Environmental Science and Pollution Research https://doi.org/10.1007/s11356-018-1396-5

RESEARCH ARTICLE

Lead facilitates foci formation in a Balb/c-3T3 two-step cell transformation model: role of Ape1 function Pablo Hernández-Franco 1 & Martín Silva 1 & Rodrigo Franco 2 & Mahara Valverde 1 & Emilio Rojas 1 Received: 20 August 2017 / Accepted: 25 January 2018 # Springer-Verlag GmbH Germany, part of Springer Nature 2018

Abstract Several possible mechanisms have been examined to gain an understanding on the carcinogenic properties of lead, which include among others, mitogenesis, alteration of gene expression, oxidative damage, and inhibition of DNA repair. The aim of the present study was to explore if low concentrations of lead, relevant for human exposure, interfere with Ape1 function, a base excision repair enzyme, and its role in cell transformation in Balb/c-3T3. Lead acetate 5 and 30 μM induced APE1 mRNA and upregulation of protein expression. This increase in mRNA expression is consistent throughout the chronic exposure. Additionally, we also found an impaired function of Ape1 through molecular beacon-based assay. To evaluate the impact of lead on foci formation, a Balb/c-3T3 two-step transformation model was used. Balb/c-3T3 cells were pretreated 1 week with low concentrations of lead before induction of transformation with n-methyl-n-nitrosoguanidine (MNNG) (0.5 μg/mL) and 12-O-tetradecanoylphorbol-13acetate (TPA) (0.1 μg/mL) (a classical two-step protocol). Morphological cell transformation increased in response to lead pretreatment that was paralleled with an increase in Ape1 mRNA and protein overexpression and an impairment of Ape1 activity and correlating with foci number. In addition, we found that lead pretreatment and MNNG (transformation initiator) increased DNA damage, determined by comet assay. Our data suggest that low lead concentrations (5, 30 μM) could play a facilitating role in cellular transformation, probably through the impaired function of housekeeping genes such as Ape1, leading to DNA damage accumulation and chromosomal instability, one of the most important hallmarks of cancer induced by chronic exposures. Keywords Lead . Ape1 . Balb/c-3T3 . DNA damage . Cell transformation

Introduction Heavy metals such as cadmium, arsenic, chromium, mercury, nickel, and lead are environmental pollutants and cause harmful health effects. Many studies have reported toxic and carcinogenic effects induced when humans and animals are Responsible editor: Philippe Garrigues Electronic supplementary material The online version of this article (https://doi.org/10.1007/s11356-018-1396-5) contains supplementary material, which is available to authorized users. * Emilio Rojas [email protected] 1

Departamento de Medicina Genómica y Toxicología Ambiental, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Ciudad Universitaria, 04510 Mexico, Mexico

2

Redox Biology Center and School of Veterinary Medicine and Biomedical Sciences, University of Nebraska-Lincoln, Lincoln, NE 68583, USA

exposed to these metals (Jomova and Valko 2011a; Meliker et al. 2010; Souza-Arroyo et al. 2012; Waalkes 2003). In metal-induced carcinogenesis, several mechanisms have been proposed, from their direct interaction with DNA to indirect mechanisms that include among others, the generation of oxidative damage, interaction with transcription factors, and inhibition of DNA repair processes (Hartwig 2013; Valverde et al. 2001; Tchounwou et al. 2012; Koedrith et al. 2013; Klaunig et al. 2010; Lee et al. 2012; Wu et al. 2016). The major mechanism of toxicity induced by lead and lead-based compounds is oxidative stress (Ahamed and Siddiqui 2007; Flora et al. 2012; Hernández-Franco et al. 2011; Jomova and Valko 2011b). Lead has also the capacity to induce protein misfolding and generate ER stress (Fang et al. 2014; Kasperczyk et al. 2012). Epidemiological studies show only a weak evidence associating lead with the incidence of several cancers (Fu and Boffetta 1995; Liao et al. 2015; Steenland and Boffetta 2000). Nevertheless, more recent studies have demonstrated that exposure to lead can induce testicular tumors and preneoplastic lesions in metallothionein-null mice (Tokar

Environ Sci Pollut Res

et al. 2010). Lead and lead compounds have been classified by the International Agency for Research on Cancer (IARC) as possible human carcinogens (group 2B), based on their observed carcinogenicity in experimental animals, but evidence for their carcinogenicity in humans is still lacking (IARC 2002, 2006a, 2007). Several studies have demonstrated the carcinogenic capacity of lead by different mechanisms (Hartwig 1994; Silbergeld 2003; Silbergeld et al. 2000; Tokar et al. 2010); one of relevance is inhibition of DNA repair, directly involved in the acquirement of genetic instability. Data from lead-exposed humans and in vitro experiments have shown that lead inhibits DNA repair (Beyersmann and Hartwig 2008; Gastaldo et al. 2007; Karakaya et al. 2005). The base excision repair (BER) pathway is responsible for the removal of DNA oxidative and alkylative damage protecting cells against xenobiotics and endogenous agents (Fishel and Kelley 2007). The apurimic/apyrimidinic endonuclease 1/redox effector factor-1 (Ape1/Ref-1) is the main multifunctional protein, that besides its role as a DNA base excision repair enzyme, has an impact in a wide variety of important cellular functions including oxidative signaling, transcription factor regulation, and cell cycle control. Altered levels of Ape1/Ref-1 have been found in some cancers (Abbotts and Madhusudan 2010; Demple and Sung 2005; Di Maso et al. 2007; Park et al. 2014; Tell and Demple 2015; Tell et al. 2005, 2009, 2010; Ying et al. 2009). Moreover, McNeill et al. (2004) found that at low concentrations, some metals, including lead, could inhibit the activity of Ape1. Carcinogenesis is a multistep process that involves multiple molecular and cellular events that transform a normal cell to a malignant neoplastic one. In vitro transformation, which has been performed in many cell systems (Corvi et al. 2012; Schechtman 2012), is regarded not only as an important method for the screening of potential carcinogens but also as a valuable approach for the mechanistic study of multistage carcinogenesis (Tanaka et al. 2012; Poburski and Thierbach 2016). The in vitro two-stage transformation assay using the Balb/c-3T3 cell line is a useful system because of its convenient protocol and high predictability that can simulate the process of initiation and promotion (LeBoeuf et al. 1996). The improved transformation assay proposed by Kajiwara and Ajimi (2003) exhibits high concordance with the rodent bioassay, and sensitivity to detect both genotoxic and non-genotoxic carcinogens. Thus, the aim of the present study was to explore if environmentally relevant doses of lead alter Ape1 function, and if this effect is relevant for the transformation process assessed in a Balb/c-3T3 two-stage transformation model.

Materials and methods Chemicals Lead acetate (Pb[CH3-COO]2, purity 99.9%) and insulintransferrinselenium-A (ITS-A) were purchased from J. T. Baker (México) and GIBCO/Invitrogen (NY, USA), respectively. 12-O-tetradecanoylphorbol-13-acetate (TPA) and nmethyl-n-nitrosoguanidine (MNNG) were purchased from the Aldrich Chemical Co. (Milwaukee, WI, USA). Flourescein diacetate (FDA) and ethidium bromide (EtBr) were purchased from Sigma (St. Louis, MO, USA).

Cell culture The experiments were performed using Balb/3T3 A31-1-1 clonal cells (ATCC). Balb/c-3T3 cells (1 × 105) were grown in Dulbecco’s modified Eagle’s minimum essential medium (DMEM) supplemented with 10% FBS, 1% of antibiotics (penicillin and streptomycin), and 1% of nonessential amino acids (Gibco) in a humidified incubator under 95% air, 5% CO2, and 37 °C. Cells were subcultured before reaching confluence, twice per week. Additional media used during the promotion stage of the transformation assay consisted of the following: DMEM supplemented with 2% FBS and 1% ITSA (10 mg/mL insulin, 5.5 mg/mL transferring, and 0.0067 mg/mL sodium selenite). All media components were obtained from GIBCO/Invitrogen (NY, USA).

Treatments Balb/c-3T3 cells were exposed daily to 5 and 30 μM of lead acetate (Pb[CH3-COO]2) for 5 weeks in 60-mm plates; these concentrations are similar to those of occupationally exposed workers or environmentally exposed individuals (GarciaLeston et al. 2012; Palus et al. 2003). In order to maintain a chronic exposure, the cells after a week under treatment were replated at a density of 1 × 103 cells per plate, to continue the exposure in a similar way until reaching 5 weeks. Cells were collected every week for different analysis such as cytotoxicity, RT-PCR, western blot, molecular beacon, and comet assay. We perform three independent experiments by triplicated for all the assays, except for cell transformation assay, which were performed four times independently.

Cytotoxicity Cell viability was measured by the dual stain flourescein diacetate/ethidium bromide (FDA/EtBr) method (HernándezFranco et al. 2011). Briefly, the cells were mixed with a fluorochrome solution containing 0.02 μg/mL EtBr and 0.015 μg/ mL FDA. FDA is taken up by cells, which through esterase activity transform the non-fluorescent FDA into the green

Environ Sci Pollut Res

fluorescent metabolite (Representative picture as supplementary material). Meanwhile, nuclei of death cells are ethidium bromide stained and visualized as red fluorescence. Cells were then analyzed under a fluorescence microscope (Olympus BMX-60 with a UM61002 filter). One hundred randomly chosen cells per condition were evaluated and the results are expressed as percentages.

condition. Transformed foci type III were scored according to the following criteria, which discriminate these foci based on four morphological characteristics: (1) foci of more than 2 mm in diameter, (2) deep basophilic staining, (3) dense multilayer of cells, and (4) random orientation of cells at the edge of the foci (IARC/NCI/EPA 1985; Tsuchiya and Umeda 1997; Sasaki et al. 2012). Data were analyzed as the average of transformed foci type III of all dishes.

Reverse-transcriptase-polymerase chain reaction Western blot Total RNA was isolated with Trizol (Invitrogen, Life Technologies) according to the manufacturer’s indications. RNA quantity and purity were determined spectrophotometrically. The RT-PCR reactions were performed using the Access RT-PCR Systems (Promega). Reactions were initiated by incubating the samples at 42 °C for 60 min to prepare the cDNA, 95 °C for 5 min to inactivate retrotranscriptase followed by 36 cycles of 1 min at 95 °C, 30 s at 60 °C, and 1 min at 72 °C. GAPDH was included as a constitutively expressed gene. RT-PCR primers were designed using Primer express software (Applied Biosystems; ABI 2.0) and sequences were as follows: APE1-F- GCATTGGGAACATAGGCTGT APE1-R- GCTCCGTCAGACAAAGAAGG GAPDH-F- AAACGACCCCTTCATTGACCT GAPDH-R- ATCTTAGTGGGGTCTCGCTC

Cell transformation assay Balb/c-3T3 cells were pretreated, daily with 5 and 30 μM of lead acetate for 1 week; after that period, a traditional transformation assay was performed (Kajiwara and Ajimi 2003). The transformation protocol consisted of 25 days, divided into two steps: initiation step between days 1 and 7 and promotion between days 7 and 25. Balb/c-3T3 cells were plated at a density of 5 × 105 cells per 100-mm dish in DMEM medium supplemented with 10% FBS. After 1 day, sub-confluent cells were exposed 4 h to MNNG (0.5 μg/mL), as the transformation initiator. After that, the media were removed, and the cells for initiation screening were replated at a density of 1 × 103 cells per 60-mm dish. On day 4, the media were replenished for all treatments and controls. On day 7, the dishes were replenished with medium supplemented with 1% ITS-A and 2% FBS. TPA (0.1 μg/mL) was then added as promoter. These media and treatments were replenished on days 11 and 14. On day 25, the cells were fixed with ethanol and stained with the Giemsa solution. Treatments with MNNG as the initiator and TPA as the promoter were used as positive controls for cell transformation (Fig. 1). We performed four independent experiments for cell transformation assay, three by triplicates (9 dishes per condition) and one experiment by duplicate (2 dishes per condition), in total 11 dishes per

Proteins were separated on 12% SDS-PAGE and transferred by electroblotting to nitrocellulose membranes (Bio-Rad) using a standard transfer buffer. Blots were then blocked in TBST (100 μM Tris-HCl, 150 mM NaCl, 0.1% Tween 20, pH 7.5) containing 2% non-fat dry milk powder for 60 min, washed three times with TBST, and incubated overnight with Ape1 primary antibody (diluted 1:500). Blots were subsequently incubated for 60 min with Zymed HRP-conjugate secondary rabbit IgG antibody diluted 1:20,000, and washed again for three times with TBST. Blots were developed using the ECL detection system (Amersham international) according to the manufacturer recommendations. Bands were quantitated by densitometry analysis in an EDAS program by Kodak.

Molecular beacon-based assay The oligodeoxyribonucleotides were purchased from Eurogentec (Seraing, Belgium) including the following: (FITC)-(GCACTXAAGAATTCACGCCATGTCGA AATTCTTAAGTGC)-Dabcyl; (FITC), where X is a tetrahydrofuran residue for Ape1. The standard enzyme assay with molecular beacon was performed for 60 min at 37 °C with 10 nm of modified beacon and cell-free extract, in the respective reaction buffer (20 μl) containing 20 mM HEPES (pH 7.5), 50 mM KCl, 2 mM EDTA, 1 mM β-mercaptoethanol, and 0.1 mg/mL BSA. Reactions were performed in a black 96well plate (final volume 0.2 mL) and fluorescence was measured using a fluorometer (Multi-Detection Microplate Reader FLx800 by BIO-TEK) and real-time computed with the attached software KCjunior. Excitation was set at 488 nm and emission at 515 nm to assess FITC fluorescence and results were expressed as response units (ru).

DNA damage, single cell gel electrophoresis assay Ten microliters of the cell suspension (10,000–15,000 cells) was mixed with 75 μl of a 0.5% low melting point agarose solution and loaded onto microscope slides prelayered with 150 μL of 0.5% normal melting point agarose. The single cell gel electrophoresis (SCGE) assay was performed as described by Martín et al. (2011). Briefly, after incubation with lysis

Environ Sci Pollut Res

Fig. 1 Cell transformation assay, scheme. Balb/c-3T3 cells were pretreated, daily with 5 and 30 uM of lead acetate for 1 week before morphological transformation assay. Protocol consisted of 25 days, divided into two steps: initiation step between days 1 and 7 and promotion between days 7 and 25. Balb/c-3T3 cells were plated at a density of 5 x 105 cells per 100-mm dish in DMEM medium supplemented with 10% FBS. After 1 day, sub-confluent cells were exposed 4 h to MNNG (0.5 ug/ mL, dissolved in DMSO), as the transformation initiator. After that, the media were removed, and the cells for initiation screening were replated at a density of 1 x 103 cells per 60-mm dish. On day 4, the media were

replenished for all treatments and controls. On day 7, the dishes were replenished with medium supplemented with 1% ITS-A and 2% FBS. TPA (0.1 ug/mL) was then added as promoter and was replenished on days 11 and 14. On day 25, the cells were fixed with ethanol and stained with the Giemsa solution. Symbols represent differences with respect to protocol recommended by Sasaki et al. (2012), * Sasaki et al. (2012) use as initiator 3-methyl-cholantrene 4 ug/mL during 72 h. ★ Sasaki et al. (2012) plate 2 x 104 cells in a 100-mm dish, since days 0 to 32. ◆ Sasaki et al. (2012) use in the promoter treatment 2 ug/mL of insulin instead of ITS-A and realize change medium in days 17, 21, and 24

buffer (2.5 M NaCl, 100 mM EDTA, 10 mM Tris, pH 10, supplemented with 10% DMSO and 1% Triton X-100) at 4 °C for at least 1 h, the slides were placed in a horizontal electrophoresis chamber containing running buffer solution (300 mM NaOH, 1 mM EDTA, pH > 13), for 20 min to allow the DNA to unwind. Electrophoresis was performed for 10 min at 300 mA and 25 V (0.8 V/cm), and all technical steps were conducted using dim indirect light. After electrophoresis, the slides were gently removed and rinsed with neutralization buffer (0.4 M Tris, pH 7.5) at room temperature for 15 min. The slides were dehydrated with 100% ethanol (5 min), after which they were air dried. Ethidium bromide (20 μL of a 20 μg/mL solution) was added to each slide, and a coverslip was placed on the gel. Individual cells were visualized at × 20 magnification using an Olympus BX-60 microscope with fluorescence attachments (515–560-nm excitation filter, 590-nm barrier filter). Images were digitized and analyzed using KOMET v.31 software (Kinetic Imaging), and the Olive Tail Moment (OTM) parameter was used to evaluate DNA damage (200 cells were scored for each condition).

those were DNA damage was assessed by comet assay, for which we use a Mann-Whitney U test. Data were plotted as mean ± standard error (SE) using SIGMA PLOT/STAT package for statistical analysis. Results with a p values < 0.05 were considered as statistically significant.

Statistical analysis Experimental replicas were independent and performed on separate days. Collected data were analyzed by using Kruskal-Wallis one-way ANOVA on ranks or Dunn’s method comparison test was performed on the collected data; except

Results Metal carcinogenesis is associated with alterations in the expression genes of DNA repair systems. We analyzed the mRNA and protein expression levels of Ape1 by semiquantitative PCR (RT-PCR) and western blot in Balb/c-3T3 cells treated with 5 and 30 μM of lead acetate for 5 weeks. It is worth noting that these concentrations did not exert effects on cell viability assessed by FDA-EtBr dual stain (Figure S1B). After chronic exposure for 5 weeks, we found an induction of Ape1 mRNA expression (Fig. 2a). Relative densitometry quantification of agarose gels shows that an increased expression level of Ape1 mRNA is consistently found throughout the treatment (Fig. 2b and supplementary material). Considering the above, we aimed to confirm that lead exposure affects the protein levels of Ape1, and found that Ape1 protein expression was upregulated. Additionally, we detected a dose-dependent increase in the expression levels of Ape1 in the first week (Fig. 3a, c) and fifth week (Fig. 3b, d) of exposure.

Environ Sci Pollut Res

Fig. 2 Lead increases Ape1/Ref1 mRNA level. Balb/c-3T3 cells were treated with lead acetate at 5 and 30 μM for 5 weeks, followed by semi-quantitative RT-PCR analysis of Ape1/Ref1 mRNA. a Expression changes through 5 weeks of lead treatment. b Relative densitometry

quantitation. Data was normalized to GAPDH and represented as fold change with respect to control (no lead treatment). Data are means ± S.E of n = 3. Kruskal-Wallis one-way ANOVA on rank test: p < 0.001; Dunn’s method comparison test: p < 0.05

Lead-induced carcinogenicity is associated with DNA damage and inhibition of DNA repair processes (Wu et al. 2016). To study the role of DNA repair systems, we used a molecular beacon-based assay in whole-cell extracts to follow the single-strand-specific DNase activity of Ape1. Ape1 activity decreased at both concentrations of lead when the cells were exposed for 1 week (Fig. 4a); meanwhile, at 5 weeks, only 30 μM lead treatment showed a decrease in Ape1 activity (Fig. 4b). This data reveal that treatment with lead inhibits

Ape1, one of the most important enzymes of DNA base excision repair process. If lead exposure inhibits DNA base excision repair, we could expect more DNA damage after MNNG treatment in the Balb/c-3T3 two-step transformation model. We used the SCGE assay to confirm this hypothesis. The results corroborated that DNA damage increased in Balb/c-3T3 cell after lead treatment, reported as OTM after 1 week and 4 h treatment with MNNG (Fig. 5).

Fig. 3 Lead increases the protein levels of Ape1. Balb/c-3T3 cells were treated with lead acetate at 5 and 30 μM for 5 weeks. Followed by immunoblot analysis of Ape1. a Representative immunoblot for Ape1 after treatment with lead for 1 and 5 weeks. b, c Bar graphs show the relative densitometry quantification. Data were normalized to β-actin and represented as fold change with respect to control (no lead treatment). Data are means ± S.E of n = 3. Kruskal-Wallis one-way ANOVA on rank test: p < 0.001; Dunn’s method comparison test: p < 0.05

Environ Sci Pollut Res

Fig. 4 Lead decreases the activity of Ape1. Balb/c-3T3 cells were treated with 5 and 30 μM of lead acetate for 5 weeks. Ape1 endonuclease activity was evaluated by molecular beacon-based assay in whole-cell extracts. a Ape1 activity after treatment with lead for 1 week. b Ape1 activity after

treatment with lead for 5 weeks. Graphs represented data as % Ape1 activity with respect to negative control. Data are means ± S.E of n = 3. Kruskal-Wallis one-way ANOVA on rank test: p < 0.001; Dunn’s method comparison test: p < 0.05

Both findings, lead-induced DNA damage and impairment in APE1 activity, suggest that lead could increase genomic instability during the initiation step of the transformation assay; it was expected that this pretreatment increased the number of foci. Pretreatment for 1 week with lead acetate followed by MNNG-TPA (initiator-promoter respectively) showed that lead has the capacity to increase foci number in the transformation model at 5 μM concentrations versus standard protocol (Fig. 6). All together, these results demonstrate that lead induces APE1 gene and protein expression; nevertheless, lead inhibits APE1 activity and lead pretreatment facilitates foci induction depending of DNA damage accumulation in Balb/c-3T3 two transformation step model.

Discussion

Fig. 5 Induction of DNA damage by lead pretreatment. Balb/c-3T3 cells were treated with lead acetate at 5 and 30 μM for 1 week. Olive Tail Moment (OTM) pretreatment for 1 week followed by 4 h MNNG treatment. Data are means ± S.E of n = 3. Mann-Whitney U rank sum test: p < 0.05

Evidence suggests that DNA repair pathways are primary targets of environmental metals (Beyersmann and Hartwig 2008; Hartwig 2013; Silbergeld et al. 2000; Silbergeld 2003). DNA repair mechanisms act as custodians of the integrity of the genome, and the genes involved in these mechanisms can be considered as caretaker genes, which prevent the cytotoxic and mutagenic effects of DNA-damaging agents, such as metals (Silbergeld et al. 2000; Silbergeld 2003; IARC 2006b; IARC 2007; Beyersmann and Hartwig 2008; Hartwig 2013). The role of Ape1 (one of the most important proteins of BER), in metal carcinogenesis, is poorly understood; in this

Fig. 6 Foci induction by lead pretreatment in a cell transformation model. Balb/c-3T3 cells were pretreated with lead acetate at 5 and 30 μM for 1 week, followed by treatment with MNNG (0.5 μg/mL) during the initiation stage and then treated with TPA (0.1 μg/mL) during the promotion stage in the transformation protocol. Data are means ± S.E of n = 4. (a) Statistical difference with to control and (b) difference with respect to MMNG/TPA treatment. Kruskal-Wallis one-way ANOVA on rank test: p < 0.001; Dunn’s method comparison test: p < 0.05

Environ Sci Pollut Res

study, we found that chronic lead treatment increased Ape1 mRNA and protein levels but its repair activity was found impaired. These findings agree with studies that reported the inhibition of Ape1 activity by lead in vitro and in vivo (McNeill et al. 2004, 2007; Bolin et al. 2006). Also, previous work has shown that Ape1mRNA levels increased while protein deregulation occurred during the development of hepatocarcinogenesis (Tomasi et al. 2009). Nonetheless, these studies did not address if the inhibition of Ape1 by lead is relevant for the transformation process. Among the molecular mechanisms proposed to explain the inhibition of DNA base excision repair by lead is competition with zinc ions, which are essential for many finger zinc proteins (Witkiewicz-Kucharczyk and Bal 2006). The presence of zinc confers to these recognition element structural characteristics essential to their ability to interact with DNA; hence, the substitution of zinc by lead could result in reduced repair activity (Silbergeld et al. 2000). Another possible explanation is that lead decreases Ape1 repair activity by a unique and specific interaction with conserved active site residues that in turn disrupts the metal-dependent (magnesium-dependent) catalytic reaction (McNeill et al. 2004). It was also recently shown that elevated endogenous oxidative stress induced by environmental exposures may have significant effect in DNA repair potential of Ape1 (Karmahapatra et al. 2014). It should be noted that Ape1 is a multifunctional protein and the redox activity plays an important role in regulating the expression of many DNA repair proteins. Regardless, a deficiency in Ape1 repair activity is associated with increased sensitivity to DNA-damaging agents, genomic instability, and cancer susceptibility. In vitro transformation, which has been performed in many systems, is regarded not only as an important method for the screening of potential carcinogens either mutagens or promoters but also as a valuable approach for the mechanistic study of multistage carcinogenesis (Schechtman 2012; Tanaka et al. 2012; Poburski and Thierbach 2016). To analyze the possible implication of Ape1 on cellular transformation due to lead exposure, we used the two-step transformation model using Balb/c3T3 cells. We observed an increase in DNA damage and number of foci induced by MNNG and TPA (standard protocol of the model), when cells were pretreated with 5 μM of lead for 1 week. The fact that lead pretreatment with 30 μM just increases DNA damage but not foci number could be interpreted as a threshold response that reflect the accumulation of genomic instability caused by the low Ape1 activity (50%) impairment before cell transformation assay, since has been correlated with cell death (Meira et al. 2001). This scenario to begin the MNNG treatment conduces to mortality that affects the clonal expansion of the foci. In summary, we found that exposure to low concentrations of lead (5, 30 μM) increases Ape1 expression in Balb/c-3T3 cells, but it also results in inhibition of the repair activity of Ape1, which results in an increase foci formation in the transformation

model. Our lead concentrations are within the range of exposure reported by McNeil et al. (2004), where they observe the inhibition of Ape1 generated by exposure to lead from 1 to 100 μM for 10 min. This group mentions that the use of concentrations similar to those found in workers exposed occupationally (1–10 μM) would induce the inhibition of Ape1 activity by 50%, which is the finding of the present study. More attractively, the present report provides evidence indicating that lead acts like a facilitator mechanism of cellular transformation through inhibiting Ape1 repair activity, independent of gene and protein expression. The results suggest that inhibition of Ape1 by lead plays an essential role in the transformation cells associated with chromosomal instability. The Ape1 overexpression following lead exposure could be the result of cell signaling due to the oxidative stress generated, but direct inhibition of the enzyme and increase chromosomal instability decide the fate of the cell (Fig. 7). Recently, Tell and Demple highlight the importance of Ape1 modifications and interactions that affect BER activity and its direct link to tumorigenesis; therefore more studies are needed to understand all the roles of Ape1 in cancer (Tell and Demple 2015). These results together with previous reports that the induction of oxidative stress plays an important and definitive role in metals-mixture-induced cell transformation (Martín et al. 2011; Rodríguez-Sastre et al. 2014) allow us to ascertain that lead is a facilitator of carcinogenesis (Silbergeld et al. 2000).

Fig. 7 Diagram indicating possible mechanisms in lead-induced cellular transformation. Lead has been reported to increase reactive oxygen species (ROS) by distinct mechanisms. (a) ROS might increase Ape1/Ref-1 expression levels through diverse signaling pathways. (b) Lead can exhibit high affinity for Cys–His zinc-binding motifs and directly inhibit Ape1 repair activity by modification of active sites leading to accumulation of DNA damage. (c) The impaired repair activity and the concomitant increase in DNA damage might be involved in the direct promotion of genomic instability resulting in cell transformation. (d) DNA damage also modulates the DNA damage response (DDR) pathway activity that can regulate different signaling proteins involved in apoptotic cell death or senescence pathways

Environ Sci Pollut Res Acknowledgements PHF and MS were the recipients of a fellowship from CONACyT. Thanks to Unidad de Biología Molecular Instituto de Fisiología Celular UNAM for the oligonucleotide synthesis. We thank the technical support of Dr. Maria Alexandra Rodríguez-Sastre.

Funding information This study was supported by CONACyT project U44260-M.

References Abbotts R, Madhusudan S (2010) Human AP endonuclease 1 (APE1): from mechanistic insights to druggable target in cancer. Cancer Treat Rev 36(5):425–435. https://doi.org/10.1016/j.ctrv.2009.12.006 Ahamed M, Siddiqui MKJ (2007) Low level lead exposure and oxidative stress: current opinions. Clin Chim Acta 383:57–64 Beyersmann D, Hartwig A (2008) Carcinogenic metal compounds: recent insight into molecular and cellular mechanisms. Arch Toxicol 82(8): 493–512. https://doi.org/10.1007/s00204-008-0313-y Bolin CM, Basha R, Cox D, Zawia NH, Lahiri DK, Cardozo-Pelaez F (2006) Exposure to lead (Pb) and the developmental origin of oxidative DNA damage in the aging brain. FASEB J 20(6):788–790. https://doi.org/10.1096/fj.05-5091fje Corvi R, Aardema MJ, Gribaldo L, Hayashi M, Hoffmann S, Schechtman L, Vanparis P (2012) ECVAM prevalidation study on in vitro cell transformation assays: general outline and conclusions of the study. Mutat Res - Genet Toxicol Environ Mutagen 744(1):12–19. https:// doi.org/10.1016/j.mrgentox.2011.11.009 Demple B, Sung J-S (2005) Molecular and biological roles of Ape1 protein in mammalian base excision repair. DNA Repair (Amst) 4(12):1442–1449. https://doi.org/10.1016/j.dnarep.2005.09.004 Di Maso V, Avellini C, Crocè LS, Rosso N, Quadrifoglio F, Cesaratto L, Codarin E, Bedogni G, Beltrami CA, Tell G, Tiribelli C (2007) Subcellular localization of APE1/Ref-1 in human hepatocellular carcinoma: possible prognostic significance. Mol Med 13:89–96 Fang J-Y, Wang P-W, Huang C-H, Hung Y-Y, Pan T-L (2014) Evaluation of the hepatotoxic risk caused by lead acetate via skin exposure using a proteomic approach. Proteomics 14:2588–2599 Fishel ML, Kelley MR (2007) The DNA base excision repair protein Ape1/Ref-1 as a therapeutic and chemopreventive target. Mol Asp Med 28(3-4):375–395. https://doi.org/10.1016/j.mam.2007.04.005 Flora G, Gupta D, Tiwari A (2012) Toxicity of lead: a review with recent updates. Interdiscip Toxicol 5:47–58 Fu H, Boffetta P (1995) Cancer and occupational exposure to inorganic lead compounds: a meta-analysis of published data. Occup Environ Med 52(2):73–81. https://doi.org/10.1136/oem.52.2.73 Garcia-Leston J, Roma-Torres J, Vilares M, Pinto R, Prista J, Teixeira JP, Mayan O, Conde J, Pingarilho M, Gaspar JF, Pasaro E, Mendez J, Laffon B (2012) Genotoxic effects of occupational exposure to lead and influence of polymorphisms in genes involved in lead toxicokinetics and in DNA repair. Env Int 43:29–36. https://doi.org/10.1016/j. envint.2012.03.001 Gastaldo J, Viau M, Bencokova Z, Joubert A, Charvet AM, Balosso J, Foray N (2007) Lead contamination results in late and slowly repairable DNA double-strand breaks and impacts upon the ATMdependent signaling pathways. Toxicol Lett 173:201–214 Hartwig A (2013) Metal interaction with redox regulation: an integrating concept in metal carcinogenesis? Free Radic Biol Med 55:63–72. https://doi.org/10.1016/j.freeradbiomed.2012.11.009 Hartwig A (1994) Role of DNA repair inhibition in lead- and cadmiuminduced genotoxicity: a review. Env Health Perspect 102(3):45–50

Hernández-Franco P, Silva M, Valverde M, Rojas E (2011) Induction of oxidative stress by low doses of lead in human hepatic cell line WRL-68. Biometals 24:951–958 IARC (2002) IARC monographs on the evaluation of carcinogenic risks to humans. Iarc Monogr. Eval. Carcinog. Risks To Humans96, i–ix+ 1–390 IARC (2006a) IARC monograph inorganic and organic lead compounds. Eval. Carcinog. Risks to Humans87, 529 IARC (2006b) IARC monographs on the evaluation of carcinogenic risks to humans. Dis. Colon Rectum 49, 791 IARC (2007) IARC monographs on the evaluation of carcinogenic risks to humans. Monograph 89, 223–276 IARC/NCI/EPA Working Group (1985) Cellular and molecular mechanisms of cell transformation and standardization of transformation assays of established cell lines for the prediction of carcinogenic chemicals: overview and recommended protocols cellular and molecular mechanisms of cell. Tra Cancer Res 45:2395–2399 Jomova K, Valko M (2011a) Importance of iron chelation in free radicalinduced oxidative stress and human disease. Curr Pharm Des 17(31):3460–3473. https://doi.org/10.2174/138161211798072463 Jomova K, Valko M (2011b) Advances in metal-induced oxidative stress and human disease. Toxicology 283:65–87 Kajiwara Y, Ajimi S (2003) Verification of the BALB/c 3T3 cell transformation assay after improvement by using an ITES-medium. Toxicol Vitr 17(4):489–496. https://doi.org/10.1016/S08872333(03)00050-X Karakaya A, Ozcagli E, Ertas N, Sardas S (2005) Assessment of abnormal DNA repair responses and genotoxic effects in lead exposed workers. Am J Ind Med 47:358–363 Karmahapatra SK, Saha T, Adhikari S, Woodrick J, Roy R (2014) Redox regulation of apurinic/apyrimidinic endonuclease 1 activity in LongEvans Cinnamon rats during spontaneous hepatitis. Mol Cell Biochem 388:185–193 Kasperczyk A, Machnik G, Dobrakowski M, Sypniewski D, Birkner E, Kasperczyk S (2012) Gene expression and activity of antioxidant enzymes in the blood cells of workers who were occupationally exposed to lead. Toxicology 301(1–3):79–84. https://doi.org/10. 1016/j.tox.2012.07.002 Klaunig JE, Kamendulis LM, Hocevar B (2010) Oxidative stress and oxidative damage in carcinogenesis. Toxicol Pathol 38:96–109 Koedrith P, Kim H, Il WJ, Seo YR (2013) Toxicogenomic approaches for understanding molecular mechanisms of heavy metal mutagenicity and carcinogenicity. Int. J. Hyg. Environ. Health 216:587–598 LeBoeuf RA, Kerckaert GA, Aardema MJ, Gibson DP, Brauninger R, Isfort RJ (1996) The pH 6.7 Syrian hamster embryo cell transformation assay for assessing the carcinogenic potential of chemicals. Mutat. Res. - Fundam. Mol. Mech. Mutagen. 356(1):85–127. https://doi.org/10.1016/0027-5107(95)00199-9 Lee JC, Son YO, Pratheeshkumar P, Shi X (2012) Oxidative stress and metal carcinogenesis. Free Radic Biol Med 53:742–757 Liao LM, Friesen MC, Xiang YB, Cai H, Koh DH, Ji BT, Yang G, Li HL, Locke SJ, Rothman N, Zheng W, Gao YT, Shu XO, Purdue MP (2015) Occupational lead exposure and associations with selected cancers: the Shanghai Men’s and Women’s Health Study Cohorts. Environ Health Perspect 124:97–103 Martín SA, Emilio R, Mahara V (2011) Role of oxidative stress in transformation induced by metal mixture. Oxidative Med Cell Longev 2011:1–11. https://doi.org/10.1155/2011/935160 McNeill DR, Narayana A, Wong HK, Wilson DM (2004) Inhibition of Ape1 nuclease activity by lead, iron, and cadmium. Environ Health Perspect 112:799–804 McNeill DR, Wong HK, Narayana A, Wilson DM (2007) Lead promotes abasic site accumulation and co-mutagenesis in mammalian cells by inhibiting the major abasic endonuclease Ape1. Mol Carcinog 46(2):91–99. https://doi.org/10.1002/mc.20196

Environ Sci Pollut Res Meira LB, Devaraj S, Kisby GE, Burns DK, Daniel RL, Hammer RE, Grundy S, Jialal I, Friedberg EC (2001) Heterozigocity for mouse Apex gene results in phenotypes associated with oxidative stress. Cancer Res 61(14):5552–5557 Meliker JR, Slotnick MJ, AvRuskin GA, Schottenfeld D, Jacquez GM, Wilson ML, Nriagu JO (2010) Lifetime exposure to arsenic in drinking water and bladder cancer: a population-based case-control study in Michigan, USA. Cancer Causes Control 21(5):745–757. https:// doi.org/10.1007/s10552-010-9503-z Palus J, Rydzynski K, Dziubaltowska E, Wyszynska K, Natarajan AT, Nilsson R (2003) Genotoxic effects of occupational exposure to lead and cadmium. Mutat Res Toxicol Environ Mutagen 540(1):19–28. https://doi.org/10.1016/S1383-5718(03)00167-0 Park JS, Kim HL, Kim YJ, Weon JI, Sung MK, Chung HW, Seo YR (2014) Human AP endonuclease 1: a potential marker for the prediction of environmental carcinogenesis risk. Oxidative Med Cell Longev 2014:1–15. https://doi.org/10.1155/2014/730301 Poburski D, Thierbach R (2016) Impairment of the BALB/c-3T3 cell transformation assay: a tool for investigating cancer mechanisms and therapies. Sci Rep 6(1):32966. https://doi.org/10.1038/ srep32966 Rodríguez-Sastre MA, Rojas E, Valverde M (2014) Assessing the impact of As-Cd-Pb metal mixture on cell transformation by two-stage Balb/c 3T3 cell assay. Mutagenesis 29:251–257 Sasaki K, Bohnenberger S, Hayashi K, Kunkelmann T, Muramatsu D, Poth A, Sakai A, Salovaara S, Tanaka N, Thomas BC, Umeda M (2012) Photo catalogue for the classification of foci in the BALB/c 3T3 cell transformation assay. Mutat Res 744(1):42–53. https://doi. org/10.1016/j.mrgentox.2012.01.009 Schechtman LM (2012) Rodent cell transformation assays—a brief historical perspective. Mutat Res Genet Toxicol Environ Mutagen 744: 3–7 Silbergeld EK (2003) Facilitative mechanisms of lead as a carcinogen. Mutat Res - Fundam Mol Mech Mutagen 533(1-2):121–133. https:// doi.org/10.1016/j.mrfmmm.2003.07.010 Silbergeld EK, Waalkes M, Rice JM (2000) Lead as a carcinogen: experimental evidence and mechanisms of action. Am J Ind Med 38:316– 323 Souza-Arroyo V, Martínez-Flores K, Bucio-Ortiz L, Gómez-Quiroz LE, Gutiérrez-Ruiz MC (2012) Liver and cadmium toxicity. Drug Metab Toxicol S5:001 Steenland K, Boffetta P (2000) Lead and cancer in humans: where are we now? Am J Ind Med 38(3):295–299. https://doi.org/10.1002/10970274(200009)38:3<295::AID-AJIM8>3.0.CO;2-L Tanaka N, Bohnenberger S, Kunkelmann T, Munaro B, Ponti J, Poth A, Sabbioni E, Sakai A, Salovaara S, Sasaki K, Thomas BC, Umeda M (2012) Prevalidation study of the BALB/c 3T3 cell transformation assay for assessment of carcinogenic potential of chemicals. Mutat. Res. - Genet. Toxicol. Environ. Mutagen. 744(1):20–29. https://doi. org/10.1016/j.mrgentox.2011.12.008

Tchounwou PB, Yedjou CG, Patlolla AK, Sutton DJ (2012) Heavy metal toxicity and the environment. EXS 101:133–164. https://doi.org/10. 1007/978-3-7643-8340-4_6 Tell G, Demple B (2015) Base excision DNA repair and cancer. Oncotarget 6(2):584–585. https://doi.org/10.18632/oncotarget.2705 Tell G, Damante G, Caldwell D, Kelley MR (2005) The intracellular localization of APE1/Ref-1: more than a passive phenomenon? Antioxid Redox Signal 7:367–384 Tell G, Fantini D, Quadrifoglio F (2010) Understanding different functions of mammalian AP endonuclease (APE1) as a promising tool for cancer treatment. Cell Mol Life Sci 67:3589–3608 Tell G, Quadrifoglio F, Tiribelli C, Kelley MR (2009) The many functions of APE1/Ref-1: not only a DNA repair enzyme. Antioxid Redox Signal 11:601–619 Tokar EJ, Diwan BA, Waalkes MP (2010) Early life inorganic lead exposure induces testicular teratoma and renal and urinary bladder preneoplasia in adult metallothionein-knockout mice but not in wild type mice. Toxicology 276(1):5–10. https://doi.org/10.1016/j.tox. 2010.06.006 Tomasi ML, Iglesias-Ara A, Yang H, Ramani K, Feo F, Pascale MR, Martínez-Chantar ML, Mato JM, Lu SC (2009) Sadenosylmethionine regulates apurinic/apyrimidinic endonuclease 1 stability: implication in hepatocarcinogenesis. Gastroenterology 136(3):1025–1010. https://doi.org/10.1053/j.gastro.2008.09.026 Tsuchiya T, Umeda M (1997) Relationship between exposure to TPA and appearance of transformed cells in MNNG-initiated transformation of BALB/c 3T3 cells. Int J Cancer 73(2):271–276. https://doi.org/ 10.1002/(SICI)1097-0215(19971009)73:2<271::AID-IJC18>3.0. CO;2-I Valverde M, Trejo C, Rojas E (2001) Is the capacity of lead acetate and cadmium chloride to induce genotoxic damage due to direct DNAmetal interaction? Mutagenesis 16:265–270 Waalkes MP (2003) Cadmium carcinogenesis. Mutat Res Fundam Mol Mech Mutagen 533(1-2):107–120. https://doi.org/10.1016/j. mrfmmm.2003.07.011 Witkiewicz-Kucharczyk A, Bal W (2006) Damage of zinc fingers in DNA repair proteins, a novel molecular mechanism in carcinogenesis. in Toxicol Lett 162(1):29–42. https://doi.org/10.1016/j.toxlet. 2005.10.018 Wu X, Cobbina SJ, Mao G, Xu H, Zhang Z, Yang L (2016) A review of toxicity and mechanisms of individual and mixtures of heavy metals in the environment. Environ Sci Pollut Res 23(9):8244–8259. https://doi.org/10.1007/s11356-016-6333-x Ying Z, Jian W, Debing X, Dong W, Xin XY (2009) Alterations in the expression of the apurinic/apyrimidinic endonuclease-1/redox factor-1 (APE1/Ref-1) in human ovarian cancer and indentification of the therapeutic potential of APE1/Ref-1 inhibitor. Int J Oncol 35: 1069–1079