ISSN 10193316, Herald of the Russian Academy of Sciences, 2010, Vol. 80, No. 6, pp. 491–497. © Pleiades Publishing, Ltd., 2010. Original Russian Text © E.A. BonchOsmolovskaya, N.V. Ravin, 2010, published in Vestnik Rossiiskoi Akademii Nauk, 2010, Vol. 80, No. 11, pp. 977–984.

From the Researcher’s Notebook Thermophilic organisms, which grow at temperatures of 80°C and higher, have been actively studied in recent decades. The methods of classical microbiology helped to obtain and describe dozens of new microorganisms in laboratory pure cultures (identical microbial cell communities). In 2008–2009, the RAS Bioengineering Center jointly with the Vinogradskii Institute of Microbiology, RAS, identified and analyzed the full genomic sequences of 11 new hyperthermophilic archaea. The results of this work are presented below. DOI: 10.1134/S1019331610060043

Analysis of Full Genomes: A New Stage in the Development of Microbiology E. A. BonchOsmolovskaya and N. V. Ravin* Microbiology—a science of organisms, although microorganisms—belongs to classical biological dis ciplines. However, owing to the specifics of its objects, it had to develop a complex of methods that are uncharacteristic of other biological disciplines. The minimal diversity of morphological characters in microorganisms under a great diversity of functional characteristics has made the latter the main pheno typic descriptors. At the same time, the small dimen sions of organisms did not allow us (at least, during the main period of development of microbiology) to investigate these functional characteristics in one organism, i.e., in one cell, which furthermore has even smaller dimensions than the cells of more complex liv ing beings. Therefore, at the dawn of microbiology, a remarkable breakthrough was the development of cul ture techniques. They imply the obtaining of labora tory cultures of microorganisms, which are certain stable communities maintained artificially by provid ing them with all nutritious substrates, microelements, vitamins, etc., necessary for their vital activity. The most important stage of microbiological work was (and still is) the obtaining of the pure cultures of microorganisms, which consist of absolutely identical cells, and these cells can be described as a single organism. The whole microbiology of the 20th century was based on research into pure cultures, providing insights into the extreme metabolic diversity of micro organisms and multiple biochemical processes involv ing them. Improving culture techniques and obtaining hardtoreach types of microorganisms, first, in labo ratory conditions and then in pure cultures have led to the creation of extensive collections and, finally, to the understanding of the major role of microorganisms in the biosphere. However, over the past 20 years, the ide * Elizaveta Aleksandrovna BonchOsmolovskaya, Dr. Sci. (Biol.), is a deputy director of the Vinogradskii Institute of Microbiol ogy, RAS. Nikolai Viktorovich Ravin, Dr. Sci. (Biol.), is a dep uty director of the RAS Bioengineering Center.

ology of culture approach had to face very serious challenges. BIOMOLECULAR METHODS IN MICROORGANISM TAXONOMY AND ECOLOGY The establishment of DNA’s role as hereditary material and the development of molecular biology in the mid20th century opened trends in microbiology that were based on the concept that all properties of an organism are “coded” by its genome. The first funda mentally important result of using molecular tech niques in microbiology was the creation in the late 1970s by C. Woese of a single phylogenetic system of prokaryotes based on the comparison of the 16S gene sequences of ribosomal RNA—conservative genome sections that all microorganisms have. Alongside bio chemical data, the results of the 16S pRNA analysis did become the decisive argument in favor of archaea forming the third domain of living organisms together with bacteria and eukaryotes. Then the databases of nucleotide sequences started to be rapidly replenished, and soon relevant biomolec ular methods were also applied to DNA, separated from natural communities, and here the culture approach suffered the first sensitive blow. It turned out that the overwhelming majority of microorganisms whose 16S pRNA genes are present in natural com munities do not have cultured relatives; some of them are deep phylogenetic branches; consequently, we cannot assess either their metabolism or their func tions in natural communities. Moreover, unknown prokaryotes often turned out to be most significant quantitatively, i.e., predetermined biogeochemical processes within the ecosystem under study, but which prokaryotes? How can we understand them without their “domesticated” pure cultures in hand? This cen tral problem of microbial ecology is successfully solved using various approaches. However, the subject of this

491

492

BONCHOSMOLOVSKAYA, RAVIN

Genomic DNA of a microorganism

(a)

(b)

a set of “accidental” fragments 500–800 nt long (random library)

(c)

(d)

A GT T A A C A C GT A GG C

sulfure lase luciferase

APS ATP

PPi

luciferin

light + oxyluciferin (e) CCTTCCAGGGTTTAGCT GGTTTAGCTCCCGTTAATG GGATCCCCTTOCAGGGT CGTTAATGGGGCTAGTAGGCTTTA

(f) GGATCCCCTTCCAGGGTTTAGCTCCCGTTAATGGGGCTAGTAGGCTTTA

(g) 1

2

3

4

5

6

7

8

9

10

Fig. 1. The methodology of identifying the nucleotide sequence of the microorganism genome. (a) The “accidental” fragmentation of genomic DNA to 500–800 nucleotides; (b) binding individual molecules to conducting microparticles, the clonal amplification of molecules with the help of PCR in waterinoil emulsions; (c) applying microparticles with amplified DNA to the wells of a picotiter plate, whose number is several hundreds of thousands; (d) pyrosequencing DNA sequences in each well on genome analyzer GS FLX (Roche) (the insert shows the principal diagram of the pyrosequencing tech nique, in which the incorporation of a complementary nucleotide into the synthesizing DNA chain is accompanied by light emis sion); (e) determining the nucleotide sequences of DNA fragments that are being sequenced in each well. The average “read” length of one reaction is about 400 nucleotides (for convenience, shorter sequences are shown); (f) “assembling” the sequences of lengthy contigs (optimally, the whole genome) from a set of overlapping sequences of individual fragments; and (g) “annotat ing” the genome, or identifying individual genes and predicting their functions by bioinformatics methods.

publication is analysis of the full genomes of microor ganisms, which delivered a fatal blow to the prevailing system of their characterization with the help of cul ture techniques. This assertion does not at all negate the culture techniques—it is still the only way to obtain the preparative DNA quantities of one organ

ism. We are going to compare the culture techniques with genomic analysis as tools that characterize the properties of new organisms and explain the role of the organisms under study in nature. Genome sequencing methods have been improving for the past 30 years (Fig. 1), resulting in productivity

HERALD OF THE RUSSIAN ACADEMY OF SCIENCES

Vol. 80

No. 6

2010

ANALYSIS OF FULL GENOMES

and speed growth and cost reduction. The number of sequenced full prokaryotic genomes exceeds 1000 now, and this number is changing every day. Simulta neously, the databases are improved and extended, as well as computer programs that help systematize and analyze the continuous and immense inflow of infor mation. Biologists of various specialties, including microbiologists, obtain access to critical data that allow them to interpret anew the previous research experience. We will try to illustrate the above with sev eral thermophilic microorganisms obtained at the lab oratory of hyperthermophilic microbial communities of the RAS Institute of Microbiology (INMI) from land, marine, and underground thermal habitats. THERMOPHILIC MICROORGANISMS Moderate thermophilic organisms, which grow at 50–60°C, have been known since the early 20th cen tury. They are usual components of many microbial communities and acquire their growth advantages at temporary increases in temperature (for example, dur ing composting). However, only in the 1970s, T.D. Brock [1] found that hot springs of volcanic ori gin are populated with microorganisms that grow at much higher temperatures (70°C and higher); these microorganisms were termed extreme thermophiles. Hyperthermophilic, i.e., living at temperatures above 80°C, microorganisms were discovered in the early 1980s by the German microbiologists W. Zillig and K. Stetter. Hyperthermophiles abundantly inhabit land and underwater hot springs, including the so called black smokers—seafloor hydrothermal vents where water temperatures greatly exceed the boiling point [2]. (Note that the remarkable Russian microbiol ogist S.I. Kuznetsov registered microbial life in high temperature springs of Kamchatka back in the 1950s; however, this observation was not followed by laboratory cultivation; consequently, information on hightem perature microbes was limited to their morphology.) The study of the 16S pRNA genes allowed us to place the main part of hyperthermophiles in a separate domain of Archaea, which implies their early evolu tionary origin; among archaea, many hyperthermo philes also form separate and early isolated phyloge netic branches. The RAS Institute of Microbiology started the search for new hyperthermophiles in the mid1980s under the leadership of G.A. Zavarzin. Thus, the INMI microbiologists found themselves among the first groups of researchers and by now have a representative collection of proprietary hyperther mophilic strains. The majority of them was obtained from hightemperature springs of Kamchatka; how ever, the collection has organisms isolated from deep water black smokers during international expeditions [3, 4], as well as hyperthermophilic microorganisms from an underground thermal habitat—the hightem perature oil deposit Samotlor in Western Siberia [5]. The INMI collection became the object of Russia’s HERALD OF THE RUSSIAN ACADEMY OF SCIENCES

493

first largescale research into full genome sequences of prokaryotes. SEQUENCING FULL GENOMES OF HYPERTHERMOPHILIC ARCHAEA Why were hyperthermophilic archaea chosen? First, for the same reasons for which this group has been so actively studied over the past decades: their extremely thermostable enzymes can find applica tion in biotechnology, while their ancient origin and isolated position in the phylogenetic system prom ises new significant results in basic microbiology, including evolutionary microbiology. Out of more than 1000 prokaryotic genomes sequenced through out the world to date, only 66 belong to archaea; however, 42 of them are hyperthermophiles. As for practical application, the genomes of hyperthermo philic archaea differ by very small sizes, almost the smallest among free living microorganisms: their size usually equals 1.5–2 million base pairs, while the usual size of the genomes of free living bacteria is 3–4 mil lion base pairs. This was important for the first experi ments, because the prokaryotic DNA chain has a ring structure and the genome is considered to be read only when the obtained sequence is closed in a ring. The shorter the genome, the easier it is to do. The project of sequencing genomes of hyperthermophilic archaea was supported by the Russian Federal Agency for Sci ence and Innovation and implemented by the RAS Bioengineering Center jointly with INMI in 2008– 2009. Before these institutes cooperated successfully in identifying the phylogenetic position of new micro organisms isolated at INMI, the sequencing of full genomes was absolutely different in scale and objec tives: we wanted to glean information about all genes in the organism under research. Selecting organisms for this research, we were guided by the following principles: these should be our own isolates, representing new taxa and possibly of a higher rank; among the known genera, priority was given to those whose genomes had not yet been sequenced; and, finally, we sought the maximal diver sity of metabolic patterns and localizations of the organisms under study. We selected organisms that in their majority repre sented new taxa, not only new species but in two cases new genera, families, and orders (Table 1). They all develop in the absence of oxygen; i.e., they are anaer obes, the majority of them use organic substrates, but there are also two lithoautotrophs that use hydrogen to reduce iron oxide. The majority of organisms were iso lated from Kamchatka’s hot springs. Exceptions are Geoglobus acetivorans, a hyperthermophilic archaeon, isolated from deepwater hydrothermal vents, and Thermococcus sibiricus, which inhabits the Samotlor stratal waters in Western Siberia. Vol. 80

No. 6

2010

494

BONCHOSMOLOVSKAYA, RAVIN

Table 1. Hyperthermophilic archaea whose full genome sequences were identified at the RAS Bioengineering Center Name

Localization

Metabolic pattern Organotroph, proteolytic

Notes

Desulfurococcus kamchatkensis1 Thermococcus sibiricus1 Acidilobus saccharovorans2 Fervidococcus fontis2 Geoglobus acetivorans2

Kamchatka’s hot spring

Kamchatka’s hot spring Hydrothermal vents of the MidAtlantic Ridge

Organotroph Uses hydrogen and fatty acids to reduce iron

Thermoproteus uzoniensis2 Vulcanisaeta moutnovskia2 Thermofilum carboxydotropha2 Strain 1633

Kamchatka’s hot spring

Sulfurreducing organotroph

New order, widespread Obligatory iron reducer, a wide range of organic substrates, including unfermentable ones Very widespread on Kamchatka

Kamchatka’s hot spring

Sulfatereducing organotroph

Grows at temperatures up to 102°C

Kamchatka’s hot spring

Pyrobaculum sp.2 Caldispaera sp.3

Kamchatka’s hot spring Kamchatka’s hot spring

Grows on CO oxidation releasing hydrogen from water Organotroph, good growth on cellulose Uses hydrogen to reduce iron Organotroph, thermoacidophile

First hydrogengenic carboxydot roph among Crenarchaeota Possibly, represents a new genus of Crenarchaeota Capable of organotrophic growth Mass form (acidic sulfur springs)

Hightemperature oil Organotroph, substrates—pep deposit in Western Siberia tides, lipids, and polysaccharides Kamchatka’s hot spring Organotroph, thermoacidophile

Kamchatka’s hot spring

Decomposes stable proteins (kera tins) Inhabits a wide underground area (Siberia, China, Japan) New order, mass form

Notes: 1 The genome was read, closed, annotated, and published. 2 The genome was read, closed, and annotated. 3 The genome was read.

The sequencing of so many microbial genomes in such a short time was possible due to the stateofthe art method of parallel pyrosequencing on genome analyzer 454 GS FLX (Roche). Fragmented into sec tions of 200–800 nucleotides in length, a genome DNA was read with multiple overlaps, which allowed us to bind these fragments with the help of special computer programs, first, into sequences of a larger size and then to close the chromosome completely. We were able to close 10 out of 11 genomes under research, and, hence, on their basis, it was possible to study all properties of the organism with full charac terization of its metabolism. We were unable to put the 11th genome of an archaeon that belonged to the Caldisphaera genus into a single chain due to a large number of recurring sequences. This genome repre sents 50 contigs, which can still be used to seek specific genes or metabolic pathways. The analysis of ten genomes assumed the general characteristic of a genome; the identification of genes and the prediction of their functions through bioinformatics methods; the reconstruction of the main metabolic pathways; and the identification of genes that code enzymes that transport substances into the cell, protective mecha nisms, etc. The comparative analysis of the obtained genome with the one already sequenced makes it pos sible to identify the characteristics of a given phylum and, vice versa, similar traits in distant relatives, assume a possible horizontal transfer of individual

genes or gene groups from one taxon to another, and identify enzymes with valuable biotechnological prop erties. Many of the revealed functions need experi mental verification; thus, the research relays back to classical microbiologists with their traditional culture approach and to biochemists. Here the most remark able in terms of microbiology events happen: for some genes, we were unable to verify the relevant biochemi cal function or physiological character, and, for other characters, on the contrary, the necessary genes were absent. For detailed illustration of this, let us take three already read genomes of hyperthermophilic archaea from our list. Desulfurococcus kamchatkensis was isolated from the Uzon hot spring caldera, Kamchatka, and it grows at temperatures of 65–92°C, the optimum being 82°C in the total absence of oxygen (Fig. 2) [6]. Its sub strates are various proteins, including those resistant to the majority of proteases, such as alpha keratins (the main proteins of human hair and animal wool). D. kamchatkensis has a genome of 1.37 million base pairs [7]. Its analysis showed the presence of more than 30 genes that code endo and exopeptidases (enzymes that hydrolyze proteins), which belong to different classes; at least five of them had signal pep tides that indicated the extracellular nature of these enzymes. Two peptidases coincide in their molecular mass with those earlier identified in the D. kamchat kensis culture with its growth on alpha keratin; i.e.,

HERALD OF THE RUSSIAN ACADEMY OF SCIENCES

Vol. 80

No. 6

2010

ANALYSIS OF FULL GENOMES

495

they are most probably keratinase active. In the D. kamchatkensis genome, we also discovered genes that also code other hydrolytic enzymes, such as amy lases, pullulanases, and endoglucanases, as well as genes that code monomer transporters and the main pathways of intracellular metabolism of carbohydrates and amino acids. This genome was the first fully read genome of the Desulfurococcus genus of archaea, which is widespread in land hot springs all over the world. The following genomes gave us even more sur prises. Thermococcus sibiricus inhabits the stratal waters of oilbearing horizons in the Jurassic sediments of the Samotlor oil deposit [7] at a depth of 1800 m and at a temperature of –85°C, i.e., at the temperature opti mum for this group of hyperthermophilic archaea. Other parameters of this habitat—pH 6.5, salinity similar to marine salinity—also correspond to the liv ing conditions of other representatives of the Thermo coccus genus, found in marine shallow and deepwater hydrothermal vents (more than 20 species are known now). The surprising point is that the phenotype of our organism differs little from that of its counterparts that live in hydrothermal vents. In addition, organisms that belong to the same T. sibiricus species were registered both in three different oil wells of the Samotlor field and in samples from deep oil deposits in China and Japan; i.e., this species is abundant deep under the surface within a large Asian area. How do the “under ground thermococci” differ? The T. sibiricus genome, although larger than D. kamchatkensis, is still small, 1.85 million base pairs [8]. The analysis of T. sibiricus identified significant differences between the primary description of the species by cultural characters and the metabolic possi bilities inherent in the genome. T. sibiricus was described as an organism that uses peptides. However, in the genome, we found a “polysaccharide island”— a cluster of genes that are localized in one section of the genome, and these code enzymes that destroy var ious polysaccharides: cellulose, starch, laminarin, and agarose. We also discovered the genes of extracellular lipase. On the basis of this information, we conducted new growth tests. The growth of T. sibiricus needs the presence of small amounts of yeast extract as a source of unidentified growth factors; in addition, yeast extract itself can serve as a growth substrate. We com pared the growth of T. sibiricus in a medium with the tested substrate and its growth in the same medium but without the substrate, i.e., only at the expense of yeast extract in it. We tested all substrates revealed by the genomic data in this way. It turned out that growth, although weak, was observable almost in all cases, and it was distinguishable from the background medium. What does this mean? This means that the primary test of an organism’s capacity to use various substrates, which was conducted under standard conditions and was only aimed at good growth with high division rates HERALD OF THE RUSSIAN ACADEMY OF SCIENCES

1 µm Fig. 2. Electronic microphotograph of cells of Desulfuro coccus kamchatkensis.

and cell yields, provided us with a very limited charac teristic of its catalytic properties. In a natural habitat, where the medium may have all the necessary growth factors in microamounts, an organism can perform functions totally different from what we observe during active growth under laboratory conditions. Table 2 shows the properties of T. sibiricus discovered during its primary microbiological description, genome anal ysis data, and the results of growth tests based on this analysis. It is indeed unlikely that peptides serve as Table 2. T. sibiricus growth on substrates predicted by the genome analysis results Cell yield in ml

Substrate Without substrate (back ground content of yeast extract was 60 mg/l) Peptone Starch Maltose Dextran Amorphous cellulose Carboxymethyl cellulose Microcrystalline cellulose Cellulose Agarose Chitin Xylan Olive oil Glycerin Linolenate Na Palmitate Na Vol. 80

No. 6

2010

Presence of appropriate gene in genome

1.41 × 107 4.60 × 108 1.63 × 107 3.52 × 107 3.31 × 107 3.25 × 107 2.60 × 107 1.73 × 107 2.90 × 107 3.92 × 107 1.24 × 107 1.12 × 107 3.68 × 107 3.39 × 107 0.81 × 107 0.67 × 107

+ – + + + + – + + – – + + – –

496

BONCHOSMOLOVSKAYA, RAVIN

growth substrates for T. sibiricus in Jurassic sediments. However, the capacity to grow on agarose, laminarin, and other polysaccharides can support the growth of this organism on the organic matter of algae buried in the sediments of the ancient sea. Weak growth on these substrates is probably due to the inadequacy of our methods of cultivation (the absence of the necessary growth factors in the medium used, and these growth factors come in together with peptone, when it is used as an energy substrate). Acidilobus saccharovorans is the third species of the Acidilobus genus, which we described earlier [9]. In addition to the typical species Acidilobus aceticus, which we isolated from the Kamchatka hot springs, another representative of this genus was obtained from the hot springs of the Yellowstone National Part in the United States. Being hyperthermophiles, these organ isms are also acidophiles, which develop optimally at pH 3.5. Their population in the Yellowstone hot springs with a low pH was rather high, which indicates their active role in these ecosystems. The representa tives of the Acidilobus genus are distant from the rest of hyperthermophilic archaea and represent the new order Acidilobales in the phylum Crenarchaeota [10]. However, their growth in laboratory conditions was so poor (in our experiments, as well as in the American experiments) that it is very hard to say anything defi nite about metabolism. We can only say that these are anaerobes and organotrophs, which use organic sub stances; elemental sulfur stimulates their growth. The latter property is widespread among hyperthermo philic archaea; sulfur is often used only to release elec trons freed during the fermentation of organic sub strates. So, what does Acidilobus do—fermentation or breathing? What is its role in the microbial communi ties of hot springs with low pH values? The analysis of the genome allowed us to answer these questions. The variety of metabolic properties that we discov ered does not at all correspond to the weak and unsta ble growth of Acidilobus in laboratory cultures. It has a set of different hydrolases: proteinases, glycosidases, and lipases. Monosaccharides, which appear during the hydrolysis of polysaccharides, can be utilized in either of the two pathways of central metabolism that A. saccharovorans has: Embden–Meyerhof and Ent ner–Doudoroff. Unlike T. sibiricus, which also has lipases but cannot oxidize fatty acids (only glycerin could be its substrate during growth on lipids), A. sac charovorans has a full set of enzymes for the cycle of beta oxidation of fatty acids and, consequently, can also use fatty acids, which are formed during the hydrolysis of lipids. Finally, all enzymes of the tricar boxylic acid cycle and the chain of electron transport on sulfur were discovered in this organism; i.e., it can breathe anaerobically and fully oxidize organic matter to CO2. The diverse mechanisms of catabolic exchange of A. saccharovorans are comparable only with the representatives of the order Thermoproteales,

which also fully decompose complex organic sub strates to CO2 by reducing elemental sulfur. Thus, the representatives of these two orders are responsible for the mineralization of organic matter, closing the anaerobic cycle of carbon in hightemper ature land springs: Thermoproteales, in neutral, and Acidilobales, in acidic. Here we see the principal dif ference of hydrothermal microbial communities from the rest of the known microbial communities that anaerobically destroy organic matter. Under meso phyllic conditions, this process needs the presence of a multicomponent community: hydrolytic enzymes; fermenters; syntrophic microflora, which oxidizes fer mentation products; and, finally, organisms with vari ous types of anaerobic breathing that take part in ter minal oxidation–reduction reactions. In hydrother mal vents, all this complex chain of processes takes place in a cell of a single organism, which has a very small, compared to mesophylls, genome. Why? What is the evolutionary meaning of these differences? We are still to find answers to these questions. The enzymes of hyperthermophilic organisms have many advantages in terms of their possible use in bio technology. A wellknown example is thermostable polymerases, primarily Taq polymerase, which greatly simplified and cheapened the polymerase chain reac tion, making it a routine technique, which, in turn, pushed forward the application of biomolecular meth ods in various spheres of human activity. Another example is thermostable hydrolases, which are widely used in the food, textile, and pulpandpaper indus tries to produce detergents and feeds, and the demand for them is far from being met. High temperatures increase the speed of processes and reduce the risk of contamination; thermostability usually correlates with stability against other environmental factors, for example, pH or the presence of organic solvents. An obstacle to the study and use of enzymes from hyper thermophiles is a very poor growth of these organisms, which does not produce preparative amounts of pro tein for purification and analysis. Analysis of the full genome sequences of new hyperthermophilic micro organisms allows us to identify genes that code new thermostable enzymes, clone them in E. coli, and express and produce them in the necessary amounts. Thus we simplify the cleaning procedure for thermo stable proteins, which are easily separated from the thermolabile proteins of the host bacterium. In the genomes of the new hyperthermophilic archaea that we sequenced, we found a large amount of genes that code new thermostable hydrolases, such as protein ases, glycosidases, and lipases. CULTURE AND GENOME TECHNIQUES: OPPOSITION OR ALLIANCE? At first sight, the successes of applying biomolecu lar methods to microbiological objects, both natural

HERALD OF THE RUSSIAN ACADEMY OF SCIENCES

Vol. 80

No. 6

2010

ANALYSIS OF FULL GENOMES

microbial communities and pure cultures of microor ganisms, have shown the limitedness of culture tech niques. Not all microorganisms can be produced in laboratory cultures. Those that are cultivated do not fully reveal their properties; consequently, their eco logical function may be interpreted in the wrong way. Nevertheless, the identification of the full genome sequence of a microorganism is possible only if we have a pure culture, which consists of cells with abso lutely identical DNA copies. Of course, it is possible to sequence a DNA obtained from a mixture of microor ganisms, then sort individual contigs by type, and, finally, close the genomes. However, although there is hope for success in “sorting” a simple mixture of sev eral types, for natural communities, it is practically impossible. The socalled metagenomics—the sequencing and analysis of a microbial DNA isolated from natural sources—solves other problems; prima rily, it seeks new functional genes. It also helps find new metabolic pathways typical of noncultivated microorganisms and, no doubt, will develop at a grow ing rate, setting the direction for future cultivation attempts. However, a pure culture in the hands of a researcher immediately opens up great opportunities, including the identification of the full genome of a new organism and the experimental verification of assump tions built on its analysis. Remember also that of true interest is research into new microorganisms, new enzymes, and new metabolic pathways. Since we can soundly predict the function of a very limited number of genes, for the majority of them, it would be just an assumption to be verified either by studying the wild strain or by cloning and expressing the gene under study. Thus, culture techniques are necessary to verify the results of genome analysis, but genomics data may also be used to improve culture techniques and to characterize an organism more fully. Let us hope that microbiology, remaining a classical organismic sci ence, will somehow reach a second circuit in its devel opment.

HERALD OF THE RUSSIAN ACADEMY OF SCIENCES

497

REFERENCES 1. T. D. Brock, Thermophilic Microorganisms and Life at High Temperatures (Springer, New York, 1978). 2. K. O. Stetter, “Hyperthermophilic Prokaryotes,” FEMS Microbiol. Rev. 18, 149 (1996). 3. E. A. BonchOsmolovskaya, “Studies of Thermophilic Microorganisms at the Institute of Microbiology, Rus sian Academy of Sciences,” Mikrobiol. 73, 644 (2004) [Microbiol. 73, 551 (2004)]. 4. M. L. Miroshnichenko and E. A. BonchOsmolovskaya, “Recent Developments in the Thermophilic Microbi ology of DeepSea Hydrothermal Vents,” Extremo philes 10, 85 (2006). 5. M. L. Miroshnichenko, H. Hippe, E. Stackebrandt, et al., “Isolation of Hyperthermophilic Archaea in Western Siberia High Temperature Oil Reservoir and Characterization of Thermococcus Sibiricus Sp. Nov.,” Extremophiles 5, 85 (2001). 6. I. V. Kublanov, S. Kh. Bidjieva, A. V. Mardanov, et al., “Desulfurococcus Kamchatkensis Sp. Nov., a Novel Hyperthermophilic ProteinDegrading Archaeon, Iso lated from Kamchatka Hot Spring,” Int. J. Syst. Evol. Microbiol. 59, 1743 (2009). 7. N. V. Ravin, A. V. Mardanov, A. V. Beletsky, et al., “Complete Genome Sequence of Anaerobic, Protein Degrading Hyperthermophilic Crenarchaeon Desulfu rococcus Kamchatkensis,” J. Bacteriol. 191, 2371 (2009). 8. A. V. Mardanov, N. V. Ravin, V. A. Svetlichny, A. V. Be letsky, et al., “The Genome of Archaeon Thermococcus Sibiricus Indicates Its Metabolic Versatility and Indige nous Origin,” Appl. Environ. Microbiol. 75, 4580 (2009). 9. M. I. Prokofeva, M. L. Miroshnichenko, N. A. Kos trikina, et al., “Acidilobus Aceticus Gen. Nov. and Sp. Nov., a New Acidophilic Anaerobic Hyperthermo philic Archaeon from Continental Hot Vents of Kam chatka,” Int. J. Syst. Evol. Bacteriol. 50, 2001 (2000). 10. M. I. Prokofeva, N. A. Kostrikina, N. A. Kolganova, et al., “Isolation of the Anaerobic Thermoacidophilic Crenarchaeote Acidilobus Saccharovorans Sp. Nov. and Proposal of Acidilobales Ord. Nov., Including Acidilo baceae Fam. Nov. and Caldisphaeraceae Fam. Nov.,” Int. J. Syst. Evol. Microbiol. 59, 3116 (2009).

Vol. 80

No. 6

2010