Plant Molecular Biology 20: 1111-1119, 1992. © 1992 Kluwer Academic Publishers. Printed in Belgium.

1111

Adenine depurination and inactivation of plant ribosomes by an antiviral protein of Mirabilis jalapa (MAP) Jiro Kataoka, Noriyuki Habuka, Masashi Miyano, Chikara Masuta, and Akira Koiwai Life Science Research Laboratory, Japan Tobacco Inc., 6-2 Umegaoka, Midori-ku, Yokohama, Kanagawa 22 7, Japan Received 6 January 1992; accepted in revised form 7 August 1992

Key words: Mirabilis antiviral protein, ribosome-inactivating protein, tritin, viral resistance

Abstract

Mirabilis antiviral protein (MAP) is a single-chain ribosome-inactivating protein (RIP) isolated from Mirabilisjalapa L. It depurinates the 28S-like rRNAs of prokaryotes and eukaryotes. A specific modification in the 25S rRNA of M.jalapa was found to occur during isolation of ribosomes by polyacrylamide/agarose composite gel electrophoresis. Primer extension analysis revealed the modification site to be at the adenine residue corresponding to A 4324 in rat 28S rRNA. The amount of endogenous M A P seemed to be sufficient to inactivate most of the homologous ribosomes. The adenine of wheat ribosomes was also found to be removed to some extent by an endogenous RIP (tritin). However, the amount of endogenous tritin seemed to be insufficient for quantitative depurination of the homologous ribosomes. Endogenous MAP could shut down the protein synthesis of its own cells when it spreads into the cytoplasm through breaks of the cells. Therefore, we speculate that M A P is a defensive agent to induce viral resistance through the suicide of its own cells.

Introduction

Ribosome-inactivating proteins (RIPs) have been isolated from several plants [ 1 ], such as ricin from Ricinus communis [26], trichosanthin from Trichosanthes kirilowii Maxim. [25] and pokeweed antiviral protein (PAP) from Phytolacca americana [18]. It has been suggested that these proteins inactivate ribosomes with their R N A N-glycosidase activity, that is, they cleave the

N-glycosidic bond at adenine 4324 of rat liver 28S rRNA, resulting in the inhibition of protein synthesis [ 10, 36]. This adenine is located in the universally conserved region of 12 nucleotides in 28 S-like rRNAs of both eukaryotes and prokaryotes [5]. It is well known that RIPs have the ability to inhibit multiplication of plant viruses [ 1, 3, 18, 22, 27, 35, 37]. This antiviral activity might be based on their R N A N-glycosidase activity. PAP is lo-

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession numbers X64260 (M. jalapa 25S ribosomal RNA) and X64261 (N. tabacum 25S ribosomal RNA).

1112 cated in the cell wall matrix of P. americana [31]. One study indicates that the ribosomes of P. americana are depurinated by endogenous PAP during isolation [36]. When the protein penetrates into the cytoplasm of its own cell along with a virus through a break in the cell wall and membrane caused by an insect, it could shut down the protein synthesis of the plant to inhibit replication of the virus. Therefore, it was suggested that PAP was a defensive agent whose principal function was probably antiviral [ 31 ]. MAP is a single-chain RIP of Mirabilis jalapa and exhibits antiviral activity [22, 35 ]. A previous report describes the cloning of MAP cDNA, and based on an analysis of the cDNA, it was suggested that MAP is compartmentalized in vacuoles [20]. When MAP genes were expressed in Escherichia coli, the growth of the transformants was completely inhibited [ 13, 20]. The 23S rRNA of the transformant was depurinated by the MAP at A 266°, which corresponds to A 4324 in rat 28S rRNA [ 14]. These results indicate that MAP is a unique RIP which inactivates the ribosomes of E. coli as well as eukaryotes by its RNA N-glycosidase activity. Although many RIPs have been reported to have no effect on homologous ribosomes [33], MAP as a wide-spectrum RNA N-glycosidase may be exceptional in that it inactivates homologous ribosomes provoking cell suicide. In order to examine this possibility, the effect of MAP on homologous ribosomes was investigated. This paper reports on the depurination of the adenine in the rRNAs of plants by endogenous RIPs and discusses the relationship between the RNA N-glycosidase activity and the antiviral activity of RIPs.

Materials and methods

Isolation of ribosomes and total RNA from plants Plant ribosomes were isolated by the methods of Larkins et al. [ 19, 23 ] with some modifications. A 50 g portion of plant tissue was frozen in liquid nitrogen and powdered using a coffee mill. The powdered tissue was gently suspended in 300 ml

of the extraction buffer (0.2 M Tris-HC1 pH 9.0, 0.4 M KC1, 60 m M Mg C12, 0.25 M sucrose, 5 m M dithiothreitol and 1/~g/ml cycloheximide). Cell debris was removed by centrifugation (30000 x g for 15 min at 4 °C). The supernatant was layered onto a purification buffer (1.5 M sucrose, 40 m M Tris-HC1 pH 9.0, 0.1 M KC1, 5 m M MgCI2, and 1 #g/ml cycloheximide) and ultracentrifuged (230 000 x g for 3 h at 4 ° C). The pellet of ribosomes was resuspended in 10 ml of the extraction buffer and the solution was repeatedly subjected to the sucrose purification procedure. Finally, the ribosomes were suspended in an assay buffer ( 5 0 m M Tris-HC1, pH 7.5, 150 mM NaC1, 5 mM MgCI2, and 1 #g/ml cycloheximide). Total RNA was isolated by a method used for the isolation of m R N A [12] in order to minimize the effects of cell rupture.

Treatment of ribosomes with MAP and aniline MAP was purified to homogeneity from roots of M. jalapa by ammonium sulfate precipitation and ion exchange chromatography with CM- and DEAE-Sepharose [35]. 1.5 A260 units of ribosomes were incubated with 10 nM MAP in 100/~1 of a reaction buffer (25 m M Tris-HC1 pH 7.6, 25 mM KC1, 5 mM MgCI2) at 37 °C for 30 min [14]. Total rRNAs from the ribosomes were incubated with 1 M aniline/acetate (pH4.5) at 60 °C for 10 min in the dark [14, 29]. An aliquot of the reactant was subjected to 3.0~o polyacrylamide/0.5 ~o agarose composite gel electrophoresis [ 14, 28].

Amplification of cDNA for 25S rRNA by polymerase chain reaction (PCR) Primers a and b (Fig. 2A) for the polymerase chain reaction were synthesized with a D N A synthesizer (ABI). The first-strand c D N A was synthesized from 2/tg of total RNA primed with primer b (Fig. 2A) by M-MLV reverse transcriptase (BRL) at 37 °C for 60 min. PCR was carried out using the cDNA, 1/~M each of the

1113 primers a and b, and a GeneAmp PCR Reagent Kit (Cetus) (Fig. 2A). Double-stranded cDNAs were amplified by 25 cycles of denaturation (95 ° C, 1.5 min), annealing (42 ° C, 2.5 min), and primer extension (72 °C, 3.5 rain) using a DNA Thermal Cycler (Cetus). The amplified DNA was cloned in pBluescript (Stratagene) at the Eco RV site. Its nucleotide sequence was determined using a T7 DNA sequencing system "Pharmacia).

RNA sequencing of 25S rRNAs A synthetic oligonucleotide primer complimentary to the sequence 44-60 bases downstream from the adenine corresponding to A 4324 in rat liver 28S rRNA (primer c, Fig. 2B) was used for rRNA sequencing. 0.5 pmol of the primer was annealed with 5 #g of the total nucleic acids at 42 °C for 15 min. After the addition of 2 #1 each of [c~-32p] dCTP, 0.2M dithiothreitol and

Fig. 1. Polyacrylamide/agarose composite gel electrophoresis analysis of the rRNAs from M. jalapa and N. tabacum. 1.5 A260units of isolated ribosomes were incubated with 10 nM of MAP at 37 °C for 30 min (lanes, 2, 4, 6, 8) [14]. Total rRNAs were purified from the ribosomes by phenol/chloroform extraction and ethanol precipitation. The rRNAs were incubated with 1 M aniline/ acetate (pH 4.5) at 60 °C for 10 rain in the dark (lanes 3, 4, 7, 8) [14, 29]. The rRNAs were analyzed on a 3.0% polyacrylamide/ 0.5 % agarose composite gel and stained with ethidium bromide [ 14, 28]. Large subunit rRNA after aniline treatment was not apparently stained with ethidium bromide. Arrows indicate small RNA fragments released from the ribosomes by the treatment(s).

1114 M-MLV reverse transcriptase, each solution (3.3 #1) was incubated at 42 °C for 15 min with four different dideoxy mixtures (10 mM Tris-HC1 pH 8.0, 0.1mM dATP, 0.1raM dGTP, 0.004 mM dCTP, 0.1 mM dTTP, and either of 0.14raM ddGTP, 0.1raM ddATP, 0.005 mM ddCTP, or 0.06 mM ddTTP). After the addition of 2 #1 of chase mixture (0.5 mM each of dATP, dGTP, dCTP and dTTP), incubation was continued for 15 rain at 42 °C [14]. After heating at

95 °C for 2 min with 6 #1 of formamide, 2 #1 of each solution were loaded onto a 6~o polyacrylamide sequencing gel.

Primer extension analysis of 25S rRNA cDNA was synthesized from the 2 #g of purified RNA primed with primer c at 42 °C for 30 rain in 10 #1 of a reaction mixture consisting of 20 units

(A) 5'

Conserved I Region [

250 bases

3'

Conserved Region

PCRProducts Primer-a..~

4" Primer-b.

(B) 5'

+ ]AGUACGAGAGGAAC]CGUUGAUUCGCACAAUUGGUCAUCGCGCUUGGUU~GCCAGUGGCGCGAA Primer

3' .......

c

(c) M. jalapa N. tabacum O. sativa T. aestivum Rat

Yeast E. coli

DI2CGUUGAUUC G - - A . . . . . . . . . . . . . . . . |. . . . . ---'------------G--A ............ I. . . . . . . . . . . . . . . . . . . . . . . C ........ C-UG-UC] ................ CA-G- - ---A ...... G---U-[ .............. A---C . . . . G-G--GGGC-GCU--I. . . . . . . . . . . . C-G-AGUGGA-

Fig. 2. A. Schematic presentation of consensus motif found in 3' terminal regions of 25S rRNAs of plants. 5' 'Conserved Region' indicates the universally conserved region of 12 nucleotides in 25S-like rRNAs of prokaryotes and eukaryotes. 3' 'Conserved Region' indicates another conserved region in 25 S rRNAs of plants. Primers a and b were based on the sequences of the two regions, 5 ' - A A C G T A G T A C G A G A G G A A C - 3 ' and 5 ' - A A G T C G T C T G C A A A G G A T T - 3 ' , respectively. B. Nucleotide sequence of the 25S rRNAs surrounding the adenine susceptible to depurination and the position of primer c. The universally conserved region of 12 nueleotides in 25S-like rRNAs of prokaryotes and eukaryotes is boxed. The adenine susceptible to depurination is indicated by an asterisk. An arrow indicates direction and length of the synthetic oligonucleotide primer, 5 ' - T T C G C G C C A C T G G C T T T 3', complimentary to the sequence 44-60 bases downstream from the adenine (primer c). The G marked with a plus sign is replaced by A in the rRNAs of T. aestivum [2] and O. sativa [34]. C. Comparison of the nucleotide sequence of the 25S rRNAs of M. jalapa with those of several other organisms. The nucleotide sequence of 25 S rRNA of M. jalapa was compared with those ofN. tabacum, O. sativa [34], T. aestivum [2], rat [6], yeast [ 11 ], and E. coli [4]. The universally conserved region of 12 nucleotides in 25S-like rRNAs of prokaryotes and eukaryotes is boxed. An asterisk indicates the adenine susceptible to depurination by RIPs.

1115 of M-MLV reverse transcriptase and 1 m M each of dNTP and 10 #Ci [c~-32p]dCTP. After heating at 95 °C for 2 min with 10 #1 of formamide, it was loaded onto a 6~o polyacrylamide sequencing gel. The radioactivity of each terminated band was measured using an Imaging Plate and a BA100 Imaging Plate Reader (Fuji Film Inc.).

RNAs of either plant isolated by the GTC buffer (strong protein denaturants) after the aniline treatment (data not shown). These results indicate that M. jalapa ribosomes were modified at a specific position during the isolation procedures. As it was critically important to determine the modification site in the rRNA of M. jalapa, further investigations were carried out.

RNA extraction from wheat germ by variousprocedures

Determination of nucleotide sequences of 25S rRNAs

A 50 g portion of wheat germ was frozen in liquid nitrogen, ground using a coffee mill, and homogenized with 100 ml of the extraction buffer. The homogenate was divided into three parts, and each was treated separately under different conditions; a) one was stored at -20 ° C just after homogenization; b) another was incubated at 37 °C for one hour; c) and the last was incubated at 37 °C for 1 h in the presence of 10 nM MAP. After each treatment, the total RNA was extracted by phenol/chloroform as described previously [20]. Intact wheat RNA was extracted using the GTC buffer as described above.

Sequencing and primer extension analysis of E. coli 23S rRNA revealed the modification site

Results

Modification of M. jalapa ribosomes during isolation The aniline treatment of rRNA is the established method of detecting the depurination of 28S-like rRNA by an RIP [9, 10, 14, 32, 36]. Figure 1 shows the effects of exogenous MAP on isolated ribosomes of the homologous (M. jalapa) and a heterologous (Nicotiana tabacum) plants. In the case of N. tabacum ribosomes, the small RNA fragment (ca. 360 bases) appeared only after MAP and aniline treatments (lane 8). In contrast, in the case ofM. jalapa ribosomes, the RNA fragment with the same mobility was detected after aniline treatment alone (lane 3) as well as after MAP and aniline treatments (lane 4). The small RNA fragment was not detected in the intact

Fig. 3. R N A sequencing of the 25S rRNAs using primer c. Each R N A was isolated using the GTC buffer. Five #g of the total RNA annealed with 0.5 pmol of primer c were used in the dideoxy chain termination reaction. Arrowheads indicate the adenine susceptible to depurination by RIPs.

1116 [14, 16]. Due to a lack of information on the nucleotide sequences ofM. jalapa and N. tabacum 25S rRNAs, it was necessary to determine the sequences of the rRNAs around the target adenine of MAP. By computer analysis of the 25S rRNA sequences of monocot plants such as Triticum aestivum [2], Oryza sativa [34], and Citrus limon [21], another conserved region was identified at approximately 250 bases downstream from the universally conserved region (Fig. 2A). The 25S rRNA sequences of M.jalapa and N. tabacum between these regions were determined by sequencing the P C R products using the synthetic primers a and b, which are based on the sequences of these conserved regions. Primer c was synthesized at 44-60 bases downstream from the adenine (Fig. 2B). The sequences surrounding the adenine in both plants were determined by

sequencing the rRNAs with primer c (Fig. 3). A region of 12 bases was completely conserved in the 25S-like rRNAs of these two dicot plants, monocot plants [2, 34], rat [6], yeast [11] and E. coli [4] (Fig. 2C).

Removal of the adenine in 25S rRNAs by an endogenous RIP

Removal of the adenine in 25 S rRNA was examined by primer extension analysis using primer c (Fig. 4). Either removal of the adenine or cleavage at the site should specifically terminate the primer extension after the addition of 43 bases. In the case of N. tabacum, the specific termination was observed in the rRNA of the ribosomes when treated with MAP (lanes 6 and 8). In contrast, in

Fig. 4. Primer extension analysis of the rRNAs. The same rRNAs as used in Fig. 1 were analyzed. Each c D N A was synthesized from purified rRNA primed with primer c at 42 °C for 30 min in a mixture of 20 units of the reverse transcriptase, 1 mM each of dNTP and 10/~Ci [e-32p]dCTP. The D N A size marker was synthesized by sequencing M13mpl8 using M4 primer. Arrows indicate the position of the primer extension after the addition of 43 bases, corresponding to a G just downstream of the susceptible adenine.

1117 There was also a weak termination of the primer extension after the addition of 44 bases (lanes 1, 2 and 6). This seems to be generated by the peculiar activity of reverse transcriptase on the depurinated RNA used as a template [141. Wheat rRNAs also exhibited the specific termination after the addition of 43 bases in all the RNAs isolated under various conditions (Fig. 5), although the small RNA fragment was not detected in the rRNAs without MAP treatment after the aniline treatment, as previously reported [ 36 ]. The relative intensities of the terminated bands were as follows: lane 1/lane 2/lane 3/lane 4 = 1: 1.9: 3.6: 30. These results seem to indicate that wheat ribosomes are slightly depurinated during the incubation of wheat germ extracts.

Discussion

Fig. 5. Primer extension analysis of wheat rRNAs isolated under different conditions. The cDNAs were synthesized by the same method as described in Fig. 4. Lane 1: total R N A was isolated from wheat germ using the G T C buffer. Phenol/ chloroform extraction was employed for lanes 2, 3 and 4 after each treatment. Lane 2: homogenate of wheat germ in the extraction buffer was stored at - 2 0 °C just after homogenization. Lane 3: the homogenate was incubated at 37 °C for 1 h. Lane 4: the homogenate was incubated at 37 °C for 1 h in the presence of 10 n M MAP. G T C and Phe indicate the R N A isolation methods of GTC buffer and phenol/ chloroform, respectively. Time indicates the incubation time (hours) of the homogenate at 37 ° C with ( + ) or without ( - ) 10 n M M A P (MAP). An arrow indicates the termination of the primer extension after the addition of 43 bases, corresponding to a G just downstream of the susceptible adenine.

the case of M. jalapa, the termination was observed in all the rRNAs of the ribosomes not only with (lanes 2 and 4), but also without (lanes 1 and 3) MAP treatment. These results indicate that MAP removes the adenine in homologous 25S rRNA as well as that in the heterologous type.

The two analytical procedures carried out on the ribosomes of M. jalapa revealed that the ribosomes were susceptible to the RNA N-glycosidase activity of endogenous MAP. The small RNA fragment (lane 4 in Fig. 1) and the extended primer bands (lanes 2 and 4 in Fig. 4) from the ribosomes treated with MAP showed the same intensity as those from untreated ribosomes (lane 3 in Fig. 1, and lanes 1 and 3 in Fig. 4, respectively). These results indicate that the amount of endogenous MAP is sufficient to depurinate most of the homologous ribosomes. While the rRNA isolated using strong denaturants showed only a weak termination signal in each sequencing strand just downstream from the position of the susceptible adenine (Fig. 3), it showed no detectable small RNA fragment after the aniline treatment (data not shown). These results suggest that few ribosomes ofM. jalapa were depurinated in vivo, and that most of the ribosomes were depurinated during isolation. The depurination of ribosomes leads to the inhibition of protein synthesis resulting in cell death [1, 9, 10, 26]. Therefore, it seems possible that endogenous MAP provokes the suicide of its own cells when it spreads through the cytoplasm through breaks in the cell.

1118 Although studies using the cell-free translation system of wheat [8] and the analysis of wheat rRNA by the aniline treatment [36] found tritin to have no effect on homologous ribosomes, primer extension analysis revealed the partial depurination of wheat ribosomes by endogenous tritin (Fig. 5). However, the amount of endogenous tritin and/or its activity on homologous ribosomes was insufficient for quantitative depurination of the ribosomes. So, there is little possibility that endogenous tritin provokes the suicide of its own cells like MAP. It has been suggested that all RIPs have evolved from a single ancestral protein of unknown function but presumably for defensive suicide [30]. However, many 'modern' RIPs do not affect homologous ribosomes [33 ]. Therefore, it is speculated that MAP and PAP [31, 36] have conserved their original self-defensive function, but that most other RIPs have lost this function during evolution and that other defensive systems have taken over this role. It may be possible to induce resistance to viruses in plants through the introduction of a heterologous RIP gene. The gene product should be kept completely away from the ribosomes of the plant until the cells are damaged. Considering the presence of the signal pepfides in all RIP genes so far reported [7, 15, 17, 20, 24], the compartmentalization of the gene product by its signal peptide may be a useful strategy to produce an antiviral transgenic plant with a heterologous RIP gene.

Acknowledgements The authors are grateful to Mr Y. Kanzaki, Food Research Center, Nisshin Flour Milling Co. Ltd., for providing the wheat germ.

References 1. Barbieri L, Stirpe F: Ribosome-inactivatingproteins from plants: properties and possible uses. Cancer Surv 1: 489520 (1982). 2. Barker RF, Harberd NP, Jarvis MG, Flavell RB: Structure and evolution of the intergenic region in a ribosomal

DNA repeat unit of wheat. J Mol Biol 201:1-17 (1988). 3. Battelli MG, Lorenzoni E, Stirpe F: Differential effect of ribosome-inactivating proteins on plant ribosome activity and plant cells growth. J. Exp. Bot 35:882-889 (1984). 4. Brosius J, Dull TJ, Noller HF: Complete nucleotide sequence of a 23S ribosomal RNA gene from Escherichia coli. Proc Natl Acad Sci USA 77:201-204 (1980). 5. Chan Y-L, Endo Y, Wool IG: The sequence of the nucleotides at the c~-sarcin cleavage site in rat 28S ribosomal ribonucleic acid. J BioI Chem 258:12768-12770 (1983). 6. Chan Y-L, Olivera J, Wool IG: The structure of rat 28S ribosomal ribonucleic acid inferred from the sequence of nucleotides in a gene. Nucl Acids Res 11:7819-7831 (1983). 7. Chow TP, Feldman RA, Lovett M, Piatak M: Isolation and DNA sequencing of a gene encoding ~-trichosanthin, a type I ribosome-inactivating protein. J Biol Chem 265: 8670-8674 (1990). 8. Coleman WH, Roberts WK: Factor requirements for the tritin inactivation of animal cell ribosomes. Biochim Biophys Acta 654:57-66 (1981). 9. Endo Y, Tsurugi K: The RNA N-glycosidase activity of ricin A-chain. J Biol Chem 263:8735-8739 (1988). 10. Endo Y, Mitsui K, Motizuki M, Tsurugi K: The mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. J Biol Chem 262:5908-5912 (1987). 11. Georgiev OI, Nikolaev N, Hadjiolov AA, Skryabin KG, Zakharyev VM, Bayev AA: The structure of the yeast ribosomal RNA genes. 4. Complete sequence of the 25S rRNA gene from Saccharomyces cerevisiae. Nucl Acids Res 9:6953-6958 (1981). 12. Glisin V, Crkvenjakov R, Byus C: Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13: 2633-2637 (1974). 13. Habuka N, Akiyama K, Tsuge H, Miyano M, Matsumoto T, Noma M: Expression and secretion of Mirabilis antiviral protein in Escherichia coli and its inhibition of in vitro eukaryotic and prokaryotic protein synthesis. J Biol Chem 265:10988-10992 (1990). 14. Habuka N, Miyano M, Kataoka J, Noma M: Escherichia coli ribosome is inactivated by Mirabilis antiviral protein which cleaves the N-glycosidic bond at the A 266° of the 23S ribosomal RNA. J Mol Biol 221:737-743 (1991). 15. Hailing KC, Hailing AC, Murray EE, Ladin BF, Houston KC, Weaver RF: Genomic cloning and characterization of a ricin gene from Ricinus communis. Nucl Acids Res 13:8019-8033 (1985). 16. Hartley MR, Legname G, Osborn R, Chen Z, Load JM: Single-chain ribosome inactivating proteins from plants depurinate Escherichia coli 23S ribosomal RNA. FEBS Lett 290:65-68 (1991). 17. Ho WKK, Liu SC, Shaw PC, Yeung HW, Ng TB, Chart WY: Cloning of the cDNA of c~-momorcharin: a ribosome inactivating protein. Biochim Biophys Acta 1088: 311314 (1991).

1119 18. Irvin JD: Purification and partial characterization of the antiviral protein Phytolacca americana which inhibits eukaryotic protein synthesis. Arch Biochem Biophys 169: 522-528 (1975). 19. Jackson AO, Larkins BA: Influence of ionic strength, pH, and chelation of divalent metals on isolation of polyribosomes from tobacco leaves. Plant Physiol 57:5-10 (1976). 20. Kataoka J, Habuka N, Miyano M, Takanami Y, Koiwai A: DNA sequence of Mirabilis antiviral protein (MAP), a ribosome-inactivating protein with an antiviral property, from Mirabilis jalapa L. and its expression in Escherichia coli. J Biol Chem 266:8426-8430 (1991). 21. Kolosha VO, Krynkov VM, Fodor I: Sequence analysis of Citrus limon DNA coding for 26S rRNA-evidence of heterogeneity in the 3'-region. FEBS Lett 197:89-92 (1986). 22. Kubo S, Ikeda T, Imaizttmi S, Takanami Y, Mikami Y: A potent plant virus inhibitor found in Mirabilisjalapa L. Ann Phytopathol Soc Jpn 56:481-487 (1990). 23. Larkins BA, Davies E: Polyribosomes from peas. Plant Physiol 55:749-756 (1975). 24. Legname G, Bellosta P, Gromo G, Modena D, Keen JN, Roberts LM, Lord JM: Nucleotide sequence of cDNA coding for dianthin 30, a ribosome inactivating protein from Dianthus caryophyllus. Biochim Biophys Acta 1090: 119-122 (1991). 25. Maraganore JM, Joseph M, Bailey MC: Purification and characterization of trichosanthin. J Biol Chem 258: 11628-11633 (1987). 26. Olsnes S, Pihl A: Toxic lectins and related proteins. In: Cohen P, Heyningen S (eds) The Molecular Action of Toxins and Viruses. Elsevier, New York (1982). 27. Owens RA, Bruening G, Shepherd RJ: A possible mech-

28.

29. 30.

31.

32.

33.

34.

35.

36.

37.

anism for the inhibition of plant viruses by a peptide from Phytolacca americana. Virology 56:390-393 (1973). Peacock AC, Dingrnan CW: Molecular weight estimation and separation of ribonucleic acid by electrophoresis in agarose-acrylamide composite gels. Biochemistry 7: 668674 (1968). PeattieDA: Direct chemical method for sequencingRNA. Proc Natl Aead Sci USA 76:1760-1764 (1979). Ready M, Wilson K, Piatak M, Robertus JD: Ricin-like toxins are evolutionarily related to single-chain ribosomeinhibiting proteins from Phytolacca. J Biol Chem 259: 15252-15256 (1984). Ready MP, Brown DT, Robertus JD: Extracellular localization of pokeweed antiviral protein. Proc Natl Acad Sci USA 83:5053-5056 (1986). Stirpe F, Bailey S, Miller SP, Bodley JM: Modification of ribosomal RNA by ribosome-ifiactivating proteins from plants. Nucl Acids Res 16:1349-1357 (1988). Stirpe F, Hughes RC: Specificityof ribosome-inactivating proteins with RNA N-glyeosidase activity. Biochem J 262: 1001-1002 (1989). Takaiwa F, Oono K, Iida Y, Sugiura M: The complete nucleotide sequence of a rice 25S rRNA gene. Gene 37: 255-259 (1985). Takanami Y, Kuwata S, Ikeda T, Kubo S: Purification and characterization of the anti-plant viral protein from Mirabilisjalapa L. Ann Phytopathol Soc Jpn 56:488-494 (1990). Taylor BE, Irvin JD: Depurination of plant ribosomes by pokeweed antiviral protein. FEBS Lett 273:144-146 (1990). Wyatt SD, Shepherd RJ: Isolation and characterization of a virus inhibitor from Phytolacca americana. Phytopathology 59:1787-1794 (1969).