Conserv Genet (2009) 10:1659–1665 DOI 10.1007/s10592-008-9744-5
RESEARCH ARTICLE
Unprecedented long-term genetic monomorphism in an endangered relict butterfly species Jan Christian Habel Æ Frank Emmanuel Zachos Æ Aline Finger Æ Marc Meyer Æ Dirk Louy Æ Thorsten Assmann Æ Thomas Schmitt
Received: 6 May 2008 / Accepted: 29 October 2008 / Published online: 15 November 2008 Springer Science+Business Media B.V. 2008
Abstract Multi-locus monomorphism in microsatellites is practically non-existent, with one notable exception, the island fox (Urocyon littoralis dickeyi) population on San Nicolas island off the coast of southern California, having been called ‘‘the most monomorphic sexually reproducing animal population yet reported’’. Here, we present the unprecedented long-term monomorphism in relict populations of the highly endangered Parnassius apollo butterfly, which is protected by CITES and classified as ‘‘threatened’’ by the IUCN. The species is disjunctly distributed throughout the western Palaearctic and has occurred in several small remnant populations outside its main distribution area. We screened 78 individuals from 1 such relict area (Mosel valley, Germany) at 16 allozyme and 6 microsatellite loci with the latter known to be polymorphic in this species elsewhere. From the same area, we also genotyped 55 museum specimens sampled from 1895 to 1989 to compare historical and present levels of genetic J. C. Habel (&) A. Finger M. Meyer Muse´e National d’histoire Naturelle, Section Zoologie des Inverte´bre´s, 25, rue Mu¨nster, 2160 Luxembourg, Germany e-mail:
[email protected] J. C. Habel A. Finger D. Louy T. Schmitt Biogeography, University Trier, 54296 Trier, Germany F. E. Zachos Zoological Institute, Christian-Albrechts-University Kiel, 24118 Kiel, Germany A. Finger ETH Zu¨rich, ITES-Ecosystem Management, 8092 Zu¨rich, Switzerland T. Assmann Institute of Ecology and Environmental Chemistry, Leuphana University Lueneburg, 21335 Lu¨neburg, Germany
diversity. However, none of all these temporal populations yielded any polymorphism. Thus, present and historical butterflies were completely monomorphic for the same fixed allele. This is the second study to report multi-locus monomorphism for microsatellites in an animal population and the first one to prove this monomorphism not to be the consequence of recent factors. Possible explanations for our results are a very low long-term effective population size and/or a strong historic bottleneck or founder event. Since the studied population has just recovered from a recent population breakdown (second half of twentieth century) and no signs of inbreeding depression have been detected, natural selection might have purged the population of weakly deleterious alleles, thus rendering it less susceptible to the usual negative corollaries of high levels of homozygosity and low effective population size. Keywords Parnassius apollo vinningensis Microsatellites Allozymes Purging Collection samples Climate change Population genetics Genetic diversity
Introduction Xerothermophilic elements (re)colonized Central Europe from the Mediterranean region after the last glacial period (Hewitt 1996). With the end of the climatic optimum during the Atlanticum, some 6,000 years ago, a large number of Mediterranean species with highly specific ecological demands only survived at isolated habitat patches in some parts of Central Europe with especially hot and dry conditions (De Lattin 1967). Living in isolation enhances processes of population dynamics [like population fluctuations (Lesica and Allendorf 1995)] and population stochasticity (Melbourne and Hastings 2008) resulting in
123
1660
the loss of genetic diversity in local sites through drift, which cannot be compensated by immigration from neighbouring populations (Hanski 1999). Such genetically impoverished populations often suffer from decreased fitness due to inbreeeding e.g., causing the accumulation of weakly deleterious genes (Allendorf and Luikart 2006). Many theoretical and experimental studies have analysed these effects (cf. Frankham et al. 2002; Hansson and Westerberg 2002; Reed and Frankham 2003). To address the problem of genetic erosion in isolated and small populations, we selected the strongly isolated populations of Parnassius apollo in the Mosel valley. These populations are several hundreds of kilometres distant from the next extant populations (Nakonieczny et al. 2007). Futhermore, the demography of the Apollo butterflies in the Mosel region has been well recorded and a strong population bottleneck is known for the second half of the twentieth century due to intensification of viticulture and later recovery after intensive restoration efforts (Kinkler et al. 1987; Lo¨ser and Rehnelt 1983). To test the influence of these known population dynamics, we analysed the population genetic structure of extant postbottleneck, bottleneck and pre-bottleneck populations. Herefore, we sampled individuals in their habitats and analysed museum specimens dating back to 1895. For this survey, we selected two different analytical tools: microsatellites and allozymes. Due to their high mutation rate, microsatellite loci are powerful markers for the detection of genetic diversity and differentiation of isolated and fragmented populations because they more often show polymorphisms than other molecular markers (Selkoe and Toonen 2006) and the six loci included in this study show considerable genetic variability in two other populations of P. apollo (Petenian et al. 2005). Allozymes also represent a suitable marker system especially in butterfly species (cf. Schmitt and Hewitt 2004a, b) to unravel genetic diversity within and differentiation among populations (Ridgway 2005), and Descimon (1995) found polymorphisms in populations of P. apollo from France; however, this system only could be used for the currently sampled individuals as enzymes degrade rapidly so that museum specimens are not a suitable source. Based on these data we analysed the genetic consequences of this regional bottleneck and the resulting conservation implications for the P. apollo populations of the Mosel region.
Materials and methods Study species The xeromontane butterfly Parnassius apollo (Linnaeus 1758) is patchily distributed from Spain to southern
123
Conserv Genet (2009) 10:1659–1665
Fennoscandia and the Balkan Peninsula including the northwestern Peleponnesos (Kudrna 2002). It has univoltine populations flying from June to August (Tolman and Lewington 1997). The species is divided into many subspecies distributed over Europe, and some of these subspecies are restricted to isolated regions of Central Europe (Tolman and Lewington 1997). At present, P. apollo is classified as one of the most endangered butterflies in Europe (IUCN 1996), listed in the European Red Data Book (Van Swaay and Warren 1999), the Appendix II of the Habitat Directive (EEC 92/43/EWG) of the European Union and the CITES-Convention. The subspecies Parnassius apollo vinningensis (Stichel 1899) was described as an endemic taxon of the Lower Mosel valley due to a characteristic wing coloration constantly deviating from the nominate form. The habitats of this butterfly are rocky slopes with the larval food plant Sedum album (Kinkler et al. 1987). Habitat destruction due to plot alignements, destruction of old stone walls with Sedum and widespread spraying of pesticides and fallow land led to a severe collapse during the 1970s, and this formerly widespread and common butterfly of the Mosel valley between Trier and Koblenz declined strongly to some few remnants during this period (Lo¨ser and Rehnelt 1983; Kinkler et al. 1987). However, strict conservation programmes of habitat reconstruction in combination with reduced application of pesticides resulted in a recovery of the surviving populations. Sampling and genetic analyses Seventy-eight individual samples of P. apollo were taken from four sites along the Mosel valley, including the westernmost and the easternmost occurrences (Fig. 1). Butterflies were sampled from the beginning of June to the end of July 2004. The individuals were netted in the field, and one leg was dissected per individual and stored in liquid nitrogen until analysis. To avoid resampling of individuals, all captured butterflies were marked before release. We used allozyme electrophoresis and microsatellite markers as analytical tools. The sampled animal tissue of one leg per individual was sufficient for both molecular approaches as a non-lethal method. We also sampled 55 museum specimens from 1895 to 1989 (1895, 1897, 1898, 1904, 1909, 1932, 1946, 1953, 1968, 1979, 1989, five samples per year), analysing these samples exclusively for the six microsatellite loci. For the allozyme analysis, the femur of each sample was homogenised in Pgm-buffer (Harris and Hopkinson 1978) by ultrasound and centrifuged at 17,000g for 5 min. The remaining tibia and tarsus were stored for DNA extraction. We ran electrophoreses on cellulose acetate plates (Hebert and Beaton 1993) and analysed 16 enzyme systems (running conditions see Table 1).
Conserv Genet (2009) 10:1659–1665
1661
Fig. 1 Geographic location of the four sample sites Calmont, Valwig, Dortebachtal and Winningen of Parnassius apollo vinningensis in the Mosel valley. The numbers in parenthesis represent the numbers of sampled individuals
Koblenz
Poland
Winningen (18) Winningen (18)
Lahn
Netherlands
Belgium
Germany Germany
Scech-Republic Czech Republic republic
France
ine Rh
Austria Swizerland Switzerland
Valwig (22) Valwig (22)
l
se
Mo
Cochem
Dortebachtal (20) Dortebachtal (20) Calmont (18) Calmont (18) 5 km
For microsatellite markers, DNA was extracted from the remaining tibia using the Qiagen DNeasyTM Tissue Extraction Kit (Hilden, Germany), following the manufacturers’ protocol. PCR reactions were carried out in a thermal cycler (Corbett Research CG1-96). Microsatellite loci were amplified from 50 to 100 ng diluted DNA in a Thermozym Mastermix (Molzym, Bremen, Germany). The samples were screened and genotyped for six microsatellite loci (PA35, 45, 56, 79, 82, 85). The forward primer of each pair was 50 endlabelled with the fluorescent phosphoramidite FAM. Primer sequences and PCR conditions were taken from Megle´cz Table 1 Conditions of electrophoresis for different enzymes analysed for Parnassius apollo vinningensis
TC Tris–citrate pH 8.2, TG Tris–glycine pH 8.5, TM Tris– maleic acid pH 7.0 (adjusted from TM pH 7.8). All buffers were run at 200 V
Enzyme
EC-No.
6PGDH GPDH
et al. (2004) and optimised (for details see Table 2). PCR products were visualised by electrophoresis on a 2.4% agarose gel stained with ethidium bromide as a control before scoring the microsatellites using an automated sequencer with the Megabace software (GE Healthware, USA).
Results All 16 allozyme and all six microsatellite loci analysed were monomorphic, showing one fixed allele each. This
Buffer
Homogenate applications
Running time (min)
1.1.1.44
TC
2
50
1.1.1.8
TM
3
45
MDH1, MDH2 MPI
1.1.1.37 5.3.1.8
TM TC
2 3
45 30
AAT
2.6.1.1
TM
3
40
G6PDH
1.1.1.49
TM
3
45
FUM
4.2.1.2
TM
3
45
ME1, ME2
1.1.1.40
TC
3
30
PK
2.7.1.40
TM
3
40
APK
2.7.3.3
TM
3
40
PGM
5.4.2.2
TG
3
35
GPI
5.3.1.9
TG
1
35
IDH1, IDH2
1.1.1.42
TC
2
50
123
1662
Conserv Genet (2009) 10:1659–1665
Table 2 Characteristics of six microsatellite loci in Parnassius apollo vinningensis developed for Parnassius apollo by Megle´cz et al. (2004), modified Locus
GenBank accession no.
Primer sequence (50 –30 )
Repeat motif
Size of sequenced allele (bp)
Ta (C)
PA35
AY491887
F: CCCACGTCAATATCACTCTTTG
(TACA)5 TACG(TACA)(TG)2 (CA)4
240
54
PA45
AY491895
F: GCCTACATGTGAGGCGTCAT
(TACA)5…(TACA)5
235
51
(TACA)6
158
51
(TGTA)2 ? (TGTA)5
107
54
(TGCG)3 GC(TGTA)7
164
54
(CA)37 TA(CA)2
212
54
R: CTGGGACGGATTGCTAGTTG R: GCATGTAGATGTAAGTGTGCGTG PA56
AY491906
F: ACTAGTCGGTCGACATAGTACC R: CCAAATGGAAGTCTGTAGTCTC
PA79
AY491924
F: TGGTCCTGTAGCTCTGTATCAC R: CTATTAAGCGGCTCGTACATC
PA82
AY491926
F: TGTAGATGACGCCCCATAT R: GTCATCTACATACGGTACGCAT
PA85
AY491928
F: AATGCAGGCACATAACTAAGAC R: TCTATGTGGCGTTTTGTGG
F forward primer; R reverse primer; Ta annealing temperature; individuals were analysed for each locus
was also true for the six microsatellite loci studied in the historical samples demonstrating that the fixation of one allele at least for the microsatellites occurred prior to 1895.
Discussion Suitability of genetic marker systems In accordance with our a priori expectations based on the relict status of the Mosel valley populations of P. apollo, no high genetic diversity was detectable. However, it was unexpected to find a complete lack of genetic diversity at the studied microsatellite loci in all individuals analysed from different localities all over the Mosel distribution range spanning a time frame of more than 100 years. The four local sampling sites therefore do not show any differentiation among each other, but must be considered as belonging to one homogeneous gene pool. Therefore, we have to question the suitability of the two genetic marker systems applied in our study. Microsatellites are a marker system often used for similar studies (Selkoe and Toonen 2006), however, the application in butterflies is often rather difficult (Megle´cz and Solignac 1998; Megle´cz et al. 2004; Habel et al. 2008; Finger et al. 2008). This most probably is due to the occurrence of microsatellite DNA families with similar or almost identical flanking regions implying an early stage of evolution in Lepidopterans (Zhang 2004). Therefore, the suitability of microsatellites in population genetic studies of butterflies is limited due to low cloning efficiency and
123
lacking specificity due to the similarities in the flanking regions important for the primer annealing (Zhang 2004). However, Petenian et al. (2005) demonstrated the suitability of the six microsatellite loci also used in our study. They analysed a total of 40 P. apollo individuals descending from two populations and got clearly interpretable results with 3–25 alleles per locus and high percentages of heterozygosity (Ho: 7.5–79.6%; He: 25.1– 95.4%). Therefore, the observed genetic uniformity of the Mosel population of P. apollo in these six microsatellite loci is real and not an artefact of unsuitability of the system. Allozymes are known as a powerful tool in the analysis of population genetic and phylogeographic pattern in butterflies and moths. The 16 loci included in the analysis of the Mosel valley Apollo butterflies showed high levels of genetic diversity in several common butterfly species of different biogeographical origins (e.g., Schmitt et al. 2003, 2005a, b, 2006a, b, 2007; Habel et al. 2005; Louy et al. 2007; Schmitt and Mu¨ller 2007; Besold et al. 2008a, b; Schmitt and Haubrich 2008), and even relict taxa showed moderate levels of genetic diversity of their populations (e.g., Schmitt and Seitz 2004; Schmitt et al. 2005c; Haubrich and Schmitt 2007). Furthermore, Descimon (1995) demonstrated genetic diversity of P. apollo populations sampled in France (Pyrenees, Alps, Massif Central), but pointed out that the degree of diversity is less than in the congeneric species P. mnemosyne and P. phoebus. Therefore, the suitability of the 16 allozyme loci studied as a second marker system is approved for the detection of genetic diversity of populations.
Conserv Genet (2009) 10:1659–1665
Parnassius apollo from the Mosel Valley—the most monomorphic butterfly Genetic depletion has been found in several butterfly populations of species with highly specialised biotic and abiotic demands (Debinski 1994; Gadeberg and Boomsma 1997; Bereczki et al. 2005; Figurny-Puchalska et al. 2000; Schmitt and Seitz 2004) as well as in other animals and plants (e.g., Watts et al. 2006; Kawamura et al. 2007; Zachos et al. 2007), but all of them show at least some genetic diversity within and among populations. For example, the ground beetle Carabus auronitens was found to be more or less genetically uniform at the level of allozyme loci (17 loci monomorph, 1 locus with two alleles) in Westphalia, while populations in glacial refugial areas (southern France) exhibit a large amount of genetic variability (Assmann et al. 1994; Reimann et al. 2002). The multi-locus monomorphism detected for six microsatellites and 16 allozyme loci of P. apollo vinningensis is indeed exceptional. Although the presence of additional rare alleles still cannot be completely excluded, our reasonably large sample sizes add credibility to our results making P. apollo vinningensis the most monomorphic butterfly taxon known to science. To our knowledge, the only other reported case of multi-locus monomorphism at microsatellite loci is the island fox (Urocyon littoralis) population on San Nicolas Island off the southern coast of California. Consequently, these foxes have been called ‘‘the most monomorphic sexually reproducing animal population yet reported’’ (Aguilar et al. 2004). When and how the genetic depletion of P. apollo vinningensis occurred cannot be deduced with our data set. However, the high stability of deoxyribonucleic acid and effective DNA extraction protocols allow the comparison of extant populations with older collection specimens going back to the eighteenth century (cf. Mandrioli et al. 2006; Watts et al. 2007). By using such collections from the late nineteenth and early twentieth century, we were able to show that the genetic depletion in P. apollo vinningensis is not a result of recent anthropogenic impacts during the twentieth century, but must have occurred earlier, as the historical samples were monomorphic for the same alleles as the extant specimens. Other butterfly species like Thymelicus acteon (Louy et al. 2007), Coenonympha hero (Cassel and Tammaru 2003), Speyeria idalia (Williams et al. 2003) or Lycaena helle (Finger et al. 2008) are also confined to isolated local populations, but still show unexpectedly high genetic diversity. However, these species survived in comparatively large metapopulation networks and only recently suffered isolation in the course of the changes in land use so that their genetic diversity is probably best explained as a remnant of a ‘better past’. Therefore, the genetic
1663
uniformity of P. apollo vinningensis is probably due to repeated bottlenecks and/or founder events during the postglacial period enduring since some thousands of years possibly going back until the first colonisation of the area after the last glacial period or even glacial persistence in situ (cf. Steward and Lister 2001). The geographically restricted distribution of this butterfly is likely to have enforced environmental and demographic stochasticity (Frankham et al. 2002) as well as concomitant population fluctuations, bottlenecks combined with genetic drift and finally the complete loss of genetic diversity at the 22 loci analysed. How important is genetic diversity for the fitness of populations? Parnassius apollo vinningensis, which has probably been isolated from conspecific populations in the Vosges, the Black Forest or the Schwa¨bische Alb for a long period of time has recovered well from its recent anthropogenic bottleneck (Kinkler et al. 1987). In contrast to general theory in conservation genetics underlining the importance of genetic diversity for the viability of populations (Frankham et al. 2002; Reed and Frankham 2003; Schmitt and Hewitt 2004a), this recovery occurred in a population without any diversity at 22 loci of two normally polymorphic marker systems. Thus, high levels of genetic diversity are seemingly not necessary for the viability of this butterfly taxon. Given that P. apollo vinningensis was already genetically depleted more than a hundred years ago, the subspecies has probably undergone more than one historic bottleneck event. If so, the successful recent recovery of the population might be a consequence of purging effects: recessive deleterious alleles might have become exposed to natural selection as a consequence of an increase in homozygosity due to inbreeding. Thus, the populations surviving bottleneck events might have had a reduced genetic load and therefore might be less susceptible to inbreeding depression (caused by homozygous deleterious alleles). While recent analyses have shown that the effects of purging generally seem to be limited and that immunity to second bottlenecks cannot be expected (Frankham et al. 2001; The´venon and Couvet 2002), the case of P. apollo vinningensis might be a rare exception to the rule. Future analyses of possible inbreeding depression in this taxon as compared with its genetically more diverse conspecifics from other locations might turn out to be a fruitful contribution to studying the importance of purging. Acknowledgments We acknowledge a grant from the Ministe`re de la Culture, de l’Enseignement Superieur et de la Recherche, Luxembourg (grant number BFR05/118 Habel), the Muse´e national
123
1664 d’histoire naturelle Luxembourg and the DFG (grant number SCHM 1659/3-1 and 3–2) making this study possible. We thank the local authorities in Koblenz for giving us a sampling permit, H. Kinkler (Leverkusen, D), A. Schmidt (Koblenz, D) and M. Weitzel (Trier, D) for information about sample localities and the population dynamics and Marco Zimmermann (Bonn, D) for field assistance. We are grateful for samples from museum collections of the ‘‘Zentrum fu¨r Biodokumentation des Saarlandes’’ (Reden, Germany) and the Alexander-Koenig–Forschungsmuseum (Bonn, Germany).
References Aguilar A, Roemer G, Debenham S, Binns M, Garcelon D, Wayne RK (2004) High MHC diversity maintained by balancing selection in an otherwise genetically monomorphic mammal. Proc Natl Acad Sci USA 3490–3494. doi:10.1073/pnas.0306 582101 Allendorf FW, Luikart G (2006) Conservation and the genetics of populations. Blackwell, London Assmann T, Nolte O, Reuter H (1994) Postglacial colonization of middle Europe by Carabus auronitens as revealed by population genetics (Coleoptera, Carabidae). In: Desender K, Dufreˆne M, Loreau M, Luff M, Maelfait JP (eds) Carabid Beetles: Ecology and Evolution. Kluwer Academic Publishers, Dordrecht Bereczki J, Pecsenye K, Peregovits L, Varga Z (2005) Pattern of genetic differentiation in the Maculinea alcon species group (Lepidoptera, Lycaenidae) in Central Europe. J Zool Syst Evol Res 43:157–165. doi:10.1111/j.1439-0469.2005.00305.x Besold J, Schmitt T, Tammaru T, Cassel-Lundhagen A (2008) Strong genetic impoverishment from the centre of distribution in southern Europe to peripheral baltic and isolated Scandinavian populations of the pearly heath butterfly. J Biogeogr 35:2090–2101 Besold J, Huck S, Schmitt T (2008b) Allozyme polymorphisms in the small heath Coenonympha pamphilus: recent ecological selection or old biogeographical signal? Ann Zool Fenn 45:217–228 Cassel A, Tammaru T (2003) Allozyme variability in central, peripheral and isolated populations of the scarce heath (Coenonympha hero: Lepidoptera, Nymphalidae); implications for conservation. Conserv Genet 4:83–93. doi:10.1023/A:10218 84832122 De Lattin G (1967) Grundriß der Zoogeographie. Verlag Gustav Fischer, Jena Debinski DM (1994) Genetic diversity assessment in a metapopulation of the butterfly Euphydryas gillettii. Heredity 70:25–30 Descimon H (1995) La conservation des Parnassius en France: aspects zooge´ographiques, e´cologiques, de´mographiques et ge´ne´tiques. Editions OPIE 1:1–54 Figurny-Puchalska E, Gadeberg RME, Boomsma JJ (2000) Comparison of genetic population structure of the large blue butterfly Maculinea nausithous and M. teleius. Biodivers Conserv 9:419– 432. doi:10.1023/A:1008970232079 Finger A, Zachos FE, Schmitt T, Meyer M, Assmann T, Habel JC (2008) The genetic status of the Violet Copper Lycaena helle—a relict of the cold past in times of global warming. Ecography (in press) Frankham R, Gilligan DM, Morris D, Briscoe DA (2001) Inbreeding and extinction: effects of purging. Conserv Genet 2:279–285. doi:10.1023/A:1012299230482 Frankham R, Ballou JD, Briscoe DA (2002) Introduction to conservation genetics. Cambridge University Press, Cambridge Gadeberg RME, Boomsma JJ (1997) Genetic population structure of the large blue butterfly Maculinea alcon in Denmark. J Insect Conserv 1:99–111. doi:10.1023/A:1018439211244
123
Conserv Genet (2009) 10:1659–1665 Habel JC, Schmitt T, Mu¨ller P (2005) The fourth paradigm pattern of postglacial range expansion of European terrestrial species: the phylogeography of the Marbled White butterfly (Satyrinae, Lepidoptera). J Biogeogr 32:1489–1497 Habel JC, Meyer M, Schmitt T, Assmann T (2008) Polymorphic microsatellite loci in the endangered butterfly Lycaena helle (Lepidoptera: Lycaenidae). Eur J Entomol 105:361–362 Hanski I (1999) Metapopulation ecology. Oxford University Press, Oxford Hansson B, Westerberg L (2002) On the correlation between heterozygosity and fitness in natural populations. Mol Ecol 11:2467–2474. doi:10.1046/j.1365-294X.2002.01644.x Harris H, Hopkinson DA (1978) Handbook of enzyme electrophoresis in human genetics. North-Holland, Amsterdam Haubrich K, Schmitt T (2007) Cryptic differentiation in alpineendemic, high altitude butterflies reveals down-slope glacial refugia. Mol Ecol 16:3643–3658. doi:10.1111/j.1365-294X. 2007.03424.x Hebert PDN, Beaton MJ (1993) Methodologies for allozyme analysis using cellulose acetat electrophoresis. Helena Laboratories, Beaumont Hewitt GM (1996) Some genetic consequences of ice ages, and their role in divergence and speciation. Biol J Linn Soc 58:247–276 IUCN (1996) The 1996 IUCN red list of threatened animals. IUCN Publications Service Unit, Cambridge Kawamura K, Kubota M, Furukawa M, Harada Y (2007) The genetic structure of endangered indigenous populations of the amago salmon, Oncorhynchus masou ishikawae, in Japan. Conserv Genet 8:1163–1176. doi:10.1007/s10592-006-9271-1 Kinkler H, Lo¨ser S, Rehnelt K (1987) 10 Jahre Erforschung des Moselapollofalters (Parnassius apollo vinningensis STICHEL 1899, Lepidoptera, Papilionidae) im modernen Weinbaugebiet der Mosel—ein Beitrag zu seiner Rettung. Mitt Arbeitsgem rhwestf Lepid V/2:53–100 Kudrna O (2002) The distribution atlas of European butterflies. Oedippus 20:1–342 Lesica P, Allendorf FW (1995) When peripheral populations are valuable for conservation. Conserv Biol 9:753–760. doi:10.1046/ j.1523-1739.1995.09040753.x Lo¨ser S, Rehnelt K (1983) Das rezente Verbreitungsareal von Parnassius apollo vinningensis Stichel, 1899 (Lepidoptera, Papilionidae) im modernen Weinbaugebiet der Mosel. Verh SIEEC X, Budapest Louy D, Habel JC, Schmitt T, Assmann T, Meyer M, Mu¨ller P (2007) Strongly diverging population genetic patterns of three skipper species: the role of habitat fragmentation and dispersal ability. Conserv Genet 8:671–681 Mandrioli M, Borsatti F, Mola L (2006) Factors affecting DNA preservation from museum-collected lepidopteran specimens. Entomol Exp Appl 120:239–244. doi:10.1111/j.1570-7458.2006. 00451.x Megle´cz E, Solignac M (1998) Microsatellite loci for Parnassius mnemosyne (Lepidoptera). Hereditas 128:179–180. doi:10.1111/ j.1601-5223.1998.00179.x Megle´cz E, Petenian F, Danchin E, Coer D’Acier A, Rasplus J-Y, Faure E (2004) High similarity between flanking regions of different microstatellites detected within each of two species of Lepidoptera: Parnassius apollo and Euphydrias aurinia. Mol Ecol 13:1693–1700. doi:10.1111/j.1365-294X.2004.02163.x Melbourne BA, Hastings A (2008) Extinction risk depends strongly on factors contributing to stochasticity. Nature 454:100–103. doi:10.1038/nature06922 Nakonieczny M, Kedziorski A, Michalczyk K (2007) Apollo Butterfly (Parnassius apollo L.) in Europe—its history, decline and perspectives of conservation. Funct Ecosyst Comm 1:56–79
Conserv Genet (2009) 10:1659–1665 Petenian F, Megle´cz E, Genson G, Rasplus J-Y, Faure E (2005) Isolation and characterization of polymorphic microsatellites in Parnassius apollo and Euphydryas aurinia (Lepidoptera). Mol Ecol Notes 5:243–245. doi:10.1111/j.1471-8286.2005.00891.x Reed DH, Frankham R (2003) Correlation between fitness and genetic diversity. Conserv Biol 17:230–237. doi:10.1046/j.1523-1739. 2003.01236.x Reimann T, Assmann T, Nolte O, Reuter H, Huber C, Weber F (2002) The paleo-ecology of Carabus auronitens Fabricius: characterization and localization of glacial refugia in southern France and reconstruction of postglacial expansion routes by means of allozyme polymorphisms. Abh Naturwissenschaftl Ver Hamburg NF 35:1–151 Ridgway T (2005) Allozyme electrophoresis still represents a powerful technique in the management of coral reefs. Biodivers Conserv 14:135–149. doi:10.1007/s10531-005-4054-4 Schmitt T, Haubrich K (2008) The genetic strucutre of the mountain forest butterfly Erebia euryale unravels the late Pleistocene and postglacial history of the mountain coniferous forest biome in Europe. Mol Ecol 17:2194–2207. doi:10.1111/j.1365-294X. 2007.03687.x Schmitt T, Hewitt GM (2004a) The genetic pattern of population threat and loss: a case study of butterflies. Mol Ecol 13:21–31. doi:10.1046/j.1365-294X.2004.02020.x Schmitt T, Hewitt GM (2004b) Molecular Biogeography of the arcticalpine disjunct burnet moth species Zygaena exulans (Zygaenidae, Lepidoptera) in the Pyrenees and Alps. J Biogeogr 31:885– 893. doi:10.1111/j.1365-2699.2004.01079.x Schmitt T, Mu¨ller P (2007) Limited hybridization along a large contact zone between two genetic lineages of the butterfly Erebia medusa (Satyrinae, Lepidoptera) in Central Europe. J Zool Syst Evol Res 45:39–46. doi:10.1111/j.1439-0469.2006. 00404.x Schmitt T, Seitz A (2004) Low diversity but high differentiation: the population genetics of Aglaope infausta (Zygaenidae: Lepidoptera). J Biogeogr 31:137–144. doi:10.1111/j.1365-2699.2004. 01079.x Schmitt T, Gießl A, Seitz A (2003) Did Polyommatus icarus (Lepidoptera: Lycaenidae) have distinct glacial refugia in southern Europe? Evidence from population genetics. Biol J Linn Soc 80:529–538. doi:10.1046/j.1095-8312.2003.00261.x Schmitt T, Ro¨ber S, Seitz A (2005a) Is the last glaciation the only relevant event for the present genetic population structure of the Meadow Brown butterfly Maniola jurtina (Lepidoptera: Nymphalidae)? Biol J Linn Soc 85:419–431. doi:10.1111/j.10958312.2005.00504.x Schmitt T, Varga Z, Seitz A (2005b) Are Polyommatus hispana and Polyommatus slovacus bivoltine Polyommatus coridon (Lepidoptera: Lycaenidae)? The discriminatory value of genetics in the taxonomy. Org Divers Evol 5:297–307. doi:10.1016/j.ode. 2005.01.001
1665 Schmitt T, Cizek O, Konvicka M (2005c) Genetics of a butterfly relocation: large, small and introduced populations of the mountain endemic Erebia epiphron silesiana. Biol Conserv 123:11–18. doi:10.1016/j.biocon.2004.09.018 Schmitt T, Hewitt GM, Mu¨ller P (2006a) Disjunct distributions during glacial and interglacial periods in mountain butterflies: Erebia epiphron as an example. J Evol Biol 19:108–113. doi: 10.1111/j.1420-9101.2005.00980.x Schmitt T, Habel JC, Zimmermann M, Mu¨ller P (2006b) Genetic differentiation of the Marbled White butterfly, Melanargia galathea, accounts for glacial distribution patterns and postglacial range expansion in southeastern Europe. Mol Ecol 15:1889– 1901. doi:10.1111/j.1365-294X.2006.02900.x Schmitt T, Ra´kosy L, Abadjiev S, Mu¨ller P (2007) Multiple differentiation centres of a non-Mediterranean butterfly species in south-eastern Europe. J Biogeogr 34:939–950. doi:10.1111/ j.1365-2699.2006.01684.x Selkoe KA, Toonen RJ (2006) Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol Lett 9:615–629. doi:10.1111/j.1461-0248.2006.00889.x Steward JR, Lister AM (2001) Cryptic northern refugia and the origins of the modern biota. Trends Ecol Evol 16:608–613. doi: 10.1016/S0169-5347(01)02338-2 The´venon S, Couvet D (2002) The impact of inbreeding depression on population survival depending on demographic parameters. Anim Conserv 5:53–60 Tolman T, Lewington R (1997) Field guide butterflies of Britain and Europe. Harper Collins, London Van Swaay CAM, Warren M (1999) Red Data Book of European butterflies (Rhopalocera). Nature and environment 99. Council of Europe Publishing, Strasbourg Watts PC, Saccheri J, Kemp SJ, Thompson DJ (2006) Population structure and the impact of regional and local habitat isolation upon levels of genetic diversity of the endangered damselfly Coenagrion mercuriale (Odonata: Zygoptera). Freshw Biol 51:193–205. doi:10.1111/j.1365-2427.2005.01478.x Watts PC, Thompson DJ, Allen KA, Kemp SJ (2007) How useful is DNA extracted from the legs of archieved insects for microsatellite-based population genetic analyses? J Insect Conserv 11:195–198. doi:10.1007/s10841-006-9024-y Williams BL, Brawn JD, Paige KN (2003) Landscape scale genetic effects of habitat fragmentation on a high gene flow species: Speyeria idalia (Nymphalidae). Mol Ecol 12:11–20. doi:10.1046/ j.1365-294X.2003.01700.x Zachos FE, Althoff C, v Steynitz Y, Eckert I, Hartl GB (2007) Genetic analysis of an isolated red deer (Cervus elaphus) population showing signs of inbreeding depression. Eur J Wildl Res 53:61–67. doi:10.1007/s10344-006-0065-z Zhang D-X (2004) Lepidopteran microsatellite DNA: redundant but promising. Trends Ecol Evol 19:507–509. doi:10.1016/j.tree. 2004.07.020
123