J. Endocrinol. Invest. 33: 222-227, 2010 DOI: 10.3275/6442
Y-chromosome markers in Turner syndrome: Screening of 130 patients Á. Sallai1, J. Sólyom1, M. Dobos1, J. Szabó1, Z. Halász1, L. Ságodi2, T. Niederland3, A. Kozári4, R. Bertalan5, P. Ugocsai6, and G. Fekete1 12nd
Department of Pediatrics, Semmelweis University, Budapest; 2Pediatric Health Center, Borsod-A-Z County Hospital, Miskolc; of Pediatrics, Petz Aladár County Hospital, Gyor; 4Department of Pediatrics, University of Pécs, Pécs; 5Csolnoky Ferenc County Hospital, Veszprem; 6Laboratory of Molecular Genetics, Test Tube Baby Foundation, Szeged, Hungary 3Department
revealed 3 patients with Y-chromosome positivity. RT-PCR revealed further 6 patients with Y-chromosome, who were initially considered as Y-negatives by standard kayotyping. The consecutive cytogenetic analysis of a large number (about 100) of metaphases (in 5 patients) and/or FISH (in 6 patients) however, also confirmed the presence of the Y-chromosome in these patients. Prophylactic gonadectomy was carried out in all 9 patients and 1 of them was diagnosed as having bilateral gonadoblastoma without clinical symptoms. Conclusions: We recommend a routine molecular screening for hidden Y-chromosome sequences in Turner patients, who are negative for Y-chromosome by conventional cytogenetic analysis, in order to calculate the future risk of developing gonadoblastoma. (J. Endocrinol. Invest. 33: 222-227, 2010) ©2010, Editrice Kurtis
ABSTRACT. Background: The presence of Y-chromosome material in patients with Turner syndrome (TS) is a risk factor for the development of gonadoblastoma. Cytogenetic analysis detects Y-chromosome mosaicism in about 5% of Turner patients. However, if Y-chromosome sequences are present in only a few cells, they may be missed by routine analysis. The use of molecular techniques to detect the presence of Y-chromosome fragments in such patients is becoming increasingly important. Aim: The objective of our study was to analyze cryptic Y-chromosome derivatives in Hungarian TS patient population by real-time PCR (RT-PCR). Subjects and metohds: Cytogenetic and RT-PCR methods were used to examine peripheral blood DNA of 130 Hungarian patients with TS for the presence of Y-chromosome. With RT-PCR, 4 regions throughout the Y-chromosome were analyzed. Results: Initial cytogenetic karyotyping assessing 10-50 metaphases
INTRODUCTION
mor detection, therefore, the current recommendation for patients with an intersex disorder or with TS containing Y-chromosome derivatives is to proceed with prophylactic removal of the dysgenic gonad prior to developing gonadoblastoma (8-10). As the detection of carriers of Y-chromosome genes using cytogenetic analysis may fail, more reliable techniques are needed to improve diagnostic accuracy. Fluorescent in situ hybridization (FISH) is believed to be a reliable method for the detection of the Y-chromosome or its fragments, but it is an expensive and time-consuming technique. One suggested way for a sensitive testing of Y-chromosome material is a PCR-based method, which usually targets multiple regions. Beside the generally tested sex-determining region of Y-chromosome (SRY) gene, another major target is the hypothetical gonadoblastoma Y region on the Y-chromosome (Yp11.2). Deletion mapping of the Y-chromosome localized the hypothetical gonadoblastoma locus on the Ychromosome (GBY) gene to a small region (1-2 Mb), near the centromere, and it also raised the idea of the presence of multiple GBY loci, where the testis specific region, Y-encoded (TSPY1) and Y-chromosome RNA recognition motif (YRRM) genes have been considered to be localized (11). However, the TSPY1 gene has recently been identified as a gonadoblastoma candidate gene (12-14). With special regard to the clinical and oncological importance of the GBY region, a sequence-specific detection may reveal the presence of the critical part of the Ychromosome and may select those patients whose careful follow-up is mandatory. Real-time PCR has proven to be a useful and reliable tool
Turner syndrome (TS) is a relatively common chromosomal abnormality affecting about 1 in every 2500-3000 live born females (1). It is characterized by short stature, ovarian failure, and specific somatic abnormalities. Complete 45,X monosomy accounts for 40-60% of the karyotypes on peripheral blood lymphocytes, while most of the remaining karyotypes show a mosaic pattern (2). Cytogenetic analysis detects the Y-chromosome mosaicism in about 5% of TS patients (3, 4). However, it has been proposed that cryptic mosaicism – for at least part of the Y-chromosome – may be present more frequently (5). The detection of Y-chromosome sequences in TS patients is important because the risk of developing gonadoblastoma can be as high as 27-30% (6, 7). Gonadoblastomas are gonadal neoplasms that consist of aggregates of germ cells and sex cord elements. Most gonadoblastomas behave in a benign fashion unless overgrowth of a malignant germ cell element is present. Dysgerminoma is the most common malignant element occurring in approximately 50% of cases (4). The malignant change may appear as early as the 1st or 2nd decade. Unfortunately, there are no serum markers for screening and early tu-
Key-words: Gonadoblastoma, real-time PCR, Turner syndrome, Y-chromosome. Correspondence: Á. Sallai, MD, 2nd Department of Pediatrics, Semmelweis University, Budapest, H-1094 Budapest, Tu´´zoltó u. 7-9. E-mail:
[email protected] Accepted June 5, 2009. First published online July 21, 2009.
222
Y-chromosome markers in Turner patients
for the specific detection of small DNA quantities. Realtime detection has proven to be as sensitive as conventional quantitative PCR techniques (15, 16). Regarding the simplicity, rapidity, and high cost efficiency of this method, it can also be used for mass screening. Therefore, we used this method to screen for Y-specific DNA sequences in more than 100 Hungarian TS patients.
Yp11+32 Yp11+31
MATERIALS AND METHODS Subjects The study included 130 consecutive patients with TS referred to the Hungarian Pediatric Endocrinology Network. The age range was 0.1-20 yr. The clinical diagnosis of the patients was set upon the medical history and presented clinical features at one of three major stages of maturation, namely at birth, when typical signs of TS appeared (congenital lymphedema: puffy hands and feet or redundant nuchal skin), at mid-childhood, when TS appeared as growth retardation with or without TS phenotypic findings, and in adolescence, when they failed to enter puberty (primary amenorrhea). The diagnosis of TS was verified by cytogenetic analysis (standard karyotyping) in all cases. The exclusion criteria were: ambiguous genitalia or enlargement of the clitoris. The study was approved by the Regional and Institutional Committee of Science and Research Ethics, Semmelweis University (TUKEB number: 11/2009). Written informed consent was obtained from the children older than 10 yr, adults, and the parents of the patients included in this study.
SRY
9
Yp11+2
TSPY1
9
Yp11+1 Yq11+1 Yq11+21
DDX3Y
8
Yq11+221 Yq11+222
HSFY1
6
Yq11+223 Yq11+23
Yq12
Methods Fig. 1 - Screened Y-specific DNA sequences with number of positive cases of the 130 patients with Turner syndrome. Map view of the Y-chromosome. The amplified regions are an intronic part of the SRY gene and an intron of the putative GBY region, namely the TSPY1 gene on the short arm and introns of the DDX3Y and the HSFY1 genes on the long arm of the Y-chromosome.
Cytogenetic analysis based on 10-50 metaphases was performed on 72-h stimulated peripheral blood cultures as described (17). FISH was performed on methanol:acetic acid fixed blood culture suspensions as described (18). Genomic DNA was isolated from 2 ml of peripheral blood with DNA isolation kit (QIAamp DNA Blood Midi Kit, Qiagen Inc, Hilden, Germany). In 3 patients who underwent gonadectomy DNA was also extracted from paraffin-embedded gonadal tissues using QIAmp Tissue Kit (Qiagen Inc.). For a sensitive detection of the presence of either the whole Y-chromosome or Y-chromosome fragments we established a real-time PCR method. Four Y-chromosome specific sequences at the regions of SRY, DEAD/H box polypeptide, Y-chromosome (DDX3Y), heat-shock transcription factor, Y-linked (HSFY1), and TSPY1 were amplified in the presence of a double stranded DNA binding dye (SYBRGreen) (Fig. 1). The primer sequences are listed in Table 1. Specific primer binding was analyzed by BLAST search tool (http://www.ncbi.nlm. nih.gov/BLAST/). The presence of the Y-chromosome specific PCR products were subsequently detected, and β-actin served as internal positive control. In order to determine the Y-chromosome-sensitivity of our assay the real-time PCR was carried out on a DNA sample from a male individual tested for whole Ychromosome positivity by FISH. A descending dilution series, in which the male DNA was diluted with female DNA to an end concentration of 50 ng/μl in a series from 100% to 0.01% of Ychromosome containing DNA material, was analyzed. Real-time PCR reaction was carried out on LightCycler™ instrument (Roche Diagnostics GmbH, Mannhein, Germany). Specific PCR products were tested by cycle sequencing. First the DNA samples were amplified with the Y-chromosome specific primer-
pairs and with the β-actin specific primers, serving as positive control and calibrator for the semi-quantitative analysis as well. The PCR reaction was carried out in a final volume of 20 μl using 2 μl of SYBR containing master mix (LightCycler DNA Master SYBR Green I, Roche), 40 ng of extracted DNA and primers at a final concentration of 0.5 pM/μl. Cycle conditions were as follows: denaturation of the template for one cycle of 95 C for 2 min; amplification of the target DNA for 30 cycles of 95 C for 10 sec, 58 C for 5 sec, and 72 C for 12 sec, each with a temperature transition rate of 20 C/sec. Fluorescence signal was detected after each extension step (FL-1, 480 nm) in order to verify the amount of PCR products. By creating a calibration curve from the ratio of the areas under the curves corresponding to the X-actin and the Y-chromosome regions, a semi-quantitative calculation of the relative amount of the initial Y-chromosome templates was calculated. Melting curves were generated with heating the samples at 95 C for 30 sec using a ramping rate of 20 C/sec, holding them at 40 C for 30 sec, then slowly heating the reaction mixtures to 95 C with a temperature transition rate of 0.1 C/sec. Fluorescence intensity was monitored simultaneously with the slow heating. Melting curves were converted into melting peaks by plotting the negative derivative of the fluorescence signal against the temperature. To verify the specificity of our PCR products, bidirectional cycle
223
Á. Sallai, J. Sólyom, M. Dobos, et al. Table 1 - Primers with product melting temperatures. Amplification primers of the control autosomal β-actin gene and 4 genes of the Ychromosome. The β-actin primers were designed onto the C intron of the β-actin gene, the SRY specific primers directly onto the SRY gene, the TSPY1 specific primers onto the intron B - exon 3 boundary of the TSPY1 gene, the DDX3Y specific primers next to an sequence tagged site (STS-site) on the first exon of the DDX3Y gene and the HSFY1 primers also onto an STS-site with minor modifications. Amplified region
Primer sequence
β-actin_F
CTCTGACCTGAGTCTCCTTTGG
β-actin_R
TCTGGGAAAAAGCAAATAGAACC
SRY_F
GCTGTAGGACAATCGGGTAAC
SRY_R
CTAAACATAAGAAAGTGAGGGCTG
TSPY1_F
CTCACCCGAAAACCTATCTAAGC
TSPY1_R
GGATGCTTCTCTTCTTCCACC
DDX3Y_F
AGTTCCGCTATTCGGTCTCA
DDX3Y_R
CCCTGAAGAGAAGCGAAAAA
HSFY1_F
AAGAAGCAACCGGAGTTAGG
HSFY1_R
TGTGTCCATTTATTCCCTTTGT
Product length
Melting temperature*
NCBI Sequence accession No.
54 bp
78-79 C
NT_007819.16
Primer binding position 5057640 5057587
91 bp
78-80 C
NT_011896.9
5516
65 bp
78-80 C
NT_011878.9
34916
61 bp
77-79 C
NT_011875.11
1217603
108 bp
78-80 C
NT_011875.11
5426 34894 1217663 6861871 6861978
(*product melting temperature may vary from salt concentrations).
RESULTS Cytogenetic and FISH analyses Classical cytogenetic analysis based on 10-50 metaphases revealed Y-chromosome mosaicism in 3 of the 130 patients (Table 2A and 2B; patients 4, 5, and 9). Of the 3 patients with Y-chromosome positivity, karyotypic classification showed mosaicism of the whole Y-chromosome in 2 samples (cases 4 and 5), while the 3rd case had mosaicism for part the Y-chromosome (patient 9). In addition, a thorough review of karyotype analysis using a large number (~100) of metaphases in 5 of the 9 who proved to have Y-chromosome material by our real-time PCR (patients 1, 3, 6, 8, and 9) revealed Y-chromosome mosaicism in each of the 5 patients. FISH analysis was also carried out in 6 of the 9 cases who showed the presence of Y-chromosome material by our real-time-PCR method (patients 1, 2, 4, 6, 7, and 8) and the results confirmed Y-chromosome positivity in each of the 6 patients (Table 2A and 2B).
sequencing analysis was carried out with each primer used for PCR. The PCR reactions were carried out on a PE9600 Thermal Cycler (Perkin Elmer, Waltham, Mass., USA). PCR products were purified with QIAquick PCR Purification Kit (Qiagen Inc.). The cycle sequencing reaction was performed with BigDye® Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on a PE9600 Thermal Cycler: initial denaturation 96 C for 1 min, 25 cycles with a denaturation step at 96 C for 10 sec, an annealing and extension step at 59 C for 4 min. Products were detected on ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). Examining the dilution series of the Y-chromosome, we were able to detect Y-specific products up to 1:1000 dilution of male positive control DNA with female DNA. We concluded that this method is capable of detecting Y-chromosome fragments in the samples, if at least 0.1% of the cells contain Y-chromosome material. Cycle sequencing proved that all of our amplified PCR product sequences matched the genomic sequences (β-actin GenBank Accession No.: NT_007819.16; SRY: GenBank Accession No.: NT_011896.9; TSPY1 GenBank Accession No.: NT_011878.9; DDX3Y and HSFY1 GenBank Accession No.: NT_011875.11).
Real-time PCR Real-time PCR analysis from a total of 130 samples re-
Table 2A - Genetic background and surgical reports of Turner patients with Y-chromosome positivity. Patient identification number
1
2
3
4
5
Age at first investigation (yr)
8
15
7
0.1
9.5
Karyotype (GTG) FISH
45,X [10]
45,X [15]
45,X [15]
45,X[1]/46,XY[14]
45,X[26]/46,XY[28]
wcpY-[42]/ wcpY+[58]
wcpY-[54]/ wcpY+[46]
ND
wcpY-[7]/ wcpY+[93]
ND
Y-chromosome specific sequences SRY
+
+
+
+
+
TSPY1
+
+
+
+
+
DDX3Y
+
+
+
+
+
HSFY1
+
-
-
+
+
45,X[51]/46,XY[66]
ND
45,X[97]/46,X,der(Y)[3]
ND
ND
Review of karyotype Age at bilateral gonadectomy (yr) Histology
14
15
8
5.5
11
Fallopian tubes no gonadal tissue
Streak gonads, segments of epididymis
Streak gonads
Bilateral gonadoblastoma
Streak gonad l.d. ovo-testis l.s.
GTG: G-bands produced by trypsin using Giemsa; FISH: fluorescent in situ hybridization; wcp: whole chromosome painting; ND: no data; der: derivative; l.d: right side; l.s: left side.
224
Y-chromosome markers in Turner patients Table 2B - Genetic background and surgical reports of Turner patients with Y-chromosome positivity. Patient identification number
6
7
8
Age at first investigation (yr)
9
12
7
9 8
Karyotype (GTG)
45,X[13]/46,X,+mar[7]
45,X[8]/46,X,+mar[6]
45,X[21]/46,X,del(Xq)[19]
45,X[18]/46,X,nfY[32]
FISH
wcpY-[78]/wcpY+[22]
wcpY-[88]/wcpY+[22]
wcpY-[62]/wcpY+[38]
ND
SRY
+
+
+
+
TSPY1
+
+
+
+
DDX3Y
+
-
+
+
HSFY1
+
-
+
+
45,X[9]46,XY[5]
ND
45,X[65]/46,XY[36]
45,X[40]/46,del(Yq)(11)[60]
Y-chromosome specific sequences
Review of karyotype Age at bilateral gonadectomy (yr) Histology
20
12.5
15
8
Streak gonads
Streak gonads
Streak gonads, some Leydig cells l.d.
Streak gonads
GTG: G-bands produced by trypsin using Giemsa; FISH: fluorescent in situ hybridization; wcp: whole chromosome painting; ND: no data; mar: marker; del: deletion; nf: not fluorescent; l.d.: right side.
and beyond the 2nd decade of life, and its incidence may be as high as 30% (4, 7, 20, 22-24), although Gravholt et al. indicated a lower frequency of 7-10% in their Danish patients (21). In a recent study, Mazzanti et al. emphasized that malignant transformation may occur early in life (7). From an ethical point of view, it is impossible to establish a prospective study to directly measure the gonadoblastoma incidence in humans, as prophylactic gonadectomy is the common procedure in cases of Y-chromosome material carriers (9, 10). In our group, the prophylactic operation was carried out in all 9 patients before the age of 20 yr, and 1 of them – a 5-yr-old girl, our youngest patient – had bilateral gonadoblastoma without any clinical signs. From a practical point of view, it would not be indifferent to restrain gonadectomy only for those who carry the GBY region, which recently proved to be the strongest candidate gene for the gonadoblastoma development. This gene contains the TSPY1 sequence (11, 12) that was also studied in this work. Cryopreservation of ovarian follicles or oocytes may be a future option for some patients undergoing gonadectomy (25). Unfortunately, we were not able to realize it. The question of which TS patients should be tested on the DNA level deserves further consideration. Standard karyotyping is a routinely applied method for testing of patients for Y-chromosome positivity. However, this frequently applied method may miss cases if the Y-chromosome is present only in a small proportion of cells or very small parts of the Y-chromosome or even marker chromosomes containing Y-specific regions are present. Page suggested to perform FISH or PCR testing only in patients who have clitoromegaly, signs of virilization, and in those who show marker chromosomes by conventional analysis (26). In contrast to this proposal, we identified carriers for Y-chromosome material in patients with 45,X karyotype who had neither virilization nor marker chromosome positivity. In a study of Quilter et al., the screening of fifty 45,X patients by PCR revealed 2 cases with a cell line containing Y-chromosome sequences (20). In a recent study including 52 cytogenetically diagnosed 45,X monosomic patients, 2 gonadoblastomas were found, and the presence of Y-chromosome material was confirmed by PCR in both cases (22).
vealed Y-chromosome positivity in 9 samples. Clinical features of these TS patients were similar to those with negative results. Six samples showed Y-chromosome positivity in all investigated regions, suggesting no partial loss of the studied regions of the Y-chromosome (Table 2A and 2B; patients 1, 4, 5, 6, 8, and 9). The remaining 3 patients were also positive for the Y-chromosome material, but they showed a partial loss of the long arm (patients 2, 3, and 7). DNA probes of these patients failed to give signal by the amplicons of the HSFY1 gene. Additionally, in one of these cases (patient 7) PCR results also proved the loss of the DDX3Y region, suggesting the loss of almost the complete long arm of the Y-chromosome (Fig. 1). Using the four Y-chromosome specific probes, of which 2 positioned on the short arm (SRY and TSPY1) and 2 on the long arm (DDX3Y and HSFY1), we were also able to locate the approximate position of the breaks. DNA from paraffin-embedded gonadal tissue was available from 3 gonadectomized patients. Real-time PCR analysis of the gonadal DNA revealed that in 1 sample Y-chromosome material was present in 100% of cells (patient 8), whereas 2 samples showed 30% and 10% Y-chromosome mosaicism (patients 5 and 6, respectively). DISCUSSION We can conclude that the frequency of detectable Ychromosome sequences in our TS patient population is similar to the average score of available published data (7, 19-23). Amongst the Hungarian Y-chromosome negative TS patients diagnosed by conventional cytogenetic analysis, Y-chromosome material was detected with our semi-quantitative real-time PCR method in 4.7% of the cases (6 of 127 patients). If we consider also those patients who were positive for the Y-chromosome by conventional cytogenetic analysis, the frequency reaches 6.9% (9 of 130 patients). On the basis of sporadic clinical experience, it is generally accepted that gonadal neoplastic malformation is more common in cases of gonadal dysgenesis when Y-chromosome material is present. It is also known that the malignant transformation appears mainly after the puberty
225
Á. Sallai, J. Sólyom, M. Dobos, et al.
by conventional cytogenetic analysis, Y-chromosome material was detected by this method in 6 patients, and these results were confirmed by cytogenetic karyotype analysis using a large number of metaphases and/or FISH method. In addition, we detected Y-chromosome sequences by the real-time PCR method in 3 patients with TS who were positive for Y-chromosome material by conventional cytogenetic karyotype analysis. Based on our findings and data from the literature, we recommend a routine molecular screening for hidden Y-chromosome sequences in TS patients, who proved to be Y-chromosome negative by conventional cytogenetic analysis. Molecular analysis should be performed as early as possible, because the appearance of gonadoblastoma and the possibility of malignant degeneration seem to occur at an early age of life.
Due to almost endless possible variations concerning the genotype of TS patients, it is difficult to propose a reliable, sensitive, and rapid quantitative testing method for the detection of Y-chromosome material. Previous works on the detection of Y-chromosome material in TS patients reported different methods including qualitative analysis of several regions of the chromosome by conventional PCR amplification. As cells positive for Y-chromosome material may form only a small fraction of peripheral blood leukocytes, it is impossible to estimate the true proportions of the mosaic cell pattern by qualitative PCR analysis. Moreover, it has recently been shown that mosaicism for Y-chromosome positivity may strongly vary among different tissues. Bianca et al. reported that 35% of the patients with TS had some Y-chromosome material when multiple tissues (oral epithelial cells, hair roots in addition to peripheral blood lymphocytes) included in the study (27). However, Mazzanti et al. reported that patients with gonadoblastoma failed to show a higher incidence of Y-mosaicism in blood and gonadal tissue (7). Giltay at al. described a 13-yr-old phenotypically female patient with 45,X/46,X, isodicentric (Y)(q11.23) and gonadolastoma. The GBY critical region was shown to be present in the idic (Y) chromosome. Yet the percentage of Y positive cells in the gonads appeared to be similar to that in the lymphocytes (28). Interestingly, our real-time PCR analysis of the gonadal DNA revealed a higher grade of Y-chromosome mosaicism than in peripheral blood in 1 patient and lower grade of Y-mosaicism in gonadal tissue in 2 patients. We describe here a novel simple molecular genetic method for the detection of Y-chromosome material using real-time PCR. Based upon a simple real-time PCR reaction our method is capable of detecting Y-chromosome material from human DNA of any source. Recently, the importance of detecting the presence of the Ychromosome and the possible significance of the ratio of mosaicism in gonadal tissues have been raised (29, 30). With the use of our semi-quantitive PCR method we were able to detect Y-chromosome material if it was present in at least 0.1% of cells (5 pg DNA). Advantages of this real-time PCR over conventional PCR reaction with consecutive gel electrophoresis include on one hand time saving and a great reduction of manual laboratory workload (fast and accurate results within 25 min from PCR mix to evaluation of the results, no need of gel electrophoresis or any additional detection method). On the other hand, real-time detection of the PCR products offers semi-automated evaluation of the results and it also allows a simple way of handling electronic patient records. Additionally, with the usage of double stranded DNA labeling dye (SYBR-Green) and without using sequence-specific detection probes costs do not exceed the costs of a conventional PCR reaction, thereby saving material and reducing laboratory personal costs. Finally, the simplicity and high cost efficiency of the presented method may be particularly advantageous for its use for high throughput screening as well. In summary, the semi-quantitative real-time PCR method proved to be a fast and accurate tool in determining Ychromosome material in TS patients. Of the 127 Hungarian Y-chromosome negative TS patients diagnosed
ACKNOWLEDGMENTS This work was supported by grant OTKA No. TO37277.
REFERENCES 1. 2.
3.
4. 5.
6.
7.
8. 9.
10.
11.
12.
13. 14.
226
Sybert VP, McCauley E. Turner’s syndrome. N Engl J Med 2004, 351: 1227-38. Hook EB, Warburton D. The distribution of chromosomal genotypes associated with Turner’s syndrome: livebirth prevalence rates and evidence for diminished fetal mortality and severity in genotypes associated with structural Y abnormalities or mosaicism. Hum Genet 1983, 64: 24-7. Magenis RE, Breg WR, Clark KA. Distribution of sex chromosome complements in 651 patients with Turner’s syndrome. Am J Hum Genet 1980, 32: 79A. Verp MS, Simpson JL. Abnormal sexual differentiation and neoplasia. Cancer Genet Cytogenetics 1987, 25: 191-218. Lindgren V, Chen C, Bryke CR, Lichter P, Page DC, Yang-Feng TL. Cytogenetic and molecular characterization of marker chromosomes in patients with mosaic 45,X karyotypes. Hum Genet 1992, 88: 393-8. Manuel M, Katayama PK, Jones HW Jr. The age of occurrence of gonadal tumors in intersex patients with a Y chromosome. Am J Obstet Gynecol 1976, 124: 293-300. Mazzanti L, Cicognani A, Baldazzi L, et al. Gonadoblastoma in Turner syndrome and Y-chromosome-derived material. Am J Med Genet A 2005, 135: 150-4. Magtibay PM. Treatment, behavior and prognosis of gonadoblastoma. CME J Gynecol Oncol 2004, 9: 26-7. Cools M, Drop SLS, Wolffenbuttel KP, Oosterhuis JW, Looijenga LHJ. Germ cell tumors in the intersex gonad: old paths, new directions, moving frontiers. Endocr Rev 2006, 27: 468-84. Lee PA, Houk CP, Ahmed SF, Hughes IA; International Consensus Conference on Intersex organized by the Lawson Wilkins Pediatric Endocrine Society and the European Society for Paediatric Endocrinology. Consensus statement on management of intersex disorders. International Consensus Conference on Intersex. Pediatrics 2006, 118: e488-500. Tsuchiya K, Reijo R, Page DC, Disteche CM. Gonadoblastoma: molecular definition of the susceptibility region on the Y chromosome. Am J Hum Genet 1995, 57: 1400-7. Hildenbrand R, Schröder W, Brude E, et al. Detection of TSPY protein in an unilateral microscopic gonadoblastoma of a Turner mosaic patient with a Y-derived marker chromosome. J Pathol 1999, 189: 623-6. Lau YF. Gonadoblastoma, testicular and prostate cancers, and TSPY gene. Am J Hum Genet 1999, 64: 921-7. Delbridge ML, Longepied G, Depetris D, et al. TSPY, the candidate gonadoblastoma gene on the human Y chromosome, has a widely expressed homologue on the X - implications for Y chromosome evolution. Chromosome Res 2004, 12: 345-56.
Y-chromosome markers in Turner patients 15. 16.
17.
18.
19.
20.
21.
22. 23.
Ball TB, Plummer FA, HayGlass KT. Improved mRNA quantitation in LightCycler RT-PCR. Int Arch Allergy Immunol 2003, 130: 82-6. Wilkening S, Bader A. Quantitative real-time polymerase chain reaction: methodical analysis and mathematical model. J Biomol Tech 2004, 5: 107-11. Haltrich I, Müller J, Szabó J, et al. Donor-cell myelodysplastic syndrome developing 13 years after marrow grafting for aplastic anemia. Cancer Genet Cytogenet 2003, 142: 124-8. Pinkel D, Straume T, Gray JW. Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci U S A 1986, 83: 2934-8. Chu CE, Connor JM, Donaldson MDC, Kelnar CJH, Smail PJ, Greene SA. Detection of Y mosaicism in patients with Turner’s syndrome. J Med Genet 1995, 32: 578-80. Quilter CR, Taylor K, Conway GS, Nathwani N, Delhanty JDA. Cytogenetic and molecular investigations of Y chromosome sequences and their role in Turner syndrome. Ann Hum Genet 1998, 62: 99-106. Gravholt CH, Fedder J, Naeraa RW, Müller J. Occurrence of gonadoblastoma in females with Turner syndrome and Y chromosome material: a population study. J Clin Endocrinol Metab 2000, 85: 3199-202. Álvarez-Nava F, Soto M, Sánchez MA, Fernández E, Lanes R. Molecular analysis in Turner syndrome. J Pediatr 2003, 142: 336-40. Canto P, Kofman-Alfaro S, Jiménez AL, et al. Gonadoblastoma in Turner syndrome patients with nonmosaic 45,X karyotype and Y chromosome sequences. Cancer Genet Cytogenet 2004, 150: 70-2.
24.
25.
26. 27.
28.
29.
30.
227
McDonough PG, Tho SPT. Clinical implications of overt and cryptic Y mosaicism in individuals with dysgenetic gonads. In: Gravholt CH, Bondy CA, eds. Wellness for Girls and Women with Turner Syndrome: International Congress Series 1298, Amsterdam: Elsevier 2006, 13-20. Hovatta O, Hreinsson J, Fridström M, Borgström B. Fertility and pregnancy aspects in Turner syndrome. In: Gravholt CH, Bondy CA, eds. Wellness for Girls and Women with Turner Syndrome: International Congress Series 1298, Amsterdam: Elsevier 2006, 185-9. Page DC. Y chromosome sequences in Turner’s syndrome and risk of gonadoblastoma or virilisation. Lancet 1994, 343: 240. Bianco B, Lipay MV, Melaragno MI, Guedes AD, Verreschi ITN. Detection of hidden Y mosaicism in Turner's syndrome: importance in the prevention of gonadoblastoma. J Pediatr Endocrinol Metab 2006, 19: 1113-7. Giltay JC, Ausems MG, van Seumeren I, et al. Short stature as the only presenting feature in a patient with an isodicentric (Y)(q11.23) and gonadoblastoma. A clinical and molecular cytogenetic study. Eur J Pediatr 2001, 60: 154-8. Osipova GR, Karmanov ME, Kozlova SI, Evgrafov OV. PCR detection of Y specific sequences in patients with Ullrich-Turner syndrome: clinical implications and limitations. Am J Med Genet 1998, 76: 283-7. Vodicka R, Vrtel R, Scheinost O, et al. Refined quantitative fluorescent PCR of Y-chromosome DNA sequences mosaics in Turner's syndrome patients--alternative to real-time PCR. J Biochem Biophys Methods 2004, 60: 151-62.
