Chinese Science Bulletin © 2008

SCIENCE IN CHINA PRESS

Springer

CaSfl1 plays a dual role in transcriptional regulation in Candida albicans ZHANG TingTing1, LI Di1, LI WanJie1, WANG Yue2† & SANG JianLi1† 1 2

Key Laboratory of Cell Proliferation and Regulation of Ministry of Education, Beijing Normal University, Beijing 100875, China Candida albicans Molecular and Cell Biology Laboratory, Institute of Molecular and Cell Biology, Proteos, 61 Biopolis Drive, Singapore 138673, Singapore

As a newly identified transcription factor in Candida albcians, CaSfl1 has been shown to be involved in cell flocculation and filamentation and in the negative regulation of several genes involved in hyphal growth. In this study, we constructed Casfl1Δ/Δ mutants and confirmed that deletion of this gene indeed affected cell flocculation and filamentation. In addition, by RT-PCR we found that while Casfl1 repressed the expression of several hypha-specific genes including HWP1, ECE1, ALS1, ALS3, and FLO8, it strongly activated the expression of the heat-shock protein genes HSP30 and HSP90 under certain stress conditions. Therefore, we propose that CaSfl1 can act as both positive and negative regulators, thereby playing a dual role in transcriptional controls in Candida albicans. Candida albicans, CaSFL1, gene knockout, morphogenesis, transcriptional regulation

Awareness of C. albicans as a major human health threat has risen during recent years. Although C. albicans infections can be relatively mild and superficial, life-threatening systemic mycoses often occur in immunocompromised patients, or as a consequence of long-term therapy with broad-spectrum antibiotics or of anticancer chemotherapy[1]. Thus, developing techniques of manipulating C. albicans and the sequencing of its genome will lead to a thorough understanding of the virulence and biology of this fungal pathogen[2,3]. C. albicans can grow in a variety of morphological forms including budding yeast, pseudohyphae and hyphae[4,5]. The yeast-to-hyphae transition has attracted much attention due to its established importance for infection and virulence[6,7]. A diverse range of environmental stimuli may induce C. albicans hyphal or pseudohyphal growth, such as serum, neutral pH (6.5―7.0), appropriate temperature (>35℃), and some synthetic growth media such as Lee’s medium and Spider medium[8]. Several signal transduction pathways are known to play roles in the growth form selection. The cAMP-protein kinase A (PKA) pathway has a key role, because blocking it abolwww.scichina.com | csb.scichina.com | www.springerlink.com

ishes true hyphal growth under most experimental conditions. Another important pathway contains a MAP kinase cascade that seems to have a more important role in regulating pseudohyphal than true hyphal growth. The two pathways control transcription factors Efg1 and Cph1 respectively, which activate the expression of hypha-specific genes for a diverse range of infection-related functions[9,10]. In S. cerevisiae, ScSFL1 was originally identified in a genetic screen for suppressors of flocculation. Its N-terminal region contains a HSF (heat-shock factor) domain, which often exists in heat-shock transcription factors[11]. Depending on the HSF domain, Sfl1 can regulate expression of some genes via specific binding to heat-shock elements (HSE) in the promoters of target genes[12,13]. In S. cerevisiae, Sfl1 is known to interact with Tpk2, a cAMP-dependent protein kinase that negaReceived February 16, 2008; accepted May 4, 2008 doi: 10.1007/s11434-008-0302-9 † Corresponding author (email: [email protected]; [email protected]) Supported by the Joint Research Fund for Overseas Natural Science of China (Grant No. 30228001) and National Basic Research Program of China (Grant No. 2007CB914401).

Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

1 Materials and methods 1.1 Strains, media and growth conditions Candida albicans strains used are listed in Table 1. The strains were routinely grown in either YPD (2% yeast extract, 1% Bactopeptone and 2% glucose) or GMM medium (2% glucose and 0.67% yeast nitrogen base). To grow strains defective in uracil, arginine or histidine synthesis, the required nutrient was added to GMM. Table 1

Candida albicans strains used in this study.

Strain

Relevant genotype

Source

SC5314

wild type

[18]

BWP17

ura3/ura3 his1Δ/his1Δ arg4Δ/arg4Δ

[18]

DT1

sfl1::HIS1/sfl1::ARG4

this study

DT2

Casfl1Δ::ARG4/Casfl1Δ::HIS1, CaURA3

this study

DT3

Casfl1Δ::ARG4/Casfl1Δ::HIS1, CaSFL1, aURA3 this study

Table 2 The primers used in this study Primer Sequence For gene deletion cassettes SFL1 ABf: 5′ TAGAAGACTACAAAGGGATCATTATC3′ SFL1 ABr: 5′ ATGGATCCGAGAAATACTACCACCAC 3′ SFL1 CDf: 5′ CCATTGCTCAGGATCCATACTGTCTACTCACGAG 3′ 5′ TTGAATGAATTGAATCATTTAATAAGTATACAGTTCSFL1 CDr: CAAGATTA3′ For PCR verification SFL1-AA: 5′ ATGGTACCGGAAAAACTCCATTGA 3′ Arg-Fw: 5′ GCTAGTGTGGAAAGAAGAGATGCTC 3′ Arg-Re: 5′ GTACACGACCCACAGTTAGTCATAAAA 3′ His-Fw: 5′ AGAAAGCTGGTGCAACCGATATAT 3′ His-Re: 5′ CACTGTATCCTCTTCTTCTGTCCCCA 3′ SFL1-orf-f: 5′ ATGAGTCATTTGGTACTGTCTTC 3′ SFL1-orf-r: 5′ ATACTGTGATGGTGAACAAAATA 3′ For revertant cassettes SFL1-rescue-f: 5′ TTGGTACCGAAAAACTCCATTGAAAAGCA 3′ SFL1-rescue-r: 5′ TTCCGGTTATTCTAATTTTCTCTTTTTATGA 3′

1.3 Hyphal and pseudohyphal induction 1.2 Construction of the Casfl1Δ/Δ mutant Gene deletion cassettes were constructed by flanking a marker gene, HIS1 or ARG4, with AB and CD DNA fragments (about 300 bp each) corresponding to the 5′ and 3′ untranslated regions (UTR) of the target gene, respectively. The AB and CD fragments with 10-bp

For hyphal induction, the strains were grown in YPD containing 20% serum, Spider medium (1% nutrient broth, 1% mannitol, 0.2% K2HPO4) or RPMI1640 (1.04% RPMI 1640 powder, 0.1% HEPES) at 37℃. For pseudohyphal induction, the strains were grown on thin low-ammonium medium (SLAD) plates (0.05

ZHANG TingTing et al. Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

2625

ARTICLES

overlapping sequence were PCR-amplified from genomic DNA using appropriate oligonucleotide primers containing added BamH I sites to facilitate ligation. Using the LiAc transformation method, the AB-ARG4-CD gene deletion cassette was transformed into BWP17 (arg4Δ/Δ, his1Δ/Δ and ura3Δ/Δ). The transformants were selected using appropriate dropout GMM media (GMM + His + Ura) and the correct heterozygous deletion strains (CaSFL1/Casfl1Δ, 1st KO strains) were verified by PCR. After transformation of the AB-HIS1-CD cassette into the 1st KO vector, the homozygous deletion strains (Casfl1Δ/Δ) were selected using GMM + Ura media and verified by PCR. Because this deletion strain was Ura3−, a copy of URA3 on the plasmid CIP10 was introduced by integration at the RP10 locus to create strains which are only deleted of CaSFL1 compared with the wild-type strain. To confirm that all the defects of the Casfl1Δ/Δ mutant were the result of CaSFL1 deletion, CaSFL1 with its own promoter was cloned in CIP10 and reintroduced into Casfl1Δ/Δ strains by integration at the CaSFL1 locus. The primers we used are listed in Table 2 (GGATCC: BamH I; GGTACC: Kpn I; CCGG: Hpa II).

MEDICAL MICROBIOLOGY

tively regulates the function of Sfl1, deletion of SFL1 enhances pseudohyphal and invasive growth[14]. Sfl1, as a transcription repressor, interacts directly with Ssn6. And in vivo repression data suggest that Sfl1 inhibits transcription by recruiting Ssn6-Tup1 via a specific domain in Sfl1[15]. The ability of yeast to respond to environmental stress is important for their adaptation to hostile environment. Such responses often require significant changes in gene expression. Understanding the molecular mechanisms for the regulation of gene expression under stress conditions is of great importance for understanding cell adaptation[16]. Various studies in C. albicans have led to the identification of a large set of genes which are differentially induced in response to different stresses, including heat-shock protein genes (HSPs). In S. cerevisiae, Sfl1 plays a positive role in maintaining the basal expression of HSP30 and is also required for the full induction of the gene in response to various stresses[17]. Here, we describe the identification and functional characterization of CaSFL1, which is the orthologue of ScSFL1. We constructed Casfl1Δ/Δ mutants to determine whether deletion of CaSFL1 can affect morphogenesis and the expression of target genes.

mmol/L (NH4)2SO4) for 4 d at 30℃. (i) Embedded growth. C. albicans cells were pregrown in YPD and diluted into melted YPD agar at 50℃ before poured into plates. These plates were incubated at 30℃ for 48 h. (ii) RNA isolation and RT-PCR. Cells were spun down by centrifugation. After adding an equal volume of acid-washed glass beads (Sigma), the cells were lysed by bead-beating at 4 ℃ in Micro Smash™ (Model MS-100, TOMY). Then total RNAs were isolated according to the manufacturer’s protocol (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press). The RNAs were reverse-transcribed using the One Step RNA PCR kit (AMV, TAKARA). Then the cDNA products were used as templates for PCR-amplification of target genes using appropriate primers. For normalization, ACT1 cDNA was amplified. The PCR program included an initial 5-min hot start at 94℃ which was followed by 27 cycles of 30 s of denaturation at 94℃, 30 s of annealing at 50℃ and 30 s of elongation at 72℃. A 7-min extension at 72℃ was

added at the end of the program. (iii) Stress conditions. Cells were grown in YPD medium to mid-log phase (A660 = 0.8). For ethanol stress conditions, ethanol was added to a final concentration of 6% and the cells were incubated at 30℃ for 1 h. For heat shock, cultures were shifted from 30℃ to 42℃ for 1 h prior to harvesting.

2 Results 2.1 Identification of CaSFL1 gene A BLAST search identified in the Candida Genome Database (http://www.candidagenome.org) a single open reading frame (orf19.454) annotated as CaSFL1. CaSFL1 encodes a protein of 805 amino acids (aa), which is longer than the 766-aa-long ScSfl1. However, sequence alignment revealed 42.7% identity between the regions corresponding to aa 113―223 of CaSfl1 and aa 61―205 of ScSfl1, and this region of each protein has a high degree of similarity with the DNA-binding domain (HSF domain) of heat-shock transcription factors (Figure 1). The shared high sequence identity and similar

Figure 1 Comparison of the domain organization of CaSfl1 and ScSfl1. SMART analysis indicates that both proteins contain one HSF domain at a similar position. Black box indicates the HSF domain. 2626

ZHANG TingTing et al. Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

2.2 Construction of the Casfl1Δ/Δ mutant and the revertant strain.

MEDICAL MICROBIOLOGY

To investigate the function of CaSFL1, we constructed a Casfl1Δ/Δ strain (DT1) by replacing one copy of CaSFL1 with ARG4 and the other with HIS1 in strain BWP17 (Figure 2). Because DT1 is Ura-, we introduced

URA3 on plasmid CIP10 by integration at the RP10 locus to create the strain DT2, which was used as Casfl1Δ/Δ mutants in all experiments in our study. To confirm that all the defects of the Casfl1Δ/Δ mutant were the result of CaSFL1 deletion, CaSFL1 with its own promoter was cloned in CIP10 and reintroduced into TD2 by integration at CaSFL1 locus (DT3). This strain was used in all the experiments described below

ARTICLES

domain organizations suggest that CaSfl1 is very likely the orthologue of ScSfl1.

Figure 2 Construction of the Casfl1Δ/Δ mutant and the revertant strain. (a) Gene deletion cassettes were constructed by flanking a marker gene, HIS1 or ARG4, with AB and CD DNA fragments (about 300 bp each) corresponding to the 5′ and 3′ untranslated regions (UTR) of the target gene, respectively. The AB and CD fragments with 10-bp overlapping sequence were PCR-amplified from genomic DNA using appropriate oligonucleotide primers containing the added BamHI sites to facilitate ligation. (b) Restriction enzyme digestion of gene deletion cassettes. (c) Using the LiAc transformation method, the gene deletion cassettes were transformed into BWP17 (arg4Δ/Δ, his1Δ/Δ and ura3Δ/Δ). The transformants were selected using appropriate dropout GMM media and the deletion strains were verified by PCR. (d) PCR verification of CaSFL1 deletion mutants. (e) Introduction of URA3 on plasmid CIp10 by integration at the RP10 locus to create strains which is only deleted of CaSFL1. CaSFL1 with its own promoter was cloned in CIp10 and reintroduced into the Casfl1Δ/Δ strain by integration at the CaSFL1 promoter region. (f) PCR verification of Casfl1Δ/Δ+URA3 (left) and Casfl1Δ/Δ+CaSFL1 (right). ZHANG TingTing et al. Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

2627

that compared the phenotype of Casfl1Δ/Δ (DT2) with the wild type (SC5314) and was found to be indistinguishable from wild type, indicating that the defects of Casfl1Δ/Δ cells were the consequence of CaSFL1 deletion.

type and Casfl1Δ/Δ mutants when grown in YPD containing 20% serum and in RPMI1640 medium (Figure 4).

2.3 Deletion of CaSFL1 results in flocculation and filamentation After we obtained the Casfl1Δ/Δ mutant, we examined its viability, growth and morphology. The result showed that wild type and the Casfl1Δ/Δ mutant did not differ either in growth rate or cell size in YPD (data not shown). However, deletion of CaSFL1 led to the formation of cell clumps and flocculation during growth in liquid GMM even when shaken vigorously at 200 r/min (Figure 3(a)). In addition, about 29.5% of the cells exhibited hyphae-like growth (Figure 3(b)). Such growth was not observed in YPD liquid medium at 30℃.

Figure 4 Hyphal growth of SC5314, the Casfl1Δ/Δ mutant and the revertant in hyphal-induction media. The cells shown were inoculated into YPD containing 20% serum or into RPMI1640 or Spider liquid media and incubated at 37℃ for 10 h. DIC microscopic photographs of cells are shown. Bars indicate 10 μm.

Figure 3 Cell morphogenesis of SC5314, the Casfl1Δ/Δ mutant and the revertant. (a) Cells of SC5314, the Casfl1Δ/Δmutant and the revertant were grown to mid-log phase in liquid GMM at 30℃. Photographs of differential interference contrast (DIC) microscopy are shown. Bars indicate 10 μm. (b) Percentage of elongated cells was counted. * denotes a statistically significant difference (P < 0.05, Student’s t-test, two-tailed) between wild type and the mutant.

To investigate whether CaSFL1 is involved in hyphal growth, we examined cell morphology in several hyphal-induction conditions including YPD containing 20% serum, Spider medium and RPMI1640 medium. Microscopic inspection revealed that the Casfl1Δ/Δ mutants grew longer hyphae than wild type and the revertant strain in liquid Spider medium. However, there is no difference in the degree of hyphal growth between wild 2628

Because of the observed difference in cell morphogenesis between growth in GMM and YPD, growth on SLAD plates was then used to evaluate pseudohyphal growth under nitrogen starvation. The results showed that the Casfl1Δ/Δ mutant exhibited greater filamentous growth in comparison with wild type and the revertant (Figure 5(c)). Besides nutritional factors, many other environmental stimuli may induce C. albicans filamentous growth, including low oxygen. Our results showed that 35.6% of the Casfl1Δ/Δ mutant cells developed into hyphae in a certain concentration of oxygen which was not low enough to induce hyphal growth in wild type cells in liquid GMM medium at 30℃ (Figure 5(a)). We then went on to examine the growth phenotype of the Casfl1Δ/Δ mutant under embedded conditions in YPD agar at 25℃. While wild type and the revertant showed some filamentation under this condition, the Casfl1Δ/Δ mutant consistently exhbited much more abundant filamentous growth. This result suggests that CaSfl1p acts as a repressor of filamentation under micro-aerophilic

ZHANG TingTing et al. Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

ARTICLES

conditions (Figure 5(b)). 2.4 Some hypha-specific genes are down-regulated in Casfl1Δ/Δ mutant. To determine whether the flocculation and increased filamentation of the Casfl1Δ/Δ mutant involve an altered transcriptional profile, we performed RT-PCR to analyze the expression of hypha-specific genes (HWP1, ECE1), agglutinin-like sequence containing genes (ALS1 and ALS3), and FLO8 which is a known positive tran- scription regulator of hypha-specific gene expression in C. albicans. ACT1 gene was included as control. The results showed that the transcriptional levels of all these genes were increased to different extents when CaSFL1 is deleted, suggesting that CaSfl1 negatively regulates the expression of these genes (Figure 6).

Figure 6 Hypha-specific genes are up-regulated in Casfl1Δ/Δ mutant. Cells of the wild type (SC5314, +/+) and the Casfl1Δ/Δ mutant (−/−) were grown in GMM for 6 h at room temperature and then harvested for RNA extraction for RT-PCR of the mRNAs of FLO8, ECE1, HWP1, ALS1, ALS3 and ACT1.

2.5 Positive regulation of HSP genes by CaSfl1 The N-terminal region of CaSfl1 has a high degree of similarity with the DNA-binding domain (HSF domain) of heat-shock transcription factors, suggesting that CaSfl1 may be involved in transcriptional regulation of

ZHANG TingTing et al. Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

2629

MEDICAL MICROBIOLOGY

Figure 5 Filamentous growth of SC5314, the Casfl1Δ/Δmutant and the revertant in aerophilic and nitrogen starvation conditions. (a) Aerophilic conditions. Cells were grown in both GMM and YPD liquid media for 6 h at 30℃. The percentage of elongated cells was counted. * denotes statistically significant difference (P < 0.05, Student’s t-test, two-tailed) between wild type and the mutant. (b) Casfl1Δ/Δ mutant shows increased filamentation under embedded growth conditions. Cells were embedded in YPD agar (2%) and grown for 48 h at 30℃. (c) Casfl1Δ/Δ mutants exhibited increased filamentation under nitrogen starvation. Photographs of colonies grown on low-ammonium medium (SLAD) plates are shown. Bars indicate 10 μm.

some heat-shock protein genes via binding specifically to the heat-shock elements (HSE) in the promoters. RT-PCR results showed that the expression of HSP30, HSP70, HSP90 in both wild type and Casfl1Δ/Δ mutants were hard to detect when the cells were grown in YPD at 30℃. However, while heat-shock stress (42℃, 1 h) up-regulated the expression of HSP30 and HSP90 in wild type, no up-regulation of the two genes was observed in the Casfl1Δ/Δ mutant. The expression of HSP30 was markedly increased in wild type under ethanol stress (6%, v/v, 1 h), but remained largely unchanged in the Casfl1Δ/Δ mutant under the same stress. These results suggest that CaSfl1 is involved in the transcriptional activation of HSP30 and HSP90 under the heat-shock condition (Figure 7).

Figure 7 Expression of HSP30, HSP70, and HSP90 in wild type and Casfl1Δ/Δ mutants under normal and stress conditions. Cells were grown in YPD to mid-log phase (A660 = 0.8) before transfer to stress conditions. After grown under either the ethanol stress condition (6%, v/v ethanol, 30 ℃, 1 h) or heat-shock conditions (42℃, 1 h), cells were harvested for RNA extraction followed by RT-PCR analysis of HSP30, HSP70, HSP90 and ACT1 mRNAs.

3 Discussion In C. albicans, the yeast-to-hypha transition is triggered by various environmental cues, such as serum, neutral pH, high temperature, starvation, CO2, and matrix[8]. Several genes that may mediate environmental responses have been identified and characterized including — CZF1, GCN1, and RIM1. In addition[19 21], there are many other transcription factors such as Efg1, Flo8, Cph2, Tec1, Ssn1, which generate a final transcription response for hyphal development[9,10]. In S. cerevisiae, ScSfl1 is known to be involved in the cAMP pathway to negatively regulate the transcriptional expression of filamentation-specific genes and agglutinin-like sequence-containing protein genes, thus, dele2630

tion of ScSFL1 enhances pseudohyphal and invasive growth and induce flocculation as well[14]. The shared high sequence identity and similar domain organization suggest that CaSfl1 is very likely the orthologue of ScSfl1. In this study, we constructed Casfl1Δ/Δ mutants to determine whether CaSFL1 is involved in the transcriptional regulation of genes relevant to morphogenesis. The results showed that a large number of Casfl1Δ/Δ mutant cells were found in aggregates and exhibited significant elongation. Hyphal induction experiments showed that the ability of Casfl1Δ/Δ mutants to grow hyphae is much stronger than wild type under some standard inducing conditions, such as in Spider’s medium, embedment in matrix and low nitrogen supply. Deletion of CaSFL1 reduces the threshold of hyphal induction. Therefore, CaSFL1 can repress cell filamentation. Recently, Bauer and Wendland[22] and Li[23] both reported the function of CaSFL1 in C. albicans, and their results are similar to ours, which further confirm that CaSfl1 is involved in cell morphogenesis. Transcriptional regulation can be either positive or negative. We preformed RT-PCR and found that the expression of hypha-specific genes (HWP1, ECE1), agglutinin-like sequence-containing protein genes (ALS1 and ALS3) and the transcription factor FLO8 are significantly increased in Casfl1Δ/Δ cells. The results are consistent with CaSfl1’s role as a negative transcription factor that represses cell aggregation and elongation via down-regulation of hypha-specific genes and the agglutinin-like sequence-containing protein genes. CaSfl1 contains a HSF domain and HSF binding sites have been found in the promoters of several hypha-specific genes, which may thus explain CaSfl1’s role in the transcriptional control of hypha-specific genes. Since Ssn6 is postulated to form a complex with the transcription repressor Tup1 in C. albicans[24,25], we propose that Sfl1 may bind to specific promoter sequences of hypha-specific genes and repress their expression by recruiting the Ssn6-Tup1 complex and Srb/mediator proteins. Since HSF domains often exist in transcription factors of heat-shock proteins, we examined transcriptional regulation of CaSfl1 on some heat-shock protein genes. Our data showed that deletion of CaSFL1 represses the expression of HSP30 and HSP90 under heat-shock conditions, suggesting that CaSfl1 may play a role in response and adaption to stress conditions in C. albicans, via positive transcriptional regulation of some heatshock proteins. This is the first report of CaSfl1 as a

ZHANG TingTing et al. Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

1 2 3 4 5 6

7 8 9 10

11

12

13

14

15

Calderone R A, Fonzi W A. Virulence factors of Candida albicans. Trends Microbiol, 2001, 9: 327―335 Morgan J. Global trends in candidemia: Review of reports from 1995 to 2005. Curr Infect Dis Rep, 2005, 7: 429―439 Richardson M D. Changing patterns and trends in systemic fungal infections. J Antimicrob Chemother, 2005, 56(Supp1.1): i5―i11 Berman J, Sudbery P E. Candida albicans: A molecular revolution built on lessons from budding yeast. Nat Rev Genet, 2002, 3: 918―930 Sudbery P, Gow N, Berman J, et al. The distinct morphogenic states of Candida albicans. Trends Microbiol, 2004, 12: 317―324 Zheng X D, Wang Y M, Wang Y, et al. Hgc1, a novel hypha-specific G1 cyclin-related protein regulates Candida albicans hyphal morphogenesis. EMBO J, 2004, 23: 1845―1856 Lo H J, Kohler J R, Fink G R, et al. Nonfilamentous C. albicans mutants are avirulent. Cell, 1997. 90: 939―949 Ernst J F. Transcription factors in Candida albicans - environmental control of morphogenesis. Microbiology, 2000, 146: 1763―1774 Liu H P. Transcriptional control of dimorphism in Candida albicans. Curr Opin Microbiol, 2001, 4: 728―735 Liu H P, Kohler J, Fink G R. Suppression of hyphal formation in candida albicans by mutation of a STE12 homolog. Science, 1994, 266: 1723―1726 Fujita A, Kikuchi Y, Kobayashi H. Domains of the SFL1 protein of yeasts are homologous to Myc oncoproteins or yeast heat-shock transcription factor. Gene, 1989, 85: 321―328 Kim T S, Lee S B, Kang H S. Glucose repression of STA1 expression is mediated by the Nrg1 and Sfl1 repressors and the Srb8-11 complex. Mol Cell Biol, 2004, 24: 7695―7706 Song W, Carlson M. Srb/mediator proteins interact functionally and physically with transcriptional repressor Sfl1. Embo, 1998, 17: 5757―5765 Robertson L S, Fink G R. The three yeast A kinases have specific signaling functions in pseudohyphal growth. Proc Natl Acad Sci USA, 1998, 95: 13783―13787 Conlan R S, Tzamarias D. Sfl1 functions via the co-repressor Ssn6-Tup1 and the cAMP-dependent protein kinase Tpk2. J Mol Biol,

16

17

18 19

20

21

22 23 24

25

26 27

2001, 309: 1007―1015 Kaufmann S H E, Schoel B. Heat shock proteins as antigen in immunity against infection and self. In: Morimoto R I, Tissieres A, Georgopoulos G, eds. The Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, 1994. 495―531 Virginie A G, Hervé A, Benoit B, et al. Sfl1 acts as an activator of the HSP30 gene in Saccharomyces cerevisiae. Curr Genet, 2007, 52: 55―63 Fonzi W A, Irwin M Y. Isogenics strain construction and gene mapping in Candida albicans. Genetics, 1993, 134: 717―728 Tripathi G, Wiltshire C, S, Brown A J, et al. Gcn4 co-ordinates morphogenetic and metabolic responses to amino acid starvation in Candida albicans. EMBO J, 2002, 21: 5448―5456 Davis D, Wilson R B, Mitchell A P, et al. RIM101-dependent and-independent pathways govern pH responses in Candida albicans. Mol Cell Biol, 2000, 20: 971―978 Brown D H, Giusani A D, Chen X, et al. Filamentous growth of Candida albicans in response to physical environmental cues and its regulation by the unique CZF1 gene. Mol Microbiol, 1999, 34: 651―662 Bauer J, Wendland J. Candida albicans Sfl1 suppresses flocculation and filamentation. Eukaryotic Cell, 2007, 6(10): 1736―1744 Li Y D, Su C, Chen J Y, et al. Roles of Candida albicans Sfl1 in hyphal development. Eukaryotic Cell, 2007, 6(11): 2112―2121 Garcia-Sanchez S, Mavor A L, Russell C L, et al. Global roles of Ssn6 in Tup1- and Nrg1-dependent gene regulation in the fungal pathogen, Candida albicans. Mol Biol Cell, 2005, 16: 2913―2925 Hwang C S, Huh W K, Kang S O. Ssn6, an important factor of morphological conversion and virulence in Candida albicans. Mol Microbiol, 2003, 47: 1029―1043 Piña B, Fernandez-Larrea J, Garcia-Reyero N, et al. The different (sur)faces of Rap1p. Mol Genet Genomics, 2003, 268: 791―798 Conlan R S, Gounalaki N, Hatzis P, et al. TheTup1-Cyc8 protein complex can shift from a transcriptional co-repressor to a transcriptional co-activator. J Biol Chem, 1999, 274: 205―210

ZHANG TingTing et al. Chinese Science Bulletin | September 2008 | vol. 53 | no. 17 | 2624-2631

2631

ARTICLES

found for the budding yeast transcription factor Rap1 that can act either as an activator or a repressor depending on the precise architecture of its binding site and its surroundings[26]. Another possible explanation for how Sfl1 can act as both a repressor and an activator is provided by a report showing that Sfl1 functions via the transcriptional corepressor Ssn6(Cyc8)-Tup8. Conlan and Tzamarias reported that Ssn6(Cyc8)-Tup8 plays a dual role in the regulation of certain genes in S. cerevisiae. For example, Ssn6(Cyc8)-Tup8 activates CIT2 transcription in response to mitochondrial dysfunction, but otherwise inhibits the basal expression of the same gene via Tup1. Therefore, CaSfl1 functions as both positive and negative regulator in Candida albicans possibly via the post-translational modifications of Ssn6(Cyc8)-Tup8 in response to specific signals[27].

MEDICAL MICROBIOLOGY

positive transcriptional regulator. The regulation may be achieved through direct binding of CaSfl1 to the heat-shock-like motifs (HSL) in the promoter region of the heat-shock protein genes. This is consistent with the function of ScSfl1 on HSP30 in S. cerevisiae[17]. An intriguing question is how Sfl1 can act as an activator when it has been shown to repress transcription? One possible explanation is that Sfl1 promotes the binding of other factors to the target promoters. The interaction of Sfl1 with these factors may determine its specific role as an activator or a repressor. We propose that Sfl1 may repress the expression of hypha-specific genes by recruiting the Ssn6-Tup1 complex and the Srb/mediator proteins. However, the factors mediating CaSfl1 regulation of the heat-shock protein genes is uncertain, which needs further investigations. A similar situation was