Neurochem Res (2012) 37:722–731 DOI 10.1007/s11064-011-0664-2

ORIGINAL PAPER

TNF-a Expression in Schwann Cells is Induced by LPS and NF-jB-Dependent Pathways Yongwei Qin • Minhui Hua • Yinong Duan Yongjing Gao • Xiaoyi Shao • Haibo Wang Tao Tao • Aiguo Shen • Chun Cheng

• •

Received: 8 November 2011 / Accepted: 23 November 2011 / Published online: 5 January 2012 Ó Springer Science+Business Media, LLC 2012

Abstract Lipopolysaccharide (LPS) is recognized by Tolllike receptor 4 and activates mitogen-activated protein kinase, which leads to the induction of proinflammatory cytokine gene expression. In vivo, Schwann cells (SCs) at the site of injury may also produce tumor necrosis factor-a (TNF-a). However, the precise mechanism that regulates TNF-a synthesis is still not clear. The nuclear transcription factor-jB (NF-jB) is an important transcription factor which is involved in the regulation of host immune responses. In the present study, we found that LPS possessed a comparable specific activity for activation of NF-jB-dependent gene expression in SCs. We also observed IjB-a/IjB-b degradation and the nuclear translocation of P65 due to LPS treatments. LPS-elicited TNF-a production in SCs was also drastically suppressed by SN50 (NF-jB inhibitor). Keywords Lipopolysaccharide
Schwann cell
Tumor necrosis factor-a
NF-jB

Yongwei Qin and Minhui Hua contributed equally to this work. Y. Qin
Y. Duan
X. Shao
H. Wang
T. Tao
C. Cheng (&) Department of Pathogen Biology, Medical College, Nantong University, 19 Qixiu Road, Nantong 226001, Jiangsu, China e-mail: [email protected] M. Hua Department of Obstetrics and Gynecology, The Affiliated Hospital of Nantong University, Nantong, China Y. Gao Institute of Nautical Medicine, Jiangsu Key Laboratory of Neuroregeneration, Nantong University, Nantong, China A. Shen Key Laboratory for Neuroregeneration of JiangSu Province, Nantong University, Nantong, China

123

Introduction The Guillain–Barre’ syndrome (GBS) and chronic inflammatory demyelinating poly-radiculoneuropathy (CIDP) are prototypic immune-mediated demyelinating neuropathies. Glias could act as antigen presenters and are of critical importance in the amplification and effector phase of immune-mediated demyelination by the secretion of proinflammatory cytokines, release of active mediators [1]. Schwann cells (SCs) are neuroglia of the peripheral nervous system (PNS). Besides their role in myelination, trophic support and regeneration of axons, SCs exhibit potential immune functions, similarly to non-myelinating glia of the central nervous system (CNS), SCs can be induced to produce cytokines and chemokines, expressing major histocompatibility complex class II molecules (MHCII), adhesion molecules and serves as an antigen presenting cell (APC). They produce chemokines and macrophage inflammatory protein-1a [2], which recruits macrophages from the blood vessels and induces local inflammation. In vivo, SCs at the site of injury may also produce TNF-a, as SCs are activated and/or damaged following nerve injury, producing cytokines and neuroactive factors, and have recently been described to possess an increasing number of macrophage-like characteristics. In addition, SCs in the course of experimental autoimmune neuritis the murine model for the human Guillain–Barre syndrome or Wallerian degeneration following an axonal injury can produce TNF-a, IL-1a and IL-1b [3]. NF-jB plays a pivotal role in the regulation of the host innate antimicrobial response. NF-jB is a family of transcription factors composed of five gene products (RelA/ P65, cRel, RelB, P50, P52) that combine to form active dimers. The predominant form is a heterodimer containing the P50 and P65 subunits. Each of these subunits is

Neurochem Res (2012) 37:722–731

characterized by a Rel homology domain involved in dimerization, DNA binding, interaction with the inhibitory IjB proteins, and nuclear localization. Unlike the P50 subunit, P65 also contains a transcriptional activator domain indispensable for NF-jB transcriptional activity. In most resting cells, the P50/P65 heterodimer is sequestered in the cytoplasm by association with the inhibitor jB (IjB). NF-jB is activated when signals from various stimuli are transduced to the IjB kinase (IKK) complex, which phosphorylates IjB-a and IjB-b isoforms [4, 5]. Phosphorylated IjBs are rapidly degraded by an ubiquitin/proteasome pathway, and the free NF-jB complex is translocated into the nucleus to activate expression of its target genes. Then, IjB-a is re-synthesized in an NF-jB-dependent manner, enters in the nucleus and removes the P50/P65 heterodimer from the DNA [6, 7]. Many microbial pathogens trigger cellular signal transduction pathways that induce NF-jB activation or subvert these pathways to overcome the innate immune response. NF-jB regulates the expression of many immunological mediators, including cytokines, their receptors, and components of their signal transduction [8]. TNF-a is a pleiotropic cytokine, the regulation of TNF-a gene expression in cells of the monocytic lineage are stimulus-dependent and quite complex, involving controls at both transcriptional and posttranscriptional levels. Many studies of the transcriptional regulation of TNF-a have focused on the investigation of transcription factors that bind to the responsive element sites within the TNF-a promoter, such as NF-jB [9], signal transducers and activators of transcription [10], and lipopolysaccharideinduced TNF-a factor (LITAF) [11]. However, the relative contributions of transcriptional activation of the TNF-a gene in SCs are poorly understood. In the present work, we investigated NF-jB and the regulation of TNF-a production in SCs upon LPS stimulation. Our results demonstrated that a rapid increase in NF-jB activation is accompanied with increase of TNF-a production. We also found that the treatment of LPSstimulated SCs with specific inhibitors SN50 partially reduce TNF-a production. Meanwhile, we examined whether or not NF-jB activation is associated with the MAPK activation cascade.

Materials and Methods Antibodies and Reagents Antibodies against IjB-a and IjB-b were obtained from Cell signal technology; P65 and PCNA were from Santa Cruz Biotechnology. SN50 were from CALBIOCHEM.

723

SC Cultures The primary culture of SCs was cultured from excised dorsal root ganglion (DRG), brachial plexus and sciatic nerves from SD rat as described previously. Briefly, cells were cultured with dulbecco’s modified eagle’s medium (DMEM) containing 10% calf serum. In order to reduce the number of dividing fibroblasts, SCs cultures were treated with monoclonal antibody anti-thy 1.1 and a rabbit complement [12]. Fibroblast contamination was minimal after this stage (about 1.5%). Most primary cells are particularly difficult to culture, therefore, we select Schwann cells line (RSC96) (Cell Bank, Chinese Academy of Sciences) to perform the Western-blot and part immunofluorescence experiments. Rat Schwann cells line were cultured in DMEM (high glucose) containing 10% fetal bovine serum and a penicillin–streptomycin mixture (Invitrogen, Carlsbad, CA, USA) [13]. The final concentrations in the culture medium are 100 lg/ml streptomycin and 100 units/ml penicillin. We used passages 5–12 for experiments. For cell culture use, LPS (Escherichia coli, 0127:B8, Sigma) should be reconstituted by adding cell culture medium to a vial and swirling gently until the powder dissolves. LPS concentration was 1 lg/ll. SCs cultures were primed for indicated times with LPS. In some experiments, U0126, SB202190, SP600125 and SN50 were applied 1 h prior to LPS stimulation. Detection of TNF-a by ELISA Following treatment of the cells for the indicated concentrations and times in triplicate wells, the conditioned medium was collected and centrifugated, and TNF-a levels in the supernatant were assessed using an enzyme-linked immunosorbent assay (ELISA) (Biosource) according to the instruction of the manufacture. RNA Isolation and RT-PCR Analysis Total cytoplasmic RNA of primary SCs was extracted using Trizol extraction kit according to the manufacturer’s protocol. Total RNA was reverse-transcribed using ThermoScript RT-PCR system (Invitrogen, USA). Primer sequences used in this report were listed as follows: TNF-a primers: sense, CGTCGTAGCAAACCACCAAG; antisense, CACAGAGCAATGACTCCAAAG. The GAPDH was used as an internal control and was detected using the following primers: sense, TGATGACATCAAGAAGGT GGTGAAG; antisense, TCCTTGGAGGCCATGTGGGC CAT. PCR was performed in a Mastercycler personal with the following parameters: TNF-a (denaturation at 94°C for

123

724

45 s, annealing at 55°C for 45 s, and extension at 72°C for 1 min each step), 26 cycles; GAPDH (94°C for 45 s, at 55°C for 45 s, 72°C for 1 min), 24 cycles. Aliquots of the PCR products were analyzed on 1% agarose gel. Meanwhile, the expression of the genes was determined by qutitative RT-PCR (LightCycler1 2.0 Real-Time PCR System, Roche Diagnostics, Mannheim, Germany) using the TaqMan Expression Assays (Roche Diagnostics). Two microliter of cDNA was used for qRT-PCR, and the reaction was performed at 95°C for 10 min, followed by 45 cycles of 94°C for 10 s and 55°C for 30 s. The expression level of the genes was normalized to GAPDH. The data was analyzed using the LightCycle software version 4.0 (Roche Diagnostics). Immunoblot Analysis After appropriate stimulation, RSC96 lysates were obtained by scratching cell in a lysate buffer. Nuclear and cytoplasmatic cell extracts were obtained as described previously [14]. Treated RSC96 were washed with cold PBS once and scraped into 1 ml of PBS. Cells were then centrifuged at 5,0009g for 5 min, and the pellet was dissolved in cytoplasm extraction buffer (10 mM HEPES, 1 mM EDTA, 60 mM KCl, 0.075% Igepal, and a protease and phosphatase inhibitor mixture) and suspended by passage through a 200 ll pipette tip. After 30–45 min of incubation at 4°C, the samples were centrifuged at 5,0009g for 5 min to generate the cytoplasmic extract in the supernatant. The supernatant was then removed, and the cytoplasmic extract was centrifuged again at 12,0009g for 10 min to yield a supernatant containing the final cytoplasmic extract. Nuclear extraction buffer (20 mM Tris–HCl, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% glycerol, 0.5% Igepal, and a protease and phosphatase inhibitor mixture) was added to the pellet followed by 5 M NaCl to break the nuclear membrane. After 30–45 min of incubation at 4°C, the samples were centrifuged at 12,0009g for 10 min to generate a supernatant containing the final nuclear extract. Purity of cytoplasmic and nuclear lysates were confirmed by the absence of b-actin immunoreactivity in the nuclear lysate and the absence of histone H1 immunoreactivity in the cytoplasmic lysates in Western immunoblotting. The proteins concentrations in each sample were determined by the method of Bradford. Proteins were loaded into wells of a 10% acryl/bisacrylamide gel, and after separation, proteins were transferred to a Polyvinylidene fluoride (PVDF) membrane. After saturation in Tris-Buffered Saline Tween-20 (TBST) containing 5% milk, primary antibody and secondary horseradish peroxidase-conjugated antibody diluted in TBST were sequentially added to and incubated with the membranes for

123

Neurochem Res (2012) 37:722–731

overnight and 2 h, respectively. Revelation was obtained by ECL (pierce biotechnology). Immunocytochemistry The primary SCs or RSC96 were fixed with 4% formaldehyde for 30 min, then treated with 0.1% TritonX-100/ Phosphate Buffered Saline (PBS) for 5 min, and incubated with PBS containing 3% normal goat serum for 1 h. The cells were incubated overnight at 4°C with polyclonal anti NF-jB P65 antibody (Santa Cruz, USA). After the cells being rinsed with PBS, they were incubated with tetramethyl rhodamine isothiocyanate (TRITC)-labeled donkey anti-rabbit IgG or fluorescein isothiocyanate (FITC)-conjugated donkey anti-rabbit IgG (Jackson, USA). The cells were rinsed and mounted onto slides, which were then analyzed and imaged by confocal laser scanning microscopy. Quantification of the Amount of P65-Translocated Cells In each group, at least 500 cells/well were examined in terms of the nuclear translocation of P65. The number of cells in which P65 had translocated into the nucleus was counted against the total cell number. Cell Viability and Morphological Features Representative cell populations from each condition were examined under light microscopy. No significant change was noted under any condition. Viable cells were classified as those that were adherent and displayed Trypan blue exclusion. Statistical Analysis All data were analyzed by one-way ANOVA followed by post hoc comparisons for multiple groups. All experiments were conducted a minimum of three times. Statistical significance was indicated by P \ 0.05.

Results LPS Induces IjB-a and IjB-b Degradation in SCs A critical regulatory control points on the pathway to NFjB activation are phosphorylation, ubiquination and subsequent degradation of IjB-a and IjB-b [15]. We have therefore estimated using Western blot the level of IjB-a

Neurochem Res (2012) 37:722–731

725

whole cell was not changed before and after treated with LPS. These results suggest that LPS induces IjB-a and IjB-b degradation in SCs. LPS Induces Activation and Nuclear Translocation of NF-jB P65 in SCs Like other members of the NF-jB family, P65 resides in the cytoplasm in an inactive form bound to inhibitory IjB proteins. Cellular activation results in the nuclear translocation of P65 for initiating gene transcription [16]. We therefore assessed by Western blot and indirect immunofluorescence the nuclear translocation of NF-jB P65 subunit after its activation by LPS treatment of the RSC96. As shown in Fig. 1C, Western blot analysis was performed using nuclear extracts. The amount of NF-jB P65 levels were increased by treatment with LPS for 20 min, and after 60 min period of treatment with LPS, the NF-jB protein levels decreased in the nuclues. P65 immunoreactivity was little in the nucleus of untreated cells (Fig. 2A), but it was evenly distributed throughout the cytoplasm (Fig. 2B). Incubation with 10 lg/ml LPS caused a shift of NF-jB P65 towards the perinuclear area at 20 min (Fig. 2C) and towards the nucleus at 40 min (Fig. 2D). Meanwhile, in the primary culture of SCs, NF-jB P65 was located in the nucleus after stimulated with 10 lg/ml LPS (Fig. 3) These results indicate that LPS induces activation and nuclear translocation of NF-jB P65 in SCs. The MAPK Inhibitor Partial Blocks LPS-Induced NFjB Activation in SCs

Fig. 1 Time course of IjB-a and IjB-b degradation and P65 nuclear translocation. RSC96 were stimulated with 10 lg/ml LPS for the periods indicated (20, 40, 60 min). Whole cell, nuclear or cytoplasmic extracts were immunoblotted with anti-P65, anti-IjB-a, anti-phosphorylated-IjB-a (Ser32), anti-IjB-b, anti-tubulin and anti-PCNA antibodies. Densitometric values were plotted and values represented the means ± SEM. *P \ 0.05, #P \ 0.05, HP \ 0.05 versus LPS untreated RSC96. C: cytoplasmic, T: total, N: nuclear

and IjB-b in the cytosol. As shown in Fig. 1A, Stimulation of RSC96 with LPS (20–60 min) results in the phosphorylation of IjB-a and degradation of IjB-a. Untreated cells constitutively expressed a very low level of phosphorylated IjB-a and high level of IjB-a. We also examined the effect of LPS on IjB-b degradation in SCs (Fig. 1B). LPS decreased the level of IjB-b protein almost at 20–40 min. IjB-b was re-synthesized and again restored to normal levels at 60 min. The amount of P65 protein in

We have investigated that induction of TNF-a by LPS in SCs is regulated by MAPK activation signals [17]. Under the assumption that either MAPK is located upstream from NF-jB, the activation of NF-jB was examined in the presence of MAPK inhibitors in LPS-stimulated SCs (Fig. 4). In non-stimulated RSC96, low level of P65 was detected, thus indicating that NF-jB was not activated (Fig. 4A, Ba). The stimulation of cells with LPS gave rise to the nuclear translocation of P65, thereby indicating the activation of NF-jB (Fig. 4A, Bb). The stimulation of MAPK inhibitors (U0126, SB202190, SP600125)-pretreated cells with LPS resulted in the decrease of P65 in the nuclear (Fig. 4A), indicating that MAPK are located upstream of NF-jB. This correlated with the result of immunofluorescent (Fig. 4B). Quantification of the result of immunofluorescence was examined in terms of the nuclear translocation of P65 (Fig. 4Bf). Therefore, these data suggest that MAPK activation may result in an increase in the phosphorylation of IjB and P65 nuclear translocation in LPS-treated cells.

123

726 Fig. 2 LPS induces P65 subunit translocation in RSC96. Cell were grown on coverslips and treated with 10 lg/ml LPS for 10, 20, 40, 60 min. Nuclear translocation of P65 was detected by TRITC-labeled antiP65 antibody and analyzed by microscopy. Quantification of the result of immunofluorescence was examined in terms of the nuclear translocation of P65 (Lower panel). Scale bars 20 lm (A–D)

Fig. 3 LPS induces P65 subunit translocation in the primary culture of SCs. Cell were untreated or treated with 10 lg/ml LPS for 40 min. Nuclear translocation of P65 was detected by FITC-labeled anti-P65 antibody and analyzed by microscopy. Scale bar 20 lm

123

Neurochem Res (2012) 37:722–731

Neurochem Res (2012) 37:722–731

727

Fig. 4 Inhibition of LPSinduced P65 nuclear translocation by MAPK inhibitors. RSC96 were pretreated with 10 lM U0126 (B, c), 20 lM SB202190 (B, d), 30 lM SP600125 (B, e) for 1 h, then stimulated with 10 lg/ml LPS for 30 min. Nuclear translocation of P65 was detected by Western-blot (A) or TRITC-labeled anti-P65 antibody and analyzed by microscopy (B). Quantification of the result of immunofluorescence was examined in terms of the nuclear translocation of P65. Asterisks indicated a P value of \ 0.01 in comparison to the panel of LPS (B, f). Scale bars 20 lm (a–e)

Possibility of NF-jB Involvement in TNF-a Production in LPS-Stimulated SCs To assess the effect of blocking NF-jB translocation after stimulation on TNF-a production, we used the synthetic peptide SN50. SN50 contains a signal sequence of the P50 subunit of NF-jB, which has been shown to block nuclear translocation of activated NF-jB [18]. SN50 were found to effectively and dose dependently inhibits the translocation of P65 in LPS-stimulated SCs (Fig. 5A). Furthermore, immunofluorescence for P65 revealed that SN50

suppresses the translocation of P65 to the nucleus. The density of immunofluorescence was significantly decreased, as observed in SN50-pretreated SCs (Fig. 5B, C). The fluorescence intensity of the P65 at the nucleus was determined using Image J software [19]. These results indicate that SN-50 plays a role as an inhibitor of NF-jB activation in SCs. The TNF-a promoter contains not only the LITAF-binding site but also sites for NF-jB, activating protein 1, and others, corresponding transcription factors can also be induced by LPS to bind to the TNF promoter and regulate its gene expression. Alternatively, in some

123

728

Neurochem Res (2012) 37:722–731

Fig. 5 Effects of NF-jB inhibitor (SN50) on NF-jB P65 activation in SCs. (A) Effects of SN50 on the translocation of NF-jB were performed by Western-blot. (B) Effects of SN50 on the nuclear translocation of P65. SCs were pretreated with SN50 (2.5 lM) for 1 h, then stimulated with LPS (10 lg/ml) for 40 min. Each group was immunocytochemically analyzed for P65, as described in experimental procedures. Scale bar 20 lm. (C) The fluorescence intensity of the P65 at the nucleus, as a ratio of that detected in the nucleus, was determined using Image J software by measuring the average pixel intensity within 500 cells of each group. Asterisks indicated P \ 0.05

cases, cytokine gene expression is regulated by cofactors that singly reduce promoter activity but together enhance it to a significant extent [20]. NF-jB was actived in LPSstimulated SCs, whether NF-jB was associated with the induction of TNF-a in LPS-stimulated SCs, we detected the TNF-a in LPS-stimulated SCs pretreatment with SN50. The pretreatment of SCs with SN50 led to a marked decrease in TNF-a mRNA (Fig. 6A, B) and TNF-a protein (Fig. 6C) production compared with no treatment. The inhibitory effect of SN50 was also found to be doesdependent. These results suggest that activation of NF-jB is involved in the induction of TNF-a in LPS-stimulated SCs.

Discussion This study demonstrate a role for NF-jB in the LPS signaling cascade in SCs. This is suggested from the observation that SCs exposure to LPS activates NF-jB and that pretreatment with SN50 against NF-jB inhibits LPSinduced NF-jB P65 subunit nuclear translocation and TNF-a expression. Shamash et al. [3] have been shown to induce TNF-a expression in SCs following nerve injury, little is known about the activation of intracellular signaling pathways by LPS leading to their expression in SCs. It is now well known that TLR4 acts as an innate immune recognition

123

receptor essential for LPS signalling. We have investigated the induction of TNF-a by LPS in SCs is regulated by TLR4 and MAPK activation signals [21]. A complete understanding of the cellular signaling mechanisms involved in the induction of TNF-a should identify novel targets for the therapeutic intervention in TNF-a-mediated neuro-inflammatory and neurodegenerative diseases. The activation of NF-jB might have been predicted, given the role of NF-jB in proinflammatory cytokine production [22], it is important to demonstrate experimentally that this activation plays a critical role in LPS induced SCs activation. While suppression of NF-jB appears to be an attractive concept in the approach to treating inflammation or pain and, unselective and complete inhibition of NF-jB may lead to deleterious effects in terms of cell survival. Specifically, TNF-a cytokine production is abolished when NF-jB inhibitors SN50 are used to pretreat SCs stimulated with LPS. Taken together, these data indicate that LPS induces IjBa degradation and that NF-jB activation is important for TNF-a secretion. NF-jB augments the expression of adhesion molecules, such as intercellular adhesion molecule 1, vascular-cell adhesion molecule 1, and E-selectin [23], and is thereby instrumental in the recruitment of leukocytes from the circulation to the site of inflammation. Moreover, NF-jB regulates the expression of matrix metalloproteinases [24], which facilitates the migration of these cells through the blood–nerve barrier [25].

Neurochem Res (2012) 37:722–731

Fig. 6 Inhibitory effect of SN50 on TNF-a mRNA and TNF-a production. (A) Effects of SN50 on TNF-a mRNA induction. The cells were stimulated with 10 lg/ml of LPS only or LPS plus different concentrations of SN50 (2.5 and 5 lM) for 1 h. Total RNA was isolated and the expression of TNF-a was determined by RT-PCR. (B) Suppression effect of SN50 on the mRNA expression of TNF-a. The cells were stimulated with 10 lg/ml of LPS only or LPS plus different concentrations of SN50 (2.5 and 5 lM) for 1 h. TNF-a mRNA was determined by qutitative RT-PCR, as described in the ‘‘Materials and Methods’’ section. GAPDH was used as a control. *P \ 0.001 indicates a significant difference from the unstimulated control group. **P \ 0.01 and ***P \ 0.005 indicate significant differences from the SN50-untreated (LPS-treated) group. (C) Inhibitory effect of SN50 on TNF-a production in the culture medium was determined using commercially available TNF-a ELISA kit. The data were obtained from three independent experiments and are expressed as the mean ± SD. *Significant difference between untreated cultures and cultures treated with 10 lg/ml LPS (n = 3; *P \ 0.01). *Significant difference between un-pretreated or pretreated with 2.5 lM SN50 (n = 3; **P \ 0.05); pretreated with 5 lM SN50 (n = 3; ***P \ 0.05)

729

Recent studies have shown that MAPK are important mediators to regulate the NF-jB-dependent gene expression in various cell types. It has been well established that inflammatory responses following exposure to LPS are highly dependent on activation of transcription factor NFjB which plays an important role in regulation of several gene expression [26–30]. The relation of MAPK to NF-jB activation in SCs is investigated using specific MAPK inhibitors, U0126, SB202190, SP600125 (Fig. 4). Since the MAPK inhibitors do partially affect the translocation of NF-jB P65, MAPK are thought to be associated with the induction of TNF-a in SCs [17]. Our findings may emphasize the functional significance of this transcription factor in the pathogenesis of inflammation in the PNS and emphasize the critical role of SCs in the disease process. TNF-a is a pleiotropic cytokine that can cause either beneficial or detrimental properties through its proinflammatory and proapoptotic effects in various cell types [31]. In a study using a Wallerian degeneration model, impairment of macrophage invasion in TNF-a or ICAM-1 deficient animals resulted in a higher number of preserved axons after peripheral nerve axotomy [32]. However, their mechanism of intracellular signal transduction is different. The extent and longevity of the inflammatory response is dependent on positive feedback loops involving cytokine signaling. Cells directly activated by pathogens produce chemokines and cytokines that recruit and activate immune cells of greater number and diversity, which in turn produce more cytokines. Autocrine and paracrine signaling by cytokines occurs via NF-jB and is necessary to sustain and amplify the activated state of NF-jB [33, 34]. Based on our results from the present study, the production of TNF-a are significantly increased in primary cells treated with LPS. SCs can act as antigen presenters and exert potent immunoregulatory functions. They are able to terminate immuno-inflammatory reactions through the release of humoral factors such as nitric oxide [35] or prostaglandin E2, and express molecules such as Fas or Fas ligand that can terminate T cell inflammation and down regulate immune functions [36]. To which extent such immuno-regulatory mechanisms are promoted by NFjB or inhibited by IjB in SCs clearly warrants further investigation. Several clinical and experimental lines of evidence have highlighted the multiple roles of TNF in the pathogenesis of inflammation-derived demyelinating diseases of the central nervous system and the peripheral nervous system. Nevertheless, it is still not entirely clear whether SCs protect or harm neurons and whether TNF-a is beneficial or toxic. Recent reports indicate that the dual actions of TNFa are mediated via different TNF receptors, with the TNFR1 eliciting neurotoxic effects and the TNFR2

123

730

eliciting neuroprotection [37]. Interestingly, these two receptors have been shown to have similarly specific roles in oligodendrocytes, with TNFR1 being implicated in demyelination and TNFR2 in remyelination. In relation to this role, it has been of great interest from a therapeutic perspective to clarify the regulation mechanism that induces TNF-a or abrogates its induction/production. Moreover, understanding the involvement of NF-jB in TNF-a production might open the route for the development of new classes of drugs modulating NF-jB activation. As such, NF-jB appears to be a suitable target for modulating the inflammatory process in the peripheral nervous system within a specified time. Acknowledgments This work was supported by National Basic Research Program of China (973 Program, No. 2011CB910604, and No. 2012BC822104); the National Natural Science Foundation of China (Grant numbers: 31070723, 81070275, 81172879, and 31100112); a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD); college and university Natural Scientific Research Programme of Jiangsu Province (No. 11KJA310002). A project funded by the Scientific Research Programme of Nantong (BK2011019); the Natural Science Foundation of NanTong University (08Z044).

References 1. Hughes RA, Allen D, Makowska A, Gregson NA (2006) Pathogenesis of chronic inflammatory demyelinating polyradiculoneuropathy. J Peripher Nerv Syst 11(1):30–46 2. Orlikowski D, Chazaud B, Plonquet A, Poron F, Sharshar T, Maison P et al (2003) Monocyte chemoattractant protein 1, chemokine receptor CCR2 productions in Guillain-Barre syndrome, experimental autoimmune neuritis. J Neuroimmunol 134(1–2):118–127 3. Shamash S, Reichert F, Rotshenker S (2002) The cytokine network of Wallerian degeneration: tumor necrosis factoralpha, interleukin-1alpha, interleukin-1beta. J Neurosci 22(8): 3052–3060 4. Mercurio F, Zhu H, Murray BW, Shevchenko A, Bennett BL, Li J, Young DB, Barbosa M, Mann M, Manning A, Rao A (1997) IKK-1, IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science 278(5339):860–866 5. DiDonato JA, Hayakawa M, Rothwarf DM, Zandi E, Karin MA (1997) cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388(6642):548–554 6. Arenzana-Seisdedos F, Thompson J, Rodriguez MS, Bachelerie F, Thomas D (1995) Hay RT.Inducible nuclear expression of newly synthesized I kappaB alpha negatively regulates DNAbinding, transcriptional activities of NF-kappaB. Mol Cell Biol 15(5):2689–2696 7. Huxford T, Huang DB, Malek S, Ghosh G (1998) The crystal structure of the IkappaBalpha/NF-kappaB complex reveals mechanisms of NF-kappaB inactivation. Cell 95(6):759–770 8. Nagar M, Jacob-Hirsch J, Vernitsky H, Berkun Y, Ben-Horin S, Amariglio N et al (2010) TNF activates a NF-kappaB-regulated cellular program in human CD45RA-regulatory T cells that modulates their suppressive function. J Immunol 184(7):3570–3581 9. Wan F, Lenardo MJ (2010) The nuclear signaling of NF-kappaB: current knowledge, new insights, future perspectives. Cell Res 20(1):24–33

123

Neurochem Res (2012) 37:722–731 10. Tyagi A, Singh RP, Ramasamy K, Raina K, Redente EF, DwyerNield LD et al (2009) Growth inhibition and regression of lung tumors by silibinin: modulation of angiogenesis by macrophageassociated cytokines and nuclear factor-kappaB and signal transducers and activators of transcription 3. Cancer Prev Res (Phila Pa) 2(1):74–83 11. Tang X, Metzger D, Leeman S, Amar S (2006) LPS-induced TNF-alpha factor (LITAF)-deficient mice express reduced LPSinduced cytokine: Evidence for LITAF-dependent LPS signaling pathways. Proc Natl Acad Sci USA 103(37):13777–13782 12. Brockes JP, Fields KL, Raff MC (1979) Studies on cultured rat Schwann cells. I. Establishment of purified populations from cultures of peripheral nerve. Brain Res 165(1):105–118 13. Hai M, Muja N, DeVries GH, Quarles RH, Patel PI (2002) Comparative analysis of Schwann cell lines as model systems for myelin gene transcription studies. J Neurosci Res 69(4):497–508 14. Taddeo B, Luo TR, Zhang W, Roizman B (2003) Activation of NF-kappaB in cells productively infected with HSV-1 depends on activated protein kinase R, plays no apparent role in blocking apoptosis. Proc Natl Acad Sci USA 100(21):12408–12413 15. Karin M, Ben-Neriah Y (2000) Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu Rev Immunol 18:621–663 16. Sasaki CY, Barberi TJ, Ghosh P, Longo DL (2005) Phosphorylation of RelA/p65 on serine 536 defines an I{kappa}B{alpha}-independent NF-{kappa}B pathway. J Biol Chem 280(41):34538–34547 17. Cheng C, Qin Y, Shao X, Wang H, Gao Y, Cheng M et al (2007) Induction of TNF-alpha by LPS in Schwann cell is regulated by MAPK activation signals. Cell Mol Neurobiol 27(7):909–921 18. Barma P, Bhattacharya S, Bhattacharya A, Kundu R, Dasgupta S, Biswas A et al (2009) Lipid induced overexpression of NF-kappaB in skeletal muscle cells is linked to insulin resistance. Biochim Biophys Acta 1792(3):190–200 19. Henriques R, Lelek M, Fornasiero EF, Valtorta F, Zimmer C, Mhlanga MM (2010) QuickPALM: 3D real-time photoactivation nanoscopy image processing in ImageJ. Nat Methods 7(5):339–340 20. Collart MA, Baeuerle P, Vassalli P (1990) Regulation of tumor necrosis factor alpha transcription in macrophages: involvement of four kappa B-like motifs, of constitutive, inducible forms of NF-kappa B. Mol Cell Biol 10(4):1498–1506 21. Herbein G, Gras G, Khan KA, Abbas W (2010) Macrophage signaling in HIV-1 infection. Retrovirology 7:34 22. Sprague AH, Khalil RA (2009) Inflammatory cytokines in vascular dysfunction, vascular disease. Biochem Pharmacol 78(6): 539–552 23. Rios JL, Recio MC, Escandell JM, Andujar I (2009) Inhibition of transcription factors by plant-derived compounds, their implications in inflammation, cancer. Curr Pharm Des 15(11):1212–1237 24. Zhao XL, Li GZ, Sun B, Zhang ZL, Yin YH, Tian YS et al (2010) MMP-mediated cleavage of beta-dystroglycan in myelin sheath is involved in autoimmune neuritis. Biochem Biophys Res Commun 392(4):551–556 25. Kieseier BC, Krivacic K, Jung S, Pischel H, Toyka KV, Ransohoff RM et al (2000) Sequential expression of chemokines in experimental autoimmune neuritis. J Neuroimmunol 110(1–2): 121–129 26. Kwon D, Fuller AC, Palma JP, Choi IH, Kim BS (2004) Induction of chemokines in human astrocytes by picornavirus infection requires activation of both AP-1, NF-kappa B. Glia 45(3):287– 296 27. Ludwig S, Planz O, Pleschka S, Wolff T (2003) Influenza-virusinduced signaling cascades: targets for antiviral therapy? Trends Mol Med 9(2):46–52 28. de Oliveira DE, Ballon G, Cesarman E (2010) NF-kappaB signaling modulation by EBV and KSHV. Trends Microbiol 18(6): 248–257

Neurochem Res (2012) 37:722–731 29. DeMeritt IB, Milford LE, Yurochko AD (2004) Activation of the NF-kappaB pathway in human cytomegalovirus-infected cells is necessary for efficient transactivation of the major immediateearly promoter. J Virol 78(9):4498–4507 30. Mogensen TH, Melchjorsen J, Hollsberg P, Paludan SR (2003) Activation B of NF-kappa in virus-infected macrophages is dependent on mitochondrial oxidative stress, intracellular calcium: downstream involvement of the kinases TGF-betaactivated kinase 1, mitogen-activated kinase/extracellular signalregulated kinase kinase 1, I kappa B kinase. J Immunol 170(12): 6224–6633 31. Aggarwal BB (2003) Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev Immunol 3(9):745–756 32. George A, Buehl A, Sommer C (2005) Tumor necrosis factor receptor 1 and 2 proteins are differentially regulated during Wallerian degeneration of mouse sciatic nerve. Exp Neurol 192(1):163–166 33. Qin Y, Cheng C, Wang H, Shao X, Gao Y, Shen A (2008) TNF-a as an autocrine mediator and its role in the activation of Schwann cells. Neurochem Res 33:1077–1084

731 34. Chow EK, O’Connell RM, Schilling S, Wang XF, Fu XY, Cheng G (2005) TLR agonists regulate PDGF-B production and cell proliferation through TGF-beta/type I IFN crosstalk. EMBO J 24(23):4071–4081 35. Schlenker B, Matiasek K, Saur D, Gratzke C, Bauer RM, Herouy Y, et al. (2010) Effects of cavernous nerve reconstruction on expression of nitric oxide synthase isoforms in rats. BJU Int 106(11): 1726–1731 36. Thornhill PB, Cohn JB, Stanford WL, Desbarats J (2008) The adaptor protein Grb2 regulates cell surface Fas ligand in Schwann cells. Biochem Biophys Res Commun 376(2):341–346 37. Takei Y, Laskey R (2008) Tumor necrosis factor alpha regulates responses to nerve growth factor, promoting neural cell survival but suppressing differentiation of neuroblastoma cells. Mol Biol Cell 19(3):855–864

123