Environ Earth Sci DOI 10.1007/s12665-014-3236-3

ORIGINAL ARTICLE

Soil microbial community response to seawater intrusion into coastal aquifer of Donghai Island, South China Yanguo Teng • Jie Su • Jinsheng Wang • Ning Dai • Jian Li • Liuting Song • Rui Zuo

Received: 24 January 2013 / Accepted: 24 March 2014 Ó Springer-Verlag Berlin Heidelberg 2014

Abstract Due to the sea level rise and the excessive exploitation of freshwater, seawater intrusion is becoming a critical issue. To clarify the degree of seawater intrusion in Donghai Island and the microbial community structure and functional response to seawater intrusion, groundwater samples and sediment samples were collected at profiles A, B; the profiles were along the direction of groundwater flow, perpendicular to the coastline, a hydrogeochemical survey and soil microbial community analysis were also performed. The hydrogeochemistry analysis showed that the chemical type of groundwater was Na–Cl, brackish water was dominant in the area, and coastal groundwater was strongly affected by seawater intrusion. The effect of seawater intrusion on structural and functional diversity of soil microbes was analyzed from soil samples of the study area, by polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE). The results of DGGE patterns and phylogenetic tree show that the extent of seawater intrusion has directly influenced soil microbial community structure. The changes of microbial community structure might be related to the major elements’ concentrations in groundwater. Phylogenetic affiliation indicated that c-proteobacteria were dominated in the profile A, while b-proteobacteria were mainly appeared in the profile B. The Electronic supplementary material The online version of this article (doi:10.1007/s12665-014-3236-3) contains supplementary material, which is available to authorized users. Y. Teng (&)  J. Su  J. Li  L. Song College of Water Sciences, Beijing Normal University, Beijing 100875, China e-mail: [email protected] J. Wang  N. Dai  R. Zuo Engineering Research Center of Groundwater Pollution Control and Remediation, Ministry of Education, Beijing 100875, China

Flavobacteriaceae was only appeared at the shrimp ponds nearby. Keywords Seawater intrusion  Groundwater  Hydrogeochemistry  Microbial community  PCR-DGGE

Introduction Seawater intrusion is the encroachment of saline water into fresh groundwater regions in coastal aquifer settings (Werner and Simmons 2009). Seawater intrusion is a global issue, exacerbated by increasing demands for fresh water in coastal zones predisposed to the influence of rising sea levels and changing climates (Werner et al. 2012). Because of human activity in coastal areas worldwide, the hydrodynamics of exchange between fresh and saline water sources has been altered (Edmonds et al. 2009). The majority of world’s coastal areas have suffered seawater intrusion, resulting in fresh groundwater pollution, coastal land salinization, water source damage, destruction of coastal structures and changes in terrestrial ecosystems (Sternberg et al. 1991; Zalidis et al. 2002). Seawater intrusion is caused by prolonged changes (or in some cases, severe episodic changes) in coastal groundwater levels because of pumping, land-use change, climate variations or sea-level fluctuations. The primary detrimental effects of seawater intrusion are reduction in available freshwater storage volume and contamination of production wells, whereby \1 % of seawater (*250 mg/l chloride) renders fresh water unfit for drinking (WHO 2011). The considerable threat of seawater intrusion on the global scale is well documented (e.g., Kinzelbach et al. 2003; Post 2005; Barlow and Reichard 2010).

123

Environ Earth Sci

Coastal groundwater resources are an increasingly critical component of available freshwater in China, within a national setting of rising population density in coastal margins. Saltwater intrusion has been induced by overexploitation of groundwater, owing to economic development in Chinese coastal areas since the 1970s (Chen et al. 1997; Qi and Qiu 2011). The seawater intrusion threat to freshwater supplies has already produced a groundwater management response in some regions of the country, with extensive investigation and construction of monitoring networks in the 1960s (Wu et al. 2008). Previous investigations show seawater intrusion on Donghai Island, especially in coastal areas (Liang et al. 2002; Luo and Su 2007), the consequence of which is that groundwater in unconfined aquifers became saline water in most residential wells. In addition, seawater and waste water drainage from shrimp farming can infiltrate unconfined aquifers to cause groundwater salinization. The concentration of chemical contaminants and pathogens in groundwater systems is influenced by biogeochemical and ecological dynamics of subterranean microbial communities (Hemme et al. 2010), and thus seawater intrusion has serious impacts upon these communities (Cissoko et al. 2008). Microbial community structure along naturally occurring salinity gradients has been studied. Typically, gamma-, beta-, and deltaproteobacteria as well as representatives of the bacteroidetes dominate in freshwater and brackish samples, whereas alphaproteobacteria and Cyanobacteria dominate in marine samples (Bernhard et al. 2005; Bouvier and del Giorgio 2002; Cottrell and Kirchman 2004; Edmonds et al. 2009; Garneau et al. 2006; Henriques et al. 2004). Madsen and Ghiorse (1993) concluded in their review that bacteria with simple life cycles appear to be most abundant and most widely distributed in the subsurface, whereas filamentous, spore-forming, and cyst-forming microbes appear to be generally absent or restricted to the first meters below groundwater tables. Since anthropogenic stressors can be physical, chemical, and biological, ecosystem assessment should consider all these (Stein et al. 2010). The central working hypothesis is that in low dynamic habitats, microbial communities faithfully reflect in situ environmental conditions. In this sense, the abundance, biomass, and structure of microbial communities as well as their physiological status (activity) can serve as sensitive ecological criteria for short-term dynamics in aquifers (Stein et al. 2010). Subsurface microorganisms are essential constituents of soil purification processes associated with groundwater quality (Schu¨tz et al. 2010). Coastal soils are generally saltaffected for certain hydrologic and geographical reasons, and salinity in coastal areas is the main reason for their poor crop yields (Kaur et al. 1998). Soil microbial

123

communities and their activity are greatly influenced by salinity (Rietz and Haynes 2003), which is a concern because microbial processes in soils control ecological functions and soil fertility (Tripathi et al. 2006). Knowledge of certain factors such as depth, grain size or temperature, controlling spatial and temporal patterns in bacterial abundance, cell biomass, and microbial activities are also important for characterizing the distribution and dynamics of these communities (Ayuso et al. 2009). Assessing direct impacts of salinity and nutrient levels on the soil microbial community is difficult in the field, since either factor would also impact other components of the system and indirectly influence microbial processes (Jackson and Vallaire 2009). To effectively understand and maintain groundwater reserves, it is important to investigate the identity and biogeochemical function of microbes within the aquifer system (Smith et al. 2012). Some evidence suggests that localized hydrodynamics, such as in regions of lateral exchange, can also produce spatial gradients of microbial metabolism (Claret and Boulton 2009) and microbial community structure (Andrushchyshyn et al. 2007; Febria et al. 2010; HaldaAlija et al. 2001; Iribar et al. 2008). Advances in metagenomic studies have allowed direct sequencing of complete environmental microbial genomes (Kennedy et al. 2010) and have greatly enhanced our knowledge of gene function, metabolic processes, community structure, and ecosystem response to environmental change (Smith et al. 2012). Molecular approaches such as 16S rDNA gene sequence analysis have revealed unique microflorae in the deep subsurface (Shimizu et al. 2006), as exemplified in terrestrial crystalline rocks (Pedersen et al. 1996a), sedimentary rocks (Fredrickson et al. 2004; Pedersen et al. 1996b; Takai et al. 2003), petroleum reservoirs (Orphan et al. 2000; Watanabe et al. 2002a, b), marine sediments (Inagaki et al. 2003), and subseafloor gas hydrates (Reed et al. 2002). With the development of molecular biology, cultivationindependent methods such as polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) have recently been developed and used, to determine genetic diversity of microbial communities and to identify individual members based on 16S rDNA and rRNA (Yoshie et al. 2001). In this study, water samples were collected at five observation wells and twenty soil samples were collected at different depths along the coast. The hydrogeochemistry results were used to determine whether the Donghai Island was influenced by seawater intrusion. The compositions of bacterial species in the microbial cultures with seawater were analyzed using 16 S rDNA PCR-DGGE. The goal of this paper was to describe if changes in microbial community structure are related to the seawater flux into the freshwater.

Environ Earth Sci

Method Study area and sampling Donghai Island (with area 286 km2) is the fifth largest island in China, and lies southeast of the city of Zhanjiang (Fig. 1), Guangdong Province. The island topography is relatively flat, and elevation is approximately 5–8 m. The climate of the study area is subtropical monsoon. Mean annual temperature is 32.4 °C (with mean monthly temperature 15.6 °C in January and 38.1 °C in July), and mean annual rainfall is 1,556 mm. There are few surface water bodies, and a few reservoirs and lakes distributed across the study area. The highest tidal level is 6.64 m (average 3.04 m) and lowest -0.73 m (average 0.87 m). The

salinity of seawater varies from 1.009 % (surface water) to 21.174 % (bottom water) in summer, and from 23.437 % (surface water) to 30.762 % (bottom water) in winter. The stratum is full-fledged tertiary and quaternary unconsolidated sand and clay and is spread throughout the study area (Luo and Su 2007). Latosol weathered from basalt is the main soil type. Seawater intrusion has changed the geochemical properties of groundwater and soil. The influence of seawater intrusion on the soil was characterized by (Wang 2010): (1) soil nutrient loss of 23.8–83.2 %; (2) soil organic matter declines of 23.8–27.9 %; (3) weakened microbial activity; and (4) reduced biodiversity. Field investigation was done in April 2009. Five groundwater samples were obtained from five observation wells (Fig. 1), and a seawater sample was also collected.

Fig. 1 Location of Donghai Island, along with hydrogeological map and sampling sites

123

Environ Earth Sci

stored at 2–5 °C prior to analysis. Nine soil samples from different layers were acquired from five observation wells, for detecting microbial communities (Fig. 1). The groundwater level were measured by water level gauge, the piezometric map and flow direction of aquifer are shown in Fig. 2. Twenty sediment samples were collected in the study area at different depths along profiles A and B. At the same sample point, a higher sample number indicates lower sample collection depth (i.e., A1-6 is collected deeper than A1-4), the sample collection depth is shown in Table 1. Sample points from the coastline between 380 and 110 m. Chemical analysis Alkalinity and physical parameters such as temperature, pH, and electrical conductivity (EC) were measured in the field. Major cation concentrations (Ca2?, Mg2?, Na?, and K?) were analyzed using inductively coupled plasma atomic emission spectroscopy (ICP-AES). Anion concentrations were ascertained for Cl-, SO42-, and Br- using ion chromatography system. DNA extraction

Fig. 2 The piezometric map and flow direction of aquifer

Table 1 The distribution of sampling location Serial number

Distance from the coastline (m)

Sampling depth(m)

A1

380

A1-4: 4.8; A1-5: 6.0; A16: 7.2

A2

350

A2-3: 3.6; A2-4: 4.8

A3

280

A3-3: 3.6; A3-4: 4.8

A4

220

A4-3: 3.6; A4-4: 4.8

A5

150

A5-3: 3.6; A5-4: 4.8

B1

300

B1-3: 3.6; B1-4: 4.8; B15: 6.0;

B3

150

B3-3: 3.6; B3-4: 4.8;

B4

140

B4-3: 3.6; B4-4: 4.8;

B5

110

B5-3; 3.6; B5-4: 4.8;

All samples were collected according to the Groundwater pollution Geological Survey evaluation norms (China Geological Survey 2008), piston washing well was used before sample collection, groundwater was sampled via submersible pump, and then stored in glass containers and frozen before transport to the laboratory, where they were

123

To construct a small insert genomic library at a low plasmid copy number, soil microbial DNA was extracted using the PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA), following the manufacturer’s protocol. DNA was precipitated with ethanol and resuspended in 30 ll of sterile water. As appropriate, the DNA preparations were diluted to reduce the concentration of inhibitory compounds for polymerase chain reaction (PCR) and stored at -20 °C. The detail method was used based on that of (Moffett et al. 2003). Polymerase chain reaction (PCR) primers The highly variable V3 region of 16S rDNA genes from the bacterioplankton community was amplified by PCR with primers PRBA338f (50 ACTCCTACGGGAGGCAGCAG) (Lane 1991) and PRUN518r (50 ATTACCGCGGCTGCTGG) (Muyzer et al. 1993), generating an amplification of 250 bp. The PCR mixture used for amplification of bacterial sequences contained 1 ll of extracted nucleic acids, 0.5 lM of each primer, 200 lM of each deoxyribonucleotide triphosphate, 10 ll of 5X GotaqÒ Flexi Buffer, 1.25 U GotaqÒ DNA Polymerase, 1.5 mM of MgCl2, and sterile MilliQ water to a final volume of 50 ll (Bucci et al. 2011). PCR amplification was performed with the following program (Bucci et al. 2011): 92 °C for 2 min; 30 cycles of denaturation at 92 °C for 1 min, annealing at 55 °C for

Environ Earth Sci

30 s, extension at 72 °C for 1 min; and a single final extension at 72 °C for 6 min.

Results and discussion

of these groundwater samples varied from 1,530 to 6,010 lS/cm (profile A) and 8,702.38 to 12,255.16 lS/cm (profile B). Examining EC (Saxena et al. 2003), groundwater was classified as fresh (\1,500 ls/cm), brackish (1,500–3,000 ls/cm), and saline ([3,000 ls/cm). Based on this classification, the percentages of groundwater samples in each group showed that 80 % of samples were brackish and 20 % saline, so brackish water was dominant in the area. The EC values were measured at 1-m intervals from the water surface, the vertical profiles of each monitoring well are displayed in Fig. 3. The map describes that the EC values at the well bottom are a little higher than those at the surface, and the EC values near the sea are higher than far from the coast. A higher EC value at the surface in bore B3 may due to the shrimp pool nearby. Total dissolved solids (TDS) which can be used to quantify groundwater salinity (Farid et al. 2013), also showed variation, 853–3,727 mg/l in profile A and 1,740–2,451 mg/l in profile B. According to the salinity classification of Rabinove et al. (1958), groundwater was classified as non-saline/freshwater (TDS \ 1,000 mg/L), slightly saline (TDS = 1,000–3,000 mg/L), moderately saline (TDS = 3,000–10,000 mg/L), and very saline (TDS [ 10,000 mg/L). Ninety percent of sampled groundwater from both profiles was slightly saline. Chemical analysis of groundwater samples indicates that the most dominant ions include Mg2?, Ca2?, Na?, Cl-, HCO3-, and SO42-. The chemical type of groundwater was Na–Cl, which indicates the influence of seawater intrusion. Variation of geochemical parameters, dominant ions and cations is illustrated in Table 2. In profile A, groundwater EC, TDS, Cl-, SO42-, Na ? , Ca2?, and Mg2? were higher in sample A5 (nearer the sea) than in A1 (farther from the sea), which suggests that coastal groundwater was strongly affected by seawater intrusion. In profile B, groundwater EC, TDS, Cl-, SO42-, Na?, Ca2?, and Mg2? were high in samples B5 (nearer the sea) and B3 (close to a shrimp pool), which suggests that groundwater salinization was influenced by both seawater intrusion and saline water leakage from the shrimp pool.

Hydrogeochemistry

DGGE patterns

Hydrochemical is a useful tool for diagnosing the salinization processes and to identify the origins of groundwater salinization. Usually, the major elements’ concentrations such as Na? and the physical parameters such as electrical conductivity (EC), and total dissolved solids (TDS) were used to delineate the salinity (Kharroubi et al. 2012; Farid et al. 2013). All major elements were determined for ten samples from profiles A and B in April 2009. Major hydrochemical parameters are presented in Table 2. Specific conductivity

The changes of microbial communities of the 20 samples collected at different locations from Zhanjiang’s Donghai Island were elucidated by the DGGE. A total of 12 bands were detected in the DGGE gel, shown in Fig. 4. Only the DGGE band 7 was detected in all profiles and some band positions were unique for specific site (e.g., bands 1, 3, 5, 9, 12). Bands 5, 6, 8, 10, 11 appeared only at the site which is near the sea, while the band 8 appeared both in profile A near the sea and in profile B far away from the sea. These differences indicated that some variance of microbial

Denaturing gradient gel electrophoresis (DGGE) DGGE was performed with a Dcode Universal Mutation Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The PCR product was loaded onto an 8 % (w/v) polyacrylamide gel in 1UTAE. The denaturant gradient range of the gel, in which 100 % denaturant contained 7 M urea and 40 % (v/v) formamide, was modified depending on the PCR product applied. Electrophoresis was run for 14 h at 60 °C at 100 V. The gels were stained for 20 min with SYBR Green I nucleic acid gel stain (1:10,000 dilution) (Biowhittaker Molecular Applications, Rockland, Maine, USA). The stained gel was immediately photographed under UV light. Scanned gels were analyzed with BioRad Quantity One software package (version 4.62). Subtract the lane background, detect the bands and make one lane as standard pattern, and the others were compared with each other for similarity using the coefficient of Dice. Similarity coefficient can be expressed as SD = 2NAB/(NA ? NB), where NA is the total number of bands of lane A, NB is the total number of bands of lane B, NAB is the bands number common to lane A and lane B. (Eichner et al. 1999), and the UPGMA cluster analysis was used to analyze microbial community similarity (Ying et al. 2008). Sequencing and phylogenetic analysis The dominant bands on the gel were recovered and sequenced. The sequence similarity was then performed with the GenBank nucleic acid databases using the BLAST algorithm. The phylogenetic tree construction was done using the neighbor-joining algorithm in the MEGA software (Xia et al. 2010).

123

Environ Earth Sci Table 2 Concentration of major elements of groundwater samples from Donghai Island

HCO3(mg/L)

Cl(mg/L)

6.9

853

375

76

93

228

13

38

6.6

1,522

838

99

66

408

16

56

59

2,330

7.2

1,269

611

105

153

315

11

71

49

A4

4,160

6.5

2,413

1292

202

66

664

35

61

95

A5

6,010

7.0

3,727

2,052

291

48

1,053

41

104

150

B1

10,900

6.8

10,529.24

1163

147

27

586

16

87

81

B2

10,100

7.7

8,702.38

943

124

53

510

24

44

65

B3

11,600

7.5

1278

164

62

694

32

60

82

B4

10,300

7.7

60

B5

11,800

7.6

12,255.16

Seawater

45,000

7.8

–

pH

A1

1,530

A2

2,890

A3

11,739.4 8,992

Fig. 3 The vertical electrical conductivity profiles of each monitoring well

communities’ compositions existed from profile A to profile B and even existed along the sea from far to near in the same profile (Hesham et al. 2011). Furthermore, another factor similarity coefficient of dice (SD) was used to compare with DGGE patterns. The SD ranged from 0.14 to 0.80. The cluster analysis indicated that the band patterns of samples of A1-4 and A4-3 had a close relationship with each other with a SD value of 0.67 in the profile A (Fig. 5), the patterns of samples of A3-4 and A4-4, A2-4 and A5-4, A2-3 and A5-3 were also similar to each other (SD value, 0.65, 0.63, 0.64, respectively). On the other hand, the patterns of samples of B1-3 and B1-4, B3-3and B3-4 displayed the highest similarities in the profile B with a SD value of 0.68. Compared with the profile A and B in the same group, the SD value is changed greatly compared with the results for profile A and B separately. The band patterns of samples of B1-5, B3-3 and B3-4 is quite different from other samples. These results also confirm that the microbial communities presented some changes in profile A to profile B and even along the sea from far to near in the same profile.

123

SO42(mg/L)

TDS (mg/L)

EC (lS/cm)

Na? (mg/L)

K? (mg/L)

Ca2? (mg/L)

Mg2? (mg/L) 28

971

119

77

537

22

46

1338

171

65

725

29

62

90

15,793

2,265

150

9,174

354

408

912

Linking the results of DGGE bands and cluster analysis of DGGE patterns with the concentrations of major elements in groundwater in the two profiles (Fig. 4), one could speculate that the variance of the DGGE bands and the SD value might be related to the changes in major elements’ concentrations. The bands 1, 3 only appeared in the sample of A2-3, mainly due to intense concentration change compared to the A1 and A3. The bands 9, 12 appeared in the sample of B3-3, B3-4 might be related to the shrimp pool nearby. At the sample site A2 and A5, the ion concentrations is similar, and the EC [4,000 ls/cm belonged the category of saline, meanwhile, the SD value of the band patterns A2-3 and A5-3, A2-4 and A5-4 were closely related to each other. The results for sample sites A3 (A34) and A4 (A4-3, A4-4) led to the same conclusion. The band patterns of samples of A1-6 are little different from others, maybe because the ion concentration is lower compared to other sample sites. These results could confirm the speculation. Sequence analysis To investigate the phylogenetic identities of some dominant DGGE bands, these nucleotide sequences were compared with known sequences in Genbank using the BLAST program (http://www.ncbi.nlm.nih.gov) Similarities between most bands and corresponding sequences were 100 %, which indicated that they belong to the same genus. Results are shown in Table 3 and the phylogenetic tree in Fig. 6. On the whole, different microbial communities were detected in the 20 soil samples. The sequences of band 7 was grouped into a-proteobacteria which was dominated in marine samples (Bernhard et al. 2005; Bouvier and del Giorgio 2002; Cottrell and Kirchman 2004; Garneau et al. 2006; Henriques et al. 2004), and related to uncultured bacterium clone VB48 which was belonged to diazotrophic

Environ Earth Sci

Fig. 4 DGGE patterns

Fig. 5 Cluster analysis of DGGE patterns. a Profile A; b profile B; c all the samples

(Fischer et al. 2012). Seawater flux into freshwater can increase NH4? (Edmonds et al. 2009), and the band 7 appeared in all the samples suggested that seawater intrusion really existed in the Donghai Island. Meanwhile, the sequences of band 3, 9, 10, and 12 were grouped into bproteobacteria and affiliated with Burkholderia sp., Burkholderia fungorum, uncultured Shigella sp. and uncultured bacterium clone HDB_SIST601, respectively. The

sequences of band 2, 4, 5, and 8 were grouped into cproteobacteria and belonged to Pseudomonas sp., uncultured Pseudomonas sp., uncultured bacterium and uncultured bacterium clone cd4d11, respectively. Usually, the bproteobacteria and c-proteobacteria were dominated in freshwater and brackish samples, and the previous studies have revealed that Pseudomonas sp. (Rangarajan et al. 2002), Burkholderia sp. (Green et al. 2008), Shigella sp.

123

Environ Earth Sci Table 3 Sequencing results Sample

Closest bacterial strain (NCBI accession)

Similarity %

putative taxonomic

1-1

Bacterium enrichment culture DGGE band D6 (GU270493)

100 %

Environmental samples

2-1

Pseudomonas sp. (FR749860)

98 %

cProteobacteria

3-1

Burkholderia sp. (EU723147)

100 %

bProteobacteria

4-1

Uncultured Pseudomonas sp. (GU300379)

100 %

cProteobacteria

5-1

Uncultured bacterium (FM997632)

100 %

cProteobacteria

7-1

Uncultured bacterium clone VB48 (JF297241)

100 %

aProteobacteria

8-1

Uncultured bacterium clone cd4d11 (HM580295)

100 %

cProteobacteria

9-1

Burkholderia fungorum (HQ284843)

100 %

bProteobacteria

10-1

Uncultured Shigella sp. (HQ914773)

100 %

bProteobacteria

11-1

Uncultured Chryseobacterium sp. (HQ686142)

100 %

Flavobacteria

12-1

Uncultured bacterium clone HDB_SIST601 (HM187351)

100 %

bProteobacteria

Conclusion

Fig. 6 Phylogenetic tree based on bacterial sequences

123

(Mahalakshmi et al. 2011) and Chryseobacterium sp. (Bakermans and Skidmore 2011) can survive in saline environments. The sequences of band 11 which was located at sample of B4-3, B4-4, B5-3, B5-4, was grouped into flavobacteria and affiliated to uncultured Chryseobacterium sp.; some research have indicated that the Flavobacteriaceae is the main composition of microbial communities in shrimp ponds (Li et al. 2010). Results confirm that the groundwater salinization was influenced by both seawater intrusion and saline water leakage from the shrimp pool in profile B. The microbial communities near the shore line might be influenced by the transient and complex mixing processes due to tidal forcing (Shimeta et al. 2002). In addition, the band 1 was grouped into environmental samples and quite different from others.

Our hydrogeochemical survey showed that groundwater was 90 % slightly saline in the coastal aquifer of Donghai Island, and coastal groundwater was influenced by seawater intrusion and saline water leakage from a shrimp pool. Using PCR-DGGE to analyze microbial community structure and species composition in the island seawater intrusion region, the results showed that the variance of the DGGE bands and the SD value is related to the changes in

Environ Earth Sci

major elements’ concentrations and the microbial communities presented some changes in profile A to profile B and even along the sea from far to near in the same profile. The b-proteobacteria and c-proteobacteria were the dominated microbial populations in profile A and profile B, respectively, suggesting that the microbial community structure changes with the degree of seawater intrusion. The shrimp ponds play a role in influencing the environmental microbial communities that are composed of Flavobacteriaceae. Acknowledgments 40773055).

This study was supported by NSFC (No.

References Andrushchyshyn OP, Wilson KP, Williams DD (2007) Ciliate communities in shallow groundwater: seasonal and spatial characteristics. Freshw Biol 52:1745–1761 Ayuso SV, Guerrero MC, Montes C, Lo´pez-Archilla AI (2009) Spatiotemporal distribution of microbial communities in a coastal, sandy aquifer system (Donana, SW Spain). Geobiology 7:66–81 Bakermans C, Skidmore ML (2011) Microbial metabolism in ice and brine at -5 degrees C. Environ Microbiol 13:2269–2278 Barlow PM, Reichard EG (2010) Saltwater intrusion in coastal regions of North America. Hydrogeol J 18:247–260 Bernhard AE, Donn T, Giblin AE, Stahl DA (2005) Loss of diversity of ammonia-oxidizing bacteria correlates with increasing salinity in an estuary system. Environ Microbiol 7(9):1289–1297 Bouvier TC, del Giorgio PA (2002) Compositional changes in freeliving bacterial communities along a salinity gradient in two temperate estuaries. Limnol Oceanogr 47(2):453–470 Bucci A, Naclerio G, Allocca V, Celico P, Celico F (2011) Potential use of microbial community investigations to analyse hydrothermal systems behaviour: the case of Ischia Island, Southern Italy. Hydrogeol Proces 25:1866–1873 Chen H, Zhang Y, Wang X, Ren Z, Li L (1997) Saltwater intrusion in the lower reaches of the Weihe River, Shandong Province, China. Hydrogeol J 5(3):82–88 China Geological Survey (2008) Groundwater pollution geological survey evaluation norms. China Geological Survey, Beijing Cissoko M, Desnues A, Bouvy M, Simengando T, Verling E, Bettarel Y (2008) Effects of freshwater and seawater mixing on virio- and bacterioplankton in a tropical estuary. Freshw Biol 53(6):1154–1162 Claret C, Boulton AJ (2009) Integrating hydraulic conductivity with biogeochemical gradients and microbial activity along rivergroundwater exchange zones in a subtropical stream. Hydrogeology J 17:151–160 Cottrell MT, Kirchman DL (2004) Single-cell analysis of bacterial growth, cell size, and community structure in the Delaware estuary. Aquat Microb Ecol 34(2):139–149 Edmonds JW, Weston NB, Joye SB, Mou X, Moran MA (2009) Microbial community response to seawater amendment in lowsalinity tidal sediments. Microb Ecol 58:558–568 Eichner CA, Erb RW, Timmis KN, Wagner-Dobler I (1999) Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community. Appl Environ Microbiol 65(1):102–109 Farid I, Trabelsi R, Zouari K, Abid K, Ayachi M (2013) Hydrogeochemical processes affecting groundwater in an irrigated land in Central Tunisia. Environ Earth Sci 68(5):1215–1231

Febria CM, Fulthorpe RR, Williams DD (2010) Characterizing seasonal changes in physicochemistry and bacterial community composition in hyporheic sediments. Hydrobiologia 647:113–126 Fischer D, Pfitzner B, Schmid M, Simoes-Araujo JL, Reis VM, Pereira W, Ormeno-Orrillo E, Hai B, Hofmann A, Schloter M, Martinez-Romero E, Baldani JI, Hartmann A (2012) Molecular characterisation of the diazotrophic bacterial community in uninoculated and inoculated field-grown sugarcane (Saccharum sp.). Plant Soil 356(1–2):83–99 Fredrickson JK, Zachara JM, Balkwill DL, Kennedy D, Li SM, Kostandarithes HM, Daly MJ, Romine MF, Brockman FJ (2004) Geomicrobiology of high-level nuclear waste-contaminated vadose sediments at the Hanford site, Washington State. Appl Environ Microbiol 70:4230–4241 Garneau M-E`, Vincent WF, Alonso-Sa´ez L, Gratton Y, Lovejoy C (2006) Prokaryotic community structure and heterotrophic production in a river-influenced coastal arctic ecosystem. Aquat Microb Ecol 42(1):27–40 Green SJ, Blackford C, Bucki P, Jahnke LL, Prufert-Bebout L (2008) A salinity and sulfate manipulation of hypersaline microbial mats reveals stasis in the cyanobacterial community structure. ISME J 2:457–470 Halda-Alija L, Hendricks SP, Johnston TC (2001) Spatial and temporal variation of Enterobacter genotypes in sediments and the underlying hyporheic zone of an agricultural stream. Microb Ecol 42:286–294 Hemme CL, Deng Y, Gentry TJ, Fields MW, Wu L, Barua S, Barry K, Tringe SG, Watson DB, He Z, Hazen TC, Tiedje JM, Rubin EM, Zhou J (2010) Metagenomic insights into evolution of a heavy metal: contaminated groundwater microbial community. ISME J 4:660–672 Henriques IS, Almeida A, Cunha A, Correia A (2004) Molecular sequence analysis of prokaryotic diversity in the middle and outer sections of the Portuguese estuary Ria de Aveiro. FEMS Microbiol Ecol 49:269–279 Hesham AE-L, Qi R, Yang M (2011) Comparison of bacterial community structures in two systems of a sewage treatment plant using PCR-DGGE analysis. J Environ Sci 23(12):2049–2054 Inagaki F, Suzuki M, Takai K, Oida H, Sakamoto T, Aoki K, Nealson KH, Horikoshi K (2003) Microbial communities associated with geological horizons in coastal subseafloor sediments from the sea of Okhotsk. Appl Environ Microbiol 69:7224–7235 Iribar A, Sa´nchez-Pe´rez JM, Lyautey E, Garabe´tian F (2008) Differentiated free-living and sediment-attached bacterial community structure inside and outside denitrification hotspots in the river-groundwater interface. Hydrobiologia 598:109–121 Jackson CR, Vallaire SC (2009) Effects of salinity and nutrients on microbial assemblages in Louisiana wetland sediments. Wetlands 29(1):277–287 Kaur B, Aggarwal AK, Gupta SR (1998) Soil microbial biomass and nitrogen mineralization in salt affected soils. Int J Ecol Environ Sci 24:103–111 Kennedy J, Flemer B, Jackson SA, Jejon DPH, Morrissey JP, O’Gara F, Dobson ADW (2010) Marine metagenomics: new tools for the study and exploitation of marine microbial metabolism. Mar Drugs 8:608–628 Kharroubi A, Tlahigue F, Agoubi B, Azri C, Bouri S (2012) Hydrochemical and statistical studies of the groundwater salinization in Mediterranean arid zones: case of the Jerba coastal aquifer in southeast Tunisia. Environ Earth Sci 67(7):2089–2100 Kinzelbach W, Bauer P, Siegfried T, Brunner P (2003) Sustainable groundwater management: problems and scientific tools. Episodes 26:279–284 Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M (eds) Nucleic acid techniques in bacterial systematics. John Wiley & Sons Ltd, Wast Sussexs, pp 115–175

123

Environ Earth Sci Li Q, Zhang Y, Juck D, Fortin N, Greer CW, Tang Q (2010) Phylogenetic analysis of bacterial communities in the shrimp and sea cucumber aquaculture environment in northern China by culturing and PCR-DGGE. Aquacult Int 18(6):977–990 Liang C, Zhou X, Chen M (2002) An approach to the optimal schemes of groundwater withdrawal under the consideration of prevetion of sea water intrusion in the Leizhou Peninsula. Geoscience 16(4):429–434 (in Chinese with English abstract) Luo Q, Su Z (2007) The characteristic analysis and the prevention and control methods from the seawater intrusion in Naozhou Island. J Geol Hazards Environ Preserv 18(2):28–32 (in Chinese with English Abstract) Madsen FL, Ghiorse WC (1993) Groundwater microbiology: subsurface ecosystem processes. In: Ford TE (ed) Aquatic microbiology: an ecological approach. Blackwell Scientific Publication, Oxford, pp 167–213 Mahalakshmi M, Srinivasan M, Murugan M, Balakrishnan S, Devanathan K (2011) Isolation and identification of total heterotrophic bacteria and human pathogens in water and sediment from Cuddalore fishing harbour after the tsunami. Asian J Biol Sci 4:148–156 Moffett BF, Nicholson FA, Uwakwe NC, Chambers BJ, Harris JA, Hill TCJ (2003) Zinc contamination decreases the bacterial diversity of agricultural soil. FEMS Microbiol Ecol 43(1):13–19 Muyzer G, Dewaal EC, Uitterlinden AG (1993) Profiling of complex microbial populations by denaturing gradient gel elctrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59:695–700 Orphan VJ, Taylor LT, Hafenbradl D, Delong EF (2000) Culturedependent and culture-independent characterization of microbial assemblages associated with high-temperature petroleum reservoirs. Appl Environ Microbiol 66:700–711 Pedersen K, Arlinger J, Ekendahl S, Hallbeck L (1996a) 16S rRNA gene diversity of attached and unattached bacteria in boreholes ¨ spo¨ hard rock laboratory, along the access tunnel to the A Sweden. FEMS Microbiol Ecol 19:249–262 Pedersen K, Arlinger J, Hallbeck L, Pettersson C (1996b) Diversity and distribution of subterranean bacteria in groundwater at Oklo in Gabon, Africa, as determined by 16S rRNA gene sequencing. Mol Ecol 5:427–436 Post VEA (2005) Fresh and saline groundwater interaction in coastal aquifers: is our technology ready for the problems ahead? Hydrogeol J 13:120–123 Qi S, Qiu Q (2011) Environmental hazard from saltwater intrusion in the Laizhou Gulf, Shangdong Province of China. Nat Hazards 56:563–566 Rabinove CL, Longford R H, Brookhar J W (1958) Saline water resources of North Dakota. US Geological Survey Water Supply, Paper 1418, p 364 Rangarajan S, Saleena LM, Nair S (2002) Diversity of Pseudomonas spp. isolated from rice rhizosphere populations grown along a salinity gradient. Microbial Ecol 43:280–289 Reed DW, Fujita Y, Delwiche ME, Blackwelder DB, Sheridan PP, Uchida T, Colwell FS (2002) Microbial communities from methane hydrate-bearing deep marine sediments in a forearc basin. Appl Environ Microbiol 68:3759–3770 Rietz DN, Haynes RJ (2003) Effects of irrigation induced salinity and sodicity on soil microbial activity. Soil Biol Biochem 35:845–854 Saxena VK, Singh VS, Mondal NC, Jain SC (2003) Use of chemical parameters to delineation fresh ground water resources in Potharlanka Island, India. Environ Geol 44(5):516–521 Schu¨tz K, Kandeler E, Nagel P et al (2010) Functional microbial community response to nutrient pulses by artificial groundwater recharge practice in surface soils and subsoils. FEMS Microbiol Ecol 72:445–455

123

Shimeta J, Amos CL, Beaulieu SE, Ashiru OM (2002) Sequential resuspension of protists by accelerating tidal flow: implications for community structure in the benthic boundary layer. Limnol Oceanogr 47(4):1152–1164 Shimizu S, Akiyama M, Ishijima Y, Hama K, Kunimaru T, Naganuma T (2006) Molecular characterization of microbial communities in fault-bordered aquifers in the Miocene formation of northernmost Japan. Geobiology 4:203–212 Smith RJ, Jeffries TC, Roundnew B, Fitch AJ, Seymour JR, Delpin MW, Newton K, Brown MH, Mitchell JG (2012) Metagenomic comparison of microbial communities inhabiting confined and unconfined aquifer ecosystems. Environ Microbiol 14:240–253 Stein H, Kellermann C, Schmidt SI, Brielmann H, Steube C, Berkhoff SE, Fuchs A, Hahn HJ, Thulin B, Griebler C (2010) The potential use of fauna and bacteria as ecological indicators for the assessment of groundwater quality. J Environ Monit 12:242–254 Sternberg LSL, Ish-Shalom-Gordon N, Ross M, O’Brien J (1991) Water relations of coastal plant communities near the ocean/ freshwater boundary. Oecologia 88(3):305–310 Takai K, Mormile MR, McKinley JP, Brockman FJ, Holben WE, Kovacik WP Jr, Fredrickson JK (2003) Shifts in archaeal communities associated with lithological and geochemical variations in subsurface Cretaceous rock. Environ Microbiol 5:309–320 Tripathi S, Kumari S, Chakraborty A, Gupta A, Chakrabarti K, Bandyapadhyay BK (2006) Microbial biomass and its activities in salt: affected coastal soils. Boil Fertil Soils 42:273–277 Wang J (2010) Geochemical processes of seawater intrusion and its microbial responsibility in Donghai Island. China Natural Science Foundation Summary Report, p 36 Watanabe K, Kodama Y, Hamamura N, Kaku N (2002a) Diversity, abundance, and activity of archaeal populations in oil-contaminated groundwater accumulated at the bottom of an underground crude oil storage cavity. Appl Environ Microbiol 68:3899–3907 Watanabe K, Kodama Y, Kaku N (2002b) Diversity and abundance of bacteria in an underground oil-storage cavity. BMC Microbiol 2:23 Werner AD, Simmons CT (2009) Impact of sea-level rise on seawater intrusion in coastal aquifers. Ground Water 47:197–204 Werner AD, Bakker M, Post VEA, Vandenbohede A, Lu C, AtaieAshtiani B, Simmons CT, Barry DA (2012) Seawater intrusion processes, investigation and management: Recent advances and future challenges. Adv Water Resour. doi:10.1016/j.advwatres. 2012.03.004 WHO (2011) Guidelines for Drinking-water Quality, 4th Edition. p 564 Wu J, Meng F, Wang X, Wang D (2008) The development and control of the seawater intrusion in the eastern coastal of Laizhou Bay. China Environ Geol 54:1763–1770 Xia S, Li J, Wang R, Li J, Zhang Z (2010) Tracking composition and dynamics of nitrification and denitrification microbial community in a biofilm reactor by PCR-DGGE and combining FISH with flow cytometry. Biochem Eng J 49(3):370–378 Ying YL, Zhen M, Hang M, Jun C (2008) Dynamic changes of microbial community diversity in a photohydrogen producing reactor monitored by PCR-DGGE. J Environ Sci 20:1118–1125 Yoshie S, Noda N, Miyano T, Tsuneda S, Hirata A, Inamori Y (2001) Microbial community analysis in the denitrification process of saline-wastewater by denaturing gradient gel electrophoresis of PCR-amplified 16 s rDNA and the cultivation method. J Biosci Bioeng 92(4):346–353 Zalidis G, Stamatiadis S, Takavakoglou V, Eskridge K, Misopolinos N (2002) Impacts of agricultural practices on soil and water quality in the Mediterranean region and proposed assessment methodology. Agric Ecosyst Environ 88(2):137–146