Tumor Biol. DOI 10.1007/s13277-016-4860-1

ORIGINAL ARTICLE

Bone marrow stromal cells induced activation of nuclear factor κB signaling protects non-Hodgkin’s B lymphoma cells from apoptosis Tuo Su 1 & Jiakai Li 2 & Mingming Meng 3 & Sheng Zhao 4 & Yali Xu 5 & Xinmin Ding 5 & Hong Jiang 5 & Xiaorong Ma 5 & Jin Qian 5 & Wei Han 1 & Lixin Sun 1 & Xiaobin Li 1 & Zuojun Liu 1 & Lei Pan 5 & Xinying Xue 5

Received: 12 November 2015 / Accepted: 13 January 2016 # International Society of Oncology and BioMarkers (ISOBM) 2016

Abstract The microenvironment encompassing a variety of non-malignant cells in close proximity with malignant tumor cells has been well known to significantly affect the behavior of tumor cells. In this study, we therefore studied the mechanism of bone marrow stromal cells in protection of lymphoma cells from spontaneous apoptosis. We demonstrated that adhesion of the freshly isolated lymphoma B cells to bone marrow stromal cells or freshly isolated lymphoma stromal cells inhibited B cell spontaneous apoptosis in culture. This inhibition of apoptosis correlated with decreased cleavage of caspase-3/8 and increased activation of canonical and non-canonical NF-κB signaling pathway. In

addition to BAFF signaling which has been reported as a functional determinant for B lymphoma cell survival in the bone marrow environment, we demonstrated RANKL from BMSCs works synergistically with BAFF to activate NF-κB signaling pathway and thus protects lymphoma B cells from spontaneous apoptosis. Keywords Bone marrow stromal cells . Nuclear factor κB signaling . Non-Hodgkin’s B lymphoma cells . Apoptosis

Introduction Tuo Su, Jiakai Li, Mingming Meng and Sheng Zhao contributed equally to this work. Xinying Xue, Lei Pan and Zuojun Liu are juxtaposed Corresponding Author * * Zuojun XinyingLiu Xue [email protected] [email protected] * * Lei Lei Pan Pan [email protected] [email protected] * Xue * Xinying Zuojun Liu [email protected] [email protected] 1

Department of General Surgery, Beijing Luhe Hospital, Capital Medical University, Beijing, China

2

Department of Radiology of Chinese PLA General Hospital, Beijing, China

3

Department of Gastroenterology, Beijing Shijitan Hospital, Capital Medical University, Beijing, China

4

Department of Cardiology, Peking University Ninth School of Clinical Medicine, Beijing Shijitan Hospital, Beijing, China

5

Department of Special Medical Treatment, Beijing Shijitan Hospital, Capital Medical University, 10 Tieyi Road, Yangfang District, Beijing, China

Lymphoma is a group of blood cell tumors and solid tumor of digestive tract and lung that develop from lymphocytes with 95 % from B cell origin and the rest from T cell origin [1]. There are two main types of lymphomas including 10 % of Hodgkin’s lymphoma and 90 % of non-Hodgkin lymphoma. Lymphomas have a wide range of histological features and clinical behaviors, about 15 subtypes of B-cell lymphoma being distinguished in the current World Health Organization lymphoma classification [1]. Most B-cell lymphomas are derived from germinal center (GC) B cells or from B cells that have passed through the GC. The B-cell lymphoma subtypes can be distinguished by traditional clinical and pathological methods [2], and currently, the genetic gene expression profiling [3]. The detailed characterization of particular structure of B-cell receptor and gene expression patterns of differentiation markers classified various human B-cell lymphomas originating from distinct stages of B cell development [4]. The mechanisms that drive B-cell lymphomas are often reminiscent of signaling pathways in normal B cell

Tumor Biol.

development. This is accomplished through mutations that activate signaling effectors or inactivate negative regulators especially in antiapoptotic NF-κB signaling pathway [5]. The NF-κB pathways mediate signaling transduction from numerous receptors, including the BCR, CD40, the B cellactivating factor (BAFF) receptor, and various Toll-like receptors for antigens, cytokines, and chemokines, to induce cell proliferation, survival, and differentiation. Many subtypes of lymphoid malignancies such as ABC DLBCL, HL, PMBL, gastric MALT lymphoma, and multiple myeloma have been associated with aberrant NF-κB activation [5]. Mutation or deletion inactivation of IKBKA [6] (encodes IκBα) and TNFAIP3 [7–10] (encodes NF-κB inhibitor A20) in several lymphoma cases represents the mechanism that activates NF-κB signaling through inactivating negative regulators. In another instance, somatic mutation in the coiled-coil domain of CARD11 in ABC DLBCL [11] and translocation that fuses N terminus of c-IAP2 to the C terminus of MALT1 [12] can constitutively activate NF-κB signaling. BCR signaling contributes a lot to NF-κB activation especially in viral or bacterial associated lymphomas [13] and ABC DLBCL [14]. In addition, aberrant activity of transcriptional regulators such as Bcl6 [15, 16], Blimp-1 [17–19], and IRF4 [20–22] are demonstrated to be associated with many subtypes of lymphomas. The presence in a tumor mass of non-malignant cells located in close proximity with malignant tumor cells has been well known. The complex components including endothelial cells, fibroblasts, myoepithelial cells, pericytes, and inflammatory cells, present within the tumor stroma, constitute a microenvironment that significantly affects the behavior of malignant tumor cells. The secreted signaling adaptor proteins, proteases, and the extracellular matrix from this microenvironment ultimately influence tumor cell behaviors such as proliferation, survival, metastasis, and drug resistance [23]. The microenvironment of B-cell lymphoma can support the proliferation and survival of malignant B cells that is illustrated by the finding that the survival of patients with follicular lymphoma correlated with the molecular features of non-malignant cells [24, 25]. BAFF, a member of the TNF superfamily of cytokines that is well known to promote B cell proliferation, activation, differentiation, and survival [26], is found to be secreted by bone marrow stromal cells (BMSCs) and promote lymphoma B cell survival and drug resistance [27]. In this study, we demonstrated that the expression of receptor activator of nuclear factor kappa-B ligand (RANKL) by bone marrow stromal cells and the activation of NF-κB signaling promote lymphoma B cell survival. Furthermore, we also found that in addition to blockade of BAFF, combined blockade of BAFF and RANKL can further synergistically attenuate BMSC-induced lymphoma B cell survival.

Materials and methods Cells and cell cultures hBMSC, mBMSC, LSC, and HS-5 were cultured in DMEM supplemented with 10 % fetal bovine serum and antibiotics. Before coculture, hBMSC, mBMSC, and LSC were seeded in 12-well plate and cultured for 2 days until full confluency; 2 × 104 Fico/Lite (Atlanta Biologicals) isolated lymphoma B cells (from stomach lymphoma) were added and continuously cultured with or without rRANK-Fc (100 ng/ml; R&D Systems Inc.) or TACI-Ig (500 ng/ml) for 2 or 4 days. Real-time PCR Lymphoma stromal cells, hBMSC, lymphoma B cell/hBMSC cocultures, and fresh isolated lymphoma B cells were snap frozen and stored at −80 °C. Total RNA was isolated using RNeasy Mini Kit (Qiagen). First-strand cDNA was synthesized from 0.5-μg RNA using random primers and the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). One microliter of cDNA was used per 20-μL reverse transcriptase reaction, and primers used for specific gene amplification were listed in Table 1. The reaction was carried out using the LightCycler FastStart DNA Master SYBR Green I kit (Roche) according to manufacturer’s instructions. Each sample was measured in triplicate. The amplification was determined by plotting against the threshold concentration. The target gene copy number was standardized relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The specificity of the amplification was controlled by analysis of the melting curve analysis and crossing point. No amplification of non-specific products was observed. RNA interference The synthesized siRNA sequences were used to target specific genes (Table 2). hBMSCs were plated onto 60-mm dishes and cultured in DMEM without antibiotics 24 h before siRNA transformation. Cells were transfected with RANKL siRNA, BAFF siRNA, or scrambled control siRNA using Lipofectamine 2000 (Invitrogen) according to the instructions of the manufacturer and continually cultured for 48 h. Cells were then harvested for analyses of RANKL, BAFF expression by western blot. Western blot Protein concentration was measured using a BCA Protein Assay kit (The Thermo Scientific Pierce). Total protein (20-μg) was loaded onto a 10 % SDS-PAGE gel and transferred onto nitrocellulose membranes. After blocking with 5 % non-fat milk for 1 h, membranes were incubated with

Tumor Biol. Table 1

The primers used for specific gene amplification

Human RANKL F: ACATATCGTTGGATCACAGCACAT R: CAAAAGGCTGAGCTTCAAGCTT Human RANK F: ATGCGGTTTGCAGTTCTTCTC R: ACTCCTTATCTCCACTTAGG Human BAFF F: ATGCAGAAAGGCAGAAAGGA R: AGGCAAGAAGTAAGGCGTGA Human BAFF-R F: AGACAAGGACGCCCCAGAGCCC R: GTGGGGTGGTTCCTGGGTCTTC Human RelA F: CCAGACCAACAACAACCCCT R: TCACTCGGCAGATCTTGAGC Human RelB F: TCCCAACCAGGATGTCTAGC R: AGCCATGTCCCTTTTCCTCT Human Bcl-xL F: GATCCCCATGGCAGCAGTAAAGCAAG R: CCCCATCCCGGAAGAGTTCATTCACT Human Cyclin D1 F: TGTTCGTGGCCTCTAAGATGAAG R: AGGTTCCACTTGAGCTTGTTCAC Human GAPDH F: ACCCACTCCTCCACCTTTGA R: CTGTTGCTGTAGCCAAATTCGT

primary antibody overnight at 4 °C and subsequently incubated with HRP-labeled secondary antibody (1:2000 dilution) for 2 h at room temperature. Reactive proteins were detected using chemiluminescent reagents (Pierce, Rockford, IL, USA). GAPDH was used as control for loading efficiency. Flow cytometry When doing FACs experiments, we used anti-human CD19 antibody to separate the B lymphoma cells from stromal cells. Lymphoma B cells after coculture were harvested to analyze cell apoptosis. Briefly, wash cells twice with cold PBS and then resuspend cells in 1× binding buffer at a concentration of 1 × 106 cells/ml, and finally transfer 100 μl of the solution to a 1.5-ml new tube. Then, add 5 μl of PE Annexin V and 5 μl of Table 2 genes

The synthesized siRNA sequences were used to target specific

RANKL siRNA1: GGAUGGCUCAUGGUUAGAUTT RANKL siRNA2: GTGCAGAAATGGCGAGAATAC BAFF siRNA1: AAGGUUGCAGCCAGCAGCUUU BAFF siRNA2: ACAGCAGUGCCAGCAGCAAGGU

7-AAD, gently vortex the cells, and incubate for 15 min at RT (25 °C) in the dark. After that, add 400 μl of 1× binding buffer to each tube. Analyze by flow cytometry within 1 h. During coculture, the lymphoma cells actually adhered to the stromal cells. When using transwell chamber to separate the B lymphoma cells from stromal cells in our coculture system, there were more Annexin Vand/or 7-AAD positive B cells than that when B-lymphoma cells and stromal cells were cocultured together. However, there were still much less Annexin V and/or 7-AAD positive B cells compared with B lymphoma cells cultured alone. The samples were analyzed on a BD FACSCalibur machine with CellQuest acquisition software. Data analysis was done using FlowJo software. Statistical analysis Data were presented as mean ± standard deviation (SD) and analyzed using Statistical Product and Service Solutions. Differences between two groups were analyzed using Student’s t test. P < 0.05 was considered statistically significant.

Results NF-κB signaling is extensively activated in lymphoma B cells when cocultured with bone marrow stromal cells BMSCs have been demonstrated to promote B lymphoma cell survival by exerting their influence on lymphoma apoptosis, cell cycle progression, and lymphoma cell responses to drugs [27–29]. In our study, coculture of diffuse large lymphoma B cells with human BMSC significantly reduced cell spontaneous apoptosis from about 80 % when lymphoma B cells were cultured with no hBMSCs to about 20 % when lymphoma B cells were cocultured with hBMSCs (Fig. 1a). Furthermore, we freshly isolated B-cell lymphoma stromal cells (LSCs) from B-cell lymphoma mass and mouse bone marrow stromal cells (mBMSCs) from 7-week old C57 BL/6 mice. Coculture of lymphoma B cells with LSC, mBMSC, and a human BMSC line HS-5 for 2 days also showed the protective effects of stromal cells on lymphoma B cell survival in in vitro culture (Fig. 1b). And, the stromal cells still protected lymphoma B cells from apoptosis when nearly all lymphoma B cells in control culture underwent apoptosis or death (Fig. 1c). Comparison of gene global transcriptional changes of diffuse large B-cell lymphoma and normal lymph nodes identified abnormal NF-κB activation in lymphoma with increased expression of p65, p50, p52, and NF-κB target genes [30]. In consistent with previous study, we found that coculture of lymphoma B cells with hBMSC induced extensive RelA, RelB, and p52 protein level in lymphoma B cells compared with control lymphoma B cells (Fig. 1d). In addition,

Tumor Biol. Fig. 1 Adhesion of the freshly isolated lymphoma B cells to bone marrow stromal cells inhibited B cell spontaneous apoptosis in culture. a Freshly isolated lymphoma B cells in suspension (left) or in adhesion to the preestablished monolayer of hBMSC (right) were cultured for 2 days. The B lymphoma cells were collected stained for FITCAnnexin V and 7-AAD. b Frequencies of apoptotic B cell populations in 2-day culture and 4-day culture (c). *P < 0.05. Data represented as the means ± standard deviations of three independent experiments with at least three mice per group. d Immunoblot analysis of RelA, RelB, p52, Bcl xL, cyclin D1, cleaved casp-3, and cleaved casp8 in extracts of lymphoma B cells. GAPDH was used as a loading control

increased expression of Bcl-xL and decreased caspase-3 and caspase-8 cleavage in cocultured lymphoma B cells indicated increased B cell survival and decreased cell apoptosis (Fig. 1d). However, the expression of cyclin D1 remained unchanged (Fig. 1d). Together, these results indicated that coculture of lymphoma B cells with stromal cells significantly protected lymphoma B cells from apoptosis along with the activation of NF-κB in lymphoma B cells. Increased RANKL-RANK signaling transduction between BMSC and lymphoma B cells enhanced NF-κB activation in B cells by coculture The gene expression profiling of classical Hodgkin lymphoma identified upregulated RANK expression and association with treatment failure [31]. We hypothesized if RANK is also upregulated in lymphoma B cells after coculture and contributes to NF-κB activation. Firstly, we detected gene expression in lymphoma B cells, LSCs, and hBMSCs. As shown in Fig. 2a, the expression of BAFF and RANKL in LSC and hBMSC is much higher than that in lymphoma B cells. BAFF receptor (BAFF-R) and RNAK are expressed in lymphoma B cells, LSCs, and hBMSCs in high abundance, however, with no significant difference (Fig. 2a). We next examined whether the gene expression of lymphoma B cells and BMSC would change when lymphoma B cells are cocultured with BMSCs. As shown in Fig. 2b, the expression of BAFF and RANKL of BMSC were two to fourfold higher after coculture; similarly, the RANK expression of lymphoma B cells also increased twofold after coculture. However, BAFF-R remained unchanged after coculture

(Fig. 2b). In consistent with the results showed in Fig. 1d, the mRNA expression of RelA, RelB, and Bcl-xL in lymphoma B cells was significantly upregulated after coculture (Fig. 2c). BMSC-derived RANKL and BAFF work synergistically to protect lymphoma B cells from spontaneous apoptosis Aiming at providing direct evidence for specific role of RANKL-RANK signaling in protection of lymphoma B cell from apoptosis, we blocked the RANKL-RANK signaling by rRANK-Fc (a soluble fusion protein that can capture RANKL to blockade RANKL mediated signaling). On account of the functional activity of BAFF in induction of canonical and noncanonical NF-κB pathway [32] as well as the functional role of BAFF in protection of lymphoma B cells from apoptosis [27], we anticipated that RANKL and BAFF work synergistically to activate canonical and non-canonical NF-κB pathway and thus to protect lymphoma B cell from apoptosis. Thus, we blockade RANKL-RANK and BAFF-BAFF-R signaling by combined use of rRANK-Fc and TACI-Ig (transmembrane activator and calcium modulator cyclophilin ligand interactor), a soluble fusion protein that binds to BAFF and APRIL to inhibit their activity. As expected, neutralization of BAFF by TACI-Ig attenuated BMSC-mediated protection of lymphoma B cell from apoptosis, which was in consistent with previous report [27]. At the same time, blockade of RANKL by rRANK-Fc also attenuated BMSC-mediated protection of lymphoma B cell from apoptosis (Fig. 3a). It is worthy of note that neutralization of BAFF or RANKL respectively could partially rescue the lymphoma B cell apoptosis; however, combined blockade of BAFF

Tumor Biol.

Fig. 2 Increased RANKL and BAFF expression in BMSC after coculture. a Quantitative PCR of mRNA expression for RANKL, RANK, BAFF, and BAFF-R in freshly isolated lymphoma B cells, freshly isolated stromal cells, and human BMSC. GAPDH was used as a reference for data normalization. b Quantitative PCR of mRNA expression for RANKL, BAFF, BAFF-R, and RANK in human BMSC

after coculture. GAPDH was used as a reference for data normalization. c Quantitative PCR of mRNA expression for RelA, RelB, Bcl xl, and cyclin D1 in lymphoma B cells after coculture. GAPDH was used as a reference for data normalization. Bar graphs showed means ± standard deviations of at least three independent experiments. *P < 0.05

Fig. 3 Blockade BAFF and RANKL attenuated the roles of BMSC in protection of lymphoma B cells from apoptosis. a Frequencies of apoptotic B cell populations in 2-day coculture with hBMSC (upper) or freshly isolated lymphoma stromal cells (LSCs, lower) by treatment with TACI-Ig and/or RANK-Fc. *P < 0.05. Data represented as the means ± standard deviations of three independent experiments with at least

three mice per group. b Immunoblot analysis of RelA, RelB, p52, Bcl xL, cleaved casp-3, and cleaved casp-8 in extracts of lymphoma B cells. GAPDH was used as a loading control. c Nuclear extracts from cultured lymphoma B cells were analyzed for the p65 binding to the NF-κB double-stranded oligonucleotide using the NF-κB transcription factor ELISA assay kit

Tumor Biol.

and RANKL could fully counteract the protective roles of BMSC on lymphoma B cell survival (Fig. 3a). Similar results can be achieved using freshly isolated lymphoma stromal cells (Fig. 3a, lower graph). Furthermore, combined blockade of BAFF and RANKL decreased protein levels of RelA, RelB, p52, and Bcl-xL in cocultured lymphoma B cells which indicated attenuated NF-κB activation and cell survival (Fig. 3b). However, with increased cleavage of caspase-3 and caspase-8, it seems that combined blockade of BAFF and RANKL induced lymphoma B cell apoptosis (Fig. 3b). To confirm the transcription activity of NF-kB transcription factors, we detected the NFkB activities by NF-kB p50/p65 Transcription Factor Assay Kit (ab133128, Abcam) (Fig. 3c).

In addition, knockdown of RANKL and BAFF simultaneously could fully attenuate BMSC-mediated protective effects on lymphoma B cell survival (Fig. 4e). Taken together, these results indicated that BMSC derived RANKL and BAFF synergistically mediated NF-κB activation and subsequently promoted lymphoma B cell survival.

Discussion

To further confirm the effect of RANKL and BAFF in BMSC on protection of lymphoma B cell from apoptosis, we performed knockdown experiments by siRNA to interfere RANKL and BAFF expression. As shown in Fig. 4a, b, siRNA specific to RANKL and BAFF reduced protein level in BMSC 2 days after transfection. Knockdown of RANKL (Fig. 4c) and BAFF (Fig. 4d) significantly attenuated BMSCmediated protective effects on lymphoma B cell survival.

In the previous study, the tumor microenvironment is well recognized to participate in many aspects of human cancer including solid tumors and hematologic malignancies. In B-cell lymphoma, the cancer-associated stromal cells and the secreted factors and/or adhesive extracellular matrix that they produce contribute significantly to tumor cell proliferation, metastasis, and drug resistance. Therefore, targeting the tumor microenvironment constitutes a treatment option to bypass cancer cells’ intrinsic drug resistance. Here, we reported that the induction of RANKL in bone marrow stromal cells is required for the survival of lymphoma B cells. Previous studies have demonstrated the function of RANKL-RANK signaling in normal B cell maturation and lymph node development. RANK deficiency in mice exhibited a marked deficiency of B cells in the spleen and complete lack of

Fig. 4 Knockdown of BAFF and RANKL by siRNAs attenuated the roles of BMSC in protection of lymphoma B cells from apoptosis. a Immunoblot analysis of BAFF in extracts of hBMSC transfected with BAFF siRNAs for 48 h. GAPDH was used as a loading control. b Immunoblot analysis of RANKL in extracts of hBMSC transfected with RANKL siRNAs for 48 h. GAPDH was used as a loading control. c Frequencies of apoptotic B cell populations in 2-day coculture with

hBMSC transfected with control siRNA or RANKL siRNA. d Frequencies of apoptotic B cell populations in 2-day coculture with hBMSC transfected with control siRNA or BAFF siRNA. e Frequencies of apoptotic B cell populations in 2-day coculture with hBMSC transfected with control siRNA or RANKL/BAFF siRNA. *P < 0.05. Data represented the means ± standard deviations of three independent experiments with at least three mice per group

Knockdown of RANKL and BAFF in BMSC attenuates its protective effects on lymphoma B cell survival

Tumor Biol.

all peripheral lymph nodes [33]. In addition, the disruption of downstream RANKL-RANK signaling cascade could also result in B cell development. IKKalpha was reported to be required for B cell maturation, formation of secondary lymphoid organs [34]. Similarly, the p100 (nfkb2) knockout or NF-κB inducing kinase (NIK) deficiency showed similar phenotype in defects in B cell function and abnormalities in peripheral lymphoid organs [35, 36]. The TNF super family (TNFSF) members including RANKL, CD40L, and BAFF stabilize the NIK protein leading to the activation of non-canonical NF-κB activation [37, 38]. In previous study, bone marrow stroma was demonstrated to protect B-cell lymphoma cells against apoptosis, at least in part through activation of NF-κB dependent mechanism involving upregulation of NF-κB regulated antiapoptotic proteins [28]. To identify the molecular mechanisms by which bone marrow stroma supports survival of lymphoma B cells, researchers have found BMSC-derived BAFF as a functional determinant for B lymphoma cell survival in the bone marrow environment [27]. On account of the fact that blockade of BAFF did not fully attenuate the role of BMSC on supporting lymphoma B cell survival, we hypothesized that other factors must be involved in this process. In our study, RANKL and BAFF mRNA were detected in BMSC and upregulated after coculture with lymphoma B cells. However, the expression of CD40L was nearly undetectable in BMSC and remained unchanged after coculture (data not shown). In addition, synergistic blockade of BAFF and RANKL profoundly attenuated the role of BMSC in protection of lymphoma B cell from apoptosis and recovered the gene expression profiling in lymphoma B cells. Our results may be relevant for a better understanding of the mechanisms whereby the stromal microenvironment in tumor mass protects lymphoma B cells from apoptosis. Given the ability of inhibition of NF-κB activation to enhance tumor cell apoptosis and overcome drug resistance, the combinational use of NF-κB signaling pathway inhibitors may be a more optimal treatment for B-cell malignancies.

4.

5.

6. 7.

8.

9. 10.

11.

12.

13.

14.

15. 16.

17.

18.

19.

Acknowledgments This study was supported by the fund of special fund, railway head corporation (No. J2015c001-B), and the Young Doctorial Foundation of Beijing Shijitan Hospital (No. 2016-QB10). This study was supported by the fund of special fund, railway head corporation. Project number is J2015C001-B.

20.

21.

22.

References 1. 2.

3.

Kuppers R. Mechanisms of B-cell lymphoma pathogenesis. Nat Rev Cancer. 2005;5:251–62. doi:10.1038/nrc1589. Campo E et al. The 2008 WHO classification of lymphoid neoplasms and beyond: evolving concepts and practical applications. Blood. 2011;117:5019–32. doi:10.1182/blood-2011-01-293050. Alizadeh AA et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403:503–11. doi:10.1038/35000501.

23.

24.

25.

Kuppers R, Klein U, Hansmann ML, Rajewsky K. Cellular origin of human B-cell lymphomas. N Engl J Med. 1999;341:1520–9. doi: 10.1056/NEJM199911113412007. Shaffer 3rd AL, Young RM, Staudt LM. Pathogenesis of human B cell lymphomas. Annu Rev Immunol. 2012;30:565–610. doi:10. 1146/annurev-immunol-020711-075027. Kuppers R. The biology of Hodgkin’s lymphoma. Nat Rev Cancer. 2009;9:15–27. doi:10.1038/nrc2542. Schmitz R et al. TNFAIP3 (A20) is a tumor suppressor gene in Hodgkin lymphoma and primary mediastinal B cell lymphoma. J Exp Med. 2009;206:981–9. doi:10.1084/jem.20090528. Compagno M et al. Mutations of multiple genes cause deregulation of NF-kappaB in diffuse large B-cell lymphoma. Nature. 2009;459: 717–21. doi:10.1038/nature07968. Kato M et al. Frequent inactivation of A20 in B-cell lymphomas. Nature. 2009;459:712–6. doi:10.1038/nature07969. Honma K et al. TNFAIP3/A20 functions as a novel tumor suppressor gene in several subtypes of non-Hodgkin lymphomas. Blood. 2009;114:2467–75. doi:10.1182/blood-2008-12-194852. Lenz G et al. Oncogenic CARD11 mutations in human diffuse large B cell lymphoma. Science. 2008;319:1676–9. doi:10.1126/science. 1153629. Sun L, Deng L, Ea CK, Xia ZP, Chen ZJ. The TRAF6 ubiquitin ligase and TAK1 kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes. Mol Cell. 2004;14:289–301. Suarez F, Lortholary O, Hermine O, Lecuit M. Infection-associated lymphomas derived from marginal zone B cells: a model of antigen-driven lymphoproliferation. Blood. 2006;107:3034–44. doi:10.1182/blood-2005-09-3679. Davis RE et al. Chronic active B-cell-receptor signalling in diffuse large B-cell lymphoma. Nature. 2010;463:88–92. doi:10.1038/ nature08638. Ye BH et al. Alterations of a zinc finger-encoding gene, BCL-6, in diffuse large-cell lymphoma. Science. 1993;262:747–50. Basso K, Dalla-Favera R. BCL6: master regulator of the germinal center reaction and key oncogene in B cell lymphomagenesis. Adv Immunol. 2010;105:193–210. doi:10.1016/S00652776(10)05007-8. Mandelbaum J et al. BLIMP1 is a tumor suppressor gene frequently disrupted in activated B cell-like diffuse large B cell lymphoma. Cancer Cell. 2010;18:568–79. doi:10.1016/j.ccr.2010.10.030. Pasqualucci L et al. Inactivation of the PRDM1/BLIMP1 gene in diffuse large B cell lymphoma. J Exp Med. 2006;203:311–7. doi: 10.1084/jem.20052204. Tam W et al. Mutational analysis of PRDM1 indicates a tumorsuppressor role in diffuse large B-cell lymphomas. Blood. 2006;107:4090–100. doi:10.1182/blood-2005-09-3778. Iida S et al. Deregulation of MUM1/IRF4 by chromosomal translocation in multiple myeloma. Nat Genet. 1997;17:226–30. doi:10. 1038/ng1097-226. Chapman MA et al. Initial genome sequencing and analysis of multiple myeloma. Nature. 2011;471:467–72. doi:10.1038/ nature09837. Salaverria I et al. Translocations activating IRF4 identify a subtype of germinal center-derived B-cell lymphoma affecting predominantly children and young adults. Blood. 2011;118:139–47. doi: 10.1182/blood-2011-01-330795. DeClerck YA et al. Proteases, extracellular matrix, and cancer: a workshop of the path B study section. Am J Pathol. 2004;164: 1131–9. doi:10.1016/S0002-9440(10)63200-2. Dave SS et al. Prediction of survival in follicular lymphoma based on molecular features of tumor-infiltrating immune cells. N Engl J Med. 2004;351:2159–69. doi:10.1056/NEJMoa041869. Burger JA, Ghia P, Rosenwald A, Caligaris-Cappio F. The microenvironment in mature B-cell malignancies: a target for new

Tumor Biol. treatment strategies. Blood. 2009;114:3367–75. doi:10.1182/blood2009-06-225326. 26. Do RK et al. Attenuation of apoptosis underlies B lymphocyte stimulator enhancement of humoral immune response. J Exp Med. 2000;192:953–64. 27. Lwin T et al. Lymphoma cell adhesion-induced expression of B cell-activating factor of the TNF family in bone marrow stromal cells protects non-Hodgkin’s B lymphoma cells from apoptosis. Leukemia. 2009;23:170–7. doi:10.1038/leu.2008.266. 28. Lwin T et al. Bone marrow stromal cells prevent apoptosis of lymphoma cells by upregulation of anti-apoptotic proteins associated with activation of NF-kappaB (RelB/p52) in non-Hodgkin’s lymphoma cells. Leukemia. 2007;21:1521–31. doi:10.1038/sj.leu.2404723. 29. Lwin T et al. Cell adhesion induces p27Kip1-associated cell-cycle arrest through down-regulation of the SCFSkp2 ubiquitin ligase pathway in mantle-cell and other non-Hodgkin B-cell lymphomas. Blood. 2007;110:1631–8. doi:10.1182/blood-2006-11-060350. 30. Mudaliar MA et al. Comparative gene expression profiling identifies common molecular signatures of NF-kappaB activation in canine and human diffuse large B cell lymphoma (DLBCL). PLoS One. 2013;8:e72591. doi:10.1371/journal.pone.0072591. 31. Steidl C et al. Gene expression profiling of microdissected Hodgkin Reed-Sternberg cells correlates with treatment outcome in classical

Hodgkin lymphoma. Blood. 2012;120:3530–40. doi:10.1182/ blood-2012-06-439570. 32. Claudio E, Brown K, Park S, Wang H, Siebenlist U. BAFF-induced NEMO-independent processing of NF-kappa B2 in maturing B cells. Nat Immunol. 2002;3:958–65. doi:10.1038/ni842. 33. Dougall WC et al. RANK is essential for osteoclast and lymph node development. Genes Dev. 1999;13:2412–24. 34. Senftleben U et al. Activation by IKKalpha of a second, evolutionary conserved. NF-kappa B signaling pathway. Science. 2001;293: 1495–9. doi:10.1126/science.1062677. 35. Franzoso G et al. Mice deficient in nuclear factor (NF)-kappa B/p52 present with defects in humoral responses, germinal center reactions, and splenic microarchitecture. J Exp Med. 1998;187:147–59. 36. Shinkura R et al. Alymphoplasia is caused by a point mutation in the mouse gene encoding Nf-kappa b-inducing kinase. Nat Genet. 1999;22:74–7. doi:10.1038/8780. 37. Yamaoka S et al. Complementation cloning of NEMO, a component of the IkappaB kinase complex essential for NF-kappaB activation. Cell. 1998;93:1231–40. 38. Sun SC. The noncanonical NF-kappaB pathway. Immunol Rev. 2012;246:125–40. doi:10.1111/j.1600-065X.2011.01088.x.