E. 2001. From MDR to MXR: New understanding of multidrug resistance systems, their properties and clinical significance. Cell. Mol. Life Sci. 58, 931–935. 3. Fan K.C., Fan D.M., Cheng L.F., Li C. 2000. Expression of multidrug resistance-related markers in gastric cancer. Anticancer Res. 20, 4809–4814. 4. Kim W.J., Kakehi Y., Wu W.J., et al. 1996. Expression of multidrug resistance-related genes (mdrl, MRP, GST-pi and DNA topoisomerase II) in urothelial cancers. Br. J. Urol. 78, 361–368. 5. Lavie Y., Fiucci G., Liscovitch M. 2001. Upregulation of caveolin in multidrug resistant cancer cells: functional implications. Adv. Drug. Deliv. Rev. 49, 317–323. 6. Fan D., Zhang X., Chen X. 2005. Bird’s-eye view on gastric cancer research of the past 25 years. J. Gastroenterol. Hepatol. 20, 360–365. 7. Shibayama H., Takai E., Matsumura I., et al. 2004. Identification of a cytokine-induced antiapoptotic molecule anamorsin essential for definitive hematopoiesis. J. Exp. Med. 4, 581–592. 8. Zhao Y., You H., Liu F., et al. 2002. Differentially expressed gene profiles between multidrug resistant gastric adenocarcinoma cells and their parental cells. Cancer Lett. 185, 211–218. 9. Hao Z., Li X., Qiao T., et al. 2006. CIAPIN1 confers multidrug resistance by upregulating the expression of

MOLECULAR BIOLOGY

Vol. 42

No. 1

2008

12.

13.

14.

15. 16. 17.

18. 19. 20.

97

MDR-1 and MRP-1 in gastric cancer cells. Cancer Biol. Ther. 5, 261–266. Cai X.J., Fan D.M., Zhang X.Y. 1994. Establishment and biological characteristics of MDR human gastric cancer cell line. Chin. J. Clin. Oncol. 2, 67–71. Hao Z., Qiao T., Jin X., et al. 2005. Preparation and characterization of a specific monoclonal antibody against CIAPIN1. Hybridoma. 24, 141–145. Shi Y., Zhai H., Wang X. 2002. Multidrug-resistanceassociated protein MGr1-Ag is identical to the human 37-kDa laminin receptor precursor. Cell. Mol. Life Sci. 59, 1577–1583. Guo C., Ding J., Yao L., et al. 2005. Tumor suppressor gene Runx3 sensitizes gastric cancer cells to chemotherapeutic drugs by downregulating Bcl-2, MDR-1 and MRP-1. Int. J. Cancer. 116, 155–160. Perkins C.L., Fang G., Kim C.N., Bhalla K.N. 2000. The role of Apaf-1, caspase-9, and bid proteins in etoposideor paclitaxel-induced mitochondrial events during apoptosis. Cancer Res. 60, 1645–1653. Hao Z., Li X., Qiao T., et al. 2006. Subcellular localization of CIAPIN1. J. Histochem. Cytochem. 54, 1437– 1444. Labialle S., Gayet L., Marthinet E., et al. 2002. Transcriptional regulators of the human multidrug resistance 1 gene, recent views. Biochem. Pharmacol. 64, 943–948. Potocnik U., Glavac M.R., Golouh R., Glavac D. 2001. The role of P glycoprotein (MDR1) polymorphisms and mutations in colorectal cancer. Pflugers Arch. 442, R182–R183. Igney F.H., Krammer P.H. 2002. Death and anti-death: Tumour resistance to apoptosis. Nat. Rev. Cancer. 2, 277–288. Sattler M., Liang H., Nettesheim D. 1997. Structure of Bcl-xL-Bak peptide complex: Recognition between regulators of apoptosis. Science. 275, 983–986. Reed J.C. 1999. Dysregulation of apoptosis in cancer. J. Clin. Oncol. 17, 2941–2953.