Neurotox Res DOI 10.1007/s12640-016-9657-x

ORIGINAL ARTICLE

Characterization of the Kynurenine Pathway in CD8+ Human Primary Monocyte-Derived Dendritic Cells Nady Braidy1 • Helene Rossez2 • Chai K. Lim3 • Bat-Erdene Jugder4 Bruce J. Brew2,5 • Gilles J. Guillemin3

•

Received: 4 April 2016 / Revised: 6 July 2016 / Accepted: 29 July 2016 Ó Springer Science+Business Media New York 2016

Abstract The kynurenine (KYN) pathway (KP) is a major degradative pathway of the amino acid, L-tryptophan (TRP), that ultimately leads to the anabolism of the essential pyridine nucleotide, nicotinamide adenine dinucleotide. TRP catabolism results in the production of several important metabolites, including the major immune tolerance-inducing metabolite KYN, and the neurotoxin and excitotoxin quinolinic acid. Dendritic cells (DCs) have been shown to mediate immunoregulatory roles that mediated by TRP catabolism. However, characterization of the KP in human DCs has so far only been partly delineated. It is critical to understand which KP enzymes are expressed and which KP metabolites are produced to be able to understand their regulatory effects on the immune response. In this study, we characterized the KP in human

& Nady Braidy [email protected] & Gilles J. Guillemin [email protected] 1

Centre for Healthy Brain Ageing, School of Psychiatry, Faculty of Medicine, University of New South Wales, Sydney, Australia

2

St Vincent’s Centre for Applied Medical Research, Sydney, Australia

3

Neuropharmacology Group, MND and Neurodegenerative Diseases Research Centre, Macquarie University, Sydney, NSW 2109, Australia

4

School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, Australia

5

Department of Neurology and HIV Medicine, St Vincent’s Hospital, Sydney, Australia

monocyte-derived DCs (MDDCs) in comparison with the human primary macrophages using RT-PCR, high-pressure gas chromatography, mass spectrometry, and immunocytochemistry. Our results show that the KP is entirely expressed in human MDDC. Following activation of the KP using interferon gamma, MDDCs can mediate apoptosis of Th cells in vitro. Understanding the molecular mechanisms regulating KP metabolism in MDDCs may provide renewed insight for the development of novel therapeutics aimed at modulating immunological effects and peripheral tolerance. Keywords Human monocyte-derived dendritic cells  Kynurenine pathway  Indoleamine 2,3 dioxygenase  Quinolinic acid Abbreviations QUIN Quinolinic acid KP Kynurenine pathway IDO Indoleamine 2,3-dioxygenase TDO Tryptophan 2,3-dioxygenase 3-HAA 3-Hydroxyanthranilic acid 3-HAO 3-Hydroxyanthranilate dioxygenase QPRTase Quinolinate phosphoribosyltransferase KYN Kynurenine KYNA Kynurenic acid 3-HK 3-Hydroxykynurenine PIC Picolinic acid KYNase Kynurenase KAT Kynurenine amino transferase KMO Kynurenine e hydroxylase GC–MS Gas chromatography–mass spectrometry MDDC Monocyte-derived dendritic cells MdM Blood monocyte-derived macrophages ACMSDase Picolinic carboxylase

123

Neurotox Res

Introduction Within the central nervous system (CNS), more than 95 % of L-tryptophan (TRP) is catabolized through the kynurenine (KYN) pathway (KP), resulting in the production of the essential pyridine nucleotide, nicotinamide adenine dinucleotide (NAD?), and several neuroactive and immunoregulatory intermediates which can be neurotoxic or neuroprotective (Stone 1993). These intermediates include the N-methyl-D-aspartate (NMDA) receptor agonist and neurotoxin quinolinic acid (QUIN), the free radical generators 3-hydroxykynurenine (3-HK), and anthranilic acid (AA; Lapin et al. 1982; Schwarcz et al. 1983; Stone 1993). Kynurenic acid (KYNA) and picolinic acid (PIC), two other KP products, are antagonists of the NMDA receptor and are neuroprotective (Foster et al. 1984; Jhamandas et al. 2000). The antioxidant potential of another KP intermediate, 3-hydroxyanthranilic acid (3HAA) has been recently established (Krause et al. 2011). There is good evidence that the KP is involved in the neurotoxicity associated with the pathogenesis of several inflammatory brain diseases (Heyes 1996; Guillemin et al. 2005a, c; Hartai et al. 2005). Indoleamine 2,3-dioxygenase (IDO) is constituently expressed by astrocytes, neurons, and microglia, although only the latter is capable of producing pathological quantities of QUIN. While KYN is produced by the brain in substantial quantities, the cerebral pathway is regulated by circulating KYN that enters the CNS using large neutral amino acid transporters. KYN is taken up by glial cells and catabolized into end products which are then released extracellularly. In addition to these activities, the KP has been found to be a key regulator of the immune response in relation to tolerance (Moffett and Namboodiri 2003) with particular relevance to pregnancy (Munn et al. 1998), tumour persistence, and transplantation. There is evidence that both tryptophan depletion and utilization with the generation of certain KP products, especially KYN, are responsible for this immune tolerance (Wirthgen and Hoeflich 2015). Two theories, non-mutually exclusive, have been proposed: (1) that TRP degradation suppresses T cell proliferation by dramatically depleting the supply of this critical amino acid, and (2) that some downstream KP metabolites suppress certain immune cells (Moffett and Namboodiri 2003). Induction of the KP regulatory enzyme IDO in dendritic cells (DCs) completely inhibits clonal expansion of T cells (Mellor et al. 2003). Activation of the KP is likely be used by HIV to favours its persistence by weakening the anti-viral immune response. The KP is also involved in other important physiological functions such as behaviour, sleep, and thermo-regulation (Stone 1993; Curzon 1996).

123

Despite growing evidence of the numerous roles of KP metabolism as a mechanism of immunosurveillance, there are several features of the pathway that remain nascent. The cellular representation of the KP has been shown to be fully present in macrophages and microglial cells (Heyes et al. 1992; Espey et al. 1997; Guillemin et al. 2003a) and partly present in astrocytes (Guillemin et al. 2001). While human macrophages possess the machinery necessary to convert TRP to produce large quantities of QUIN, no information is present regarding the functional expression of KP enzymes apart from IDO in human DCs. Clarification of the involvement of the KP is crucial for increasing our understanding of the important role of TRP metabolism in cellular degeneration, health and disease, and the development of immunotherapies modulating the function of IDO. Activation of KP enzymes are regulated at both the transcriptional and translational levels. Interferon gamma (IFN-c) is the principle regulator of Indo transcription. One study previously showed that IFN-c can modify the immunogenic properties of CD8? but not CD8- in an IDOdependent manner (Heyes et al. 1997; Pemberton et al. 1997). Although the protein expression of IDO is comparable on both CD8? and CD8- cells, IFN-c could not induce KP metabolism in CD8- cells. To define the KP in human monocyte-derived DCs (MDDCs), we used primary cultures of CD8? human MDDC cells stimulated with IFNc. We assessed the presence of the major KP enzymes by qualitative and quantitative PCR. In addition, we measured the concentration of important KP substrates and intermediates: TRP, KYN, KYNA, as well as the end products QUIN and PIC. We used immunocytochemistry to study the cellular localization of some of the KP enzymes and metabolites. Finally, we assessed the significance of the KP in DCs by determining the effect of KP inhibition on T cell apoptosis in vitro.

Materials and Methods Ethics Approval Human blood was obtained following informed written consent. This study has been approved by the Human Ethics Committees (HREC 08284) from the University of New South Wales and the University of Sydney. Reagents and Chemicals All cell culture media and additives were from Life Technologies (Gaithersburg, MA, USA) unless otherwise stated. DAPI and AraC were obtained from Sigma-Aldrich Chemical Co. (Sydney, NSW, Australia). Mouse mAb anti-

Neurotox Res

CD68 clone KiM1P was gratefully provided by Dr. Parwaresch (University of Kiel, Germany) and was used at a concentration of 10 lg/mL. Polyclonal antibody (pAb) anti-QUIN was purchased from Chemicon (Melbourne, VIC, Australia). Mouse mAb anti-IDO and mouse mAb anti-KYNaserenine hydroxylase (KMO) were respectively and gratefully provided by Prof. O. Takikawa (Japan) and Prof. T. Uemura (Japan). These two antibodies were respectively used at a concentration of 10, 10, and 2 lg/ mL. Secondary anti-mouse IgG and anti-rabbit Alexa 488 (green) or Alexa 594 (Red)-conjugated antibodies were purchased from Molecular probes (Eugene, OR, USA). All commercial antibodies were used at the concentrations recommended by the manufacturer. Cell Cultures

in AIM-V, a serum-free medium containing no detectable QUIN (Invitrogen, Melbourne, VIC, Australia). Qualitative PCR Detection of mRNA Expression of KP Enzymes The qualitative PCR protocol, primer sequences (Table 1), and PCR run sequences (Table 2) were previously described (Guillemin et al. 2001). Negative controls were (a) omission of a target template, (b) omission of reverse transcriptase, and (c) genomic DNA. Amplified products were quantified after scanning using ImageJ1.34s (NIH, Bethesda, MA, USA). Experiments were performed in triplicate on cultures derived from five different foetal brains. Based on image analysis intensity ratios of KP enzyme mRNA expressed relative to GAPDH mRNA, the standard error was between 4 and 5 %.

MDDC Generation and Culture Monocytes were isolated from 500 mL of blood (Parramatta Blood Bank, Australia) by counter current elutriation as previously described (Turville et al. 2001). Monocytes were further depleted of contaminating cells using a monocyte-enrichment cocktail (Stem Cell Technologies, Vancouver, BC, Canada). Monocyte fractions were at least 97 % CD11c1ve, at least 90 % CD141ve, and 0.1 % or less CD31ve. DCs were converted as previously described (Turville et al. 2001) using 500 U/mL interleukin-4 and 400 U/mL granulocyte–macrophage colony-stimulating factor (Schering-Plough, Kenilworth, NJ). At day 6, cells were at least 95 % CD1a1ve, CD11c1ve with no detectable CD14, CD3, or CD83 populations. CD8? DCs were further isolated by means of CD8a MicroBeads (Miltenyi Biotec). MDDCs were matured by culture for 48 h with 10 ng/mL TNF-a (R&D Systems, Minneapolis, MN). Human peripheral blood mononuclear cells (PBMCs) used for RT-PCR were isolated from the blood of healthy volunteers (Centre for Immunology, Sydney, Australia) using a standard Ficoll-paque (Amersham) density separation method as previously described (Kerr et al. 1997a, b). Briefly, human PBMCs were isolated from the blood of healthy volunteers (Centre for Immunology, Sydney, Australia) using a standard Ficoll-paque density separation method as previously described (Kerr et al. 1997a, b). Monocyte-derived macrophages (MdM) were obtained using a classic adherence method. Briefly, isolated PBMCs were added to Falcon Primaria 24-well plates (Becton–Dickinson, Australia) containing RPMI medium, 10 % autologous human serum, 2 mM glutamine, 200 IU/ mL penicillin G, and 200-lg/mL streptomycin sulphate. After 8 days in vitro, the human serum component of the medium was eliminated completely, and cells maintained

qPCR For the gene expression studies, RNA was extracted from treated human DCs and macrophages using the RNeasy mini kits (Qiagen, Hilden, Germany). The cDNA was prepared using the SuperScript III first-strand synthesis system and random hexamers (Invitrogen Corporation). Briefly, for each reaction, 2 lL of diluted cDNA, 10 lL of SYBR green master mix, 0.15 lL of 10 lM forward and reverse primers, and 7.7 lL of nuclease-free water were used to making a total volume of 20 lL. qPCR was carried out using the Mx3500P real-time PCR system (Stratagene, NSW, Australia). The primer sequences for qPCR are shown in Table 3. The relative expression levels of KP enzyme transcripts were calculated using a mathematical model based on the individual qPCR primer efficiencies, and the quantified values were normalized against the housekeeping gene 18S. From these values, fold-differences in the levels of transcripts between individual untreated and treated cell cultures were calculated according to the formula 2DDCt : Immunocytochemistry The method for immunocytochemistry was previously described (Guillemin et al. 1997). DCs were grown in Permanox chamber slides for 2–3 days. After 72 h, control (untreated) and IFN-c-treated cells were fixed with acetone/methanol (vol/vol) for 20 min at -20 °C. Cells were then rinsed three times with PBS and a gentle membranous permeabilization was performed by incubation with 0.025 % Triton X 100 in PBS for 10 min at room temperature. After washing, cells were incubated with 5 % normal goat serum (NGS) in PBS for 45 min at room

123

Neurotox Res Table 1 Primer sequences used to investigate the mRNA expression of KP enzymes in human CD8? DCs and macrophages in the presence and absence of immune activation

Table 2 Summary of qualitative PCR run sequences

Genes

Forward sequence 50

Reverse sequence 50

Band sizes

Annealing temperature (°C)

IDO-1

ggcccaaagaagtttgcag

ggaagttcctgtgagctggt

160

60.0

IDO-2

cagacagtgccttttcacca

gtgcatccgagaaacaacct

367

60.8

KYNase

tgcatcagcgatgaggttta

ttcttcagcagcatccagtg

621

59.7

KAT-1

ggaagcgtccttggattaca

atcgtatgggcatgcttttc

589

60.8

KAT-2

ccaagcttcaatctgcacac

caaacggagttgattgctca

535

57.3

KMO

aagaagcccctgtggtgac

cacaaacaggatgcccagta

506

59.7

3-HAAO

caactgccaagtctcctggt

ctccaccttcagagcgaagt

397

58.0

QPRTase

agctaccccaggaggtttgt

gcaaatggctatggtggtct

297

58.0

ACMSDase

acccagaagactgtggatgg

cttggcaggtttttccagac

213

60.0

Cycle repeats on step (2) 35

Temperature (°C)

Run time (min)

Steps

Denaturation

94

4.5

1

Denaturation

94

1

2

Hybridization

Specify in Table 3

1

Extension

72

1.5

Extension

72

10

temperature, and rinsed twice with PBS and incubated for 1 h at 37 °C with selected primary antibody mAb or pAb diluted in 5 % NGS. Cells were then washed with 5 % NGS solution and incubated for 1 h at 37 °C with the appropriate labelled secondary antibodies (goat anti-mouse IgG or goat anti-rabbit coupled with Alexa 488 or Alexa 594). Nuclear staining was performed using DAPI at 1 lg/ mL for 5 min at room temperature. After several washings with PBS at 37 °C, the cover slips were quickly mounted on glass slides with Fluoromount-G and were examined with an Olympus BX60 fluorescence microscope associated with a digital SensiCam. The following three controls were performed for each labelling experiment: (1) isotypic antibody controls for mAbs and serum control for pAbs, (2) incubation with only the secondary labelled antibodies, and (3) estimation of auto-fluorescence of unlabelled cells. High-Pressure Gas Chromatography (HPLC) TRP levels were measured using an Agilent 1100 series HPLC system equipped with a G1329A temperature-controlled autosampler, a G1314A variable wavelength detector, a G1321A xenon flash lamp fluorescence detector and a Zorbax 300SB C18 reversed phase 4.6 9 250 mm column (Agilent Technologies, North Ryde, NSW, Australia), and mobile phase consisting of ammonium acetate buffer (0.1 M, pH 4.65) containing 0.02 % (v/v) acetonitrile. KYN was measured by UV absorbance at 365 nm, and TRP was measured using fluorescence (Ex285 nm/ Em365 nm) after post-column derivatization with zinc acetate as previously described (Kapoor et al. 1994). Limits

123

3

of detection was calculated (based on the number of moles of TRP detected in a 100 lL injection onto the HPLC column) to be: TRP, 65 pmol, KYN, 200 fmol, and KYNA, 10 fmol, which are consistent with previous data (Kapoor et al. 1994). KYNA was measured by fluorescence (Ex254 nm/Em404 nm) after post-column derivatization with zinc acetate as previously described (Kapoor et al. 1994). Data related to cellular production of TRP metabolites have the background values (due to traces in serum and medium) for each metabolite subtracted in order to represent net cellular production. All results are expressed as the mean ± the standard error of measurement (SEM). Gas Chromatography/Mass Spectrometry (GC/MS) Culture supernatants of growing cells in culture stimulated with and without IFN-c (100 U/mL) for 24 h were assayed for QUIN and PIC as previously described (Kerr et al. 1997a, b). QUIN concentrations were calculated with the following formula: total concentration of QUIN (in nanomolar) detected in cell culture supernatants minus the concentration of QUIN (in nanomolar) present in the culture medium before addition to cells. The GC/MS method used for the analysis of PIC and QUIN has been described previously (Smythe et al. 2003). Briefly, the internal standards used were PIC conjugated with deuterium D4PIC and QUIN conjugated with deuterium D3-QUIN. QUIN and PIC samples were analysed by GC–MS with the spectrometer operating in electron capture negative ionization mode. Selected ions (m/z 273 for PIC and m/z 277 for D4-PIC) were then monitored (Smythe et al. 2002).

Neurotox Res Table 3 Primers used in qPCR analysis of KP enzymes Genes

Efficiency (%)

# of values for std. curve

Ct at lowest concentration

IDO-1

99.5

5

30 (0.0008 ng)

Ct at highest concentration 17 (80 ng)

Tm

79.8

Sequence Forward: 50 Reverse: 50 gactacaagaatggcacacgctatg ccagactctatgagatcaggcagatg

IDO-2

115

5

36 (0.026 ng)

27.5 (80 ng)

77

TDO

104

5

29 (0.005 ng)

19.5 (80 ng)

79.3

aagatagaggatgctgacaata tccgttcccatatcattaact cggtggttcctcaggctatcac tggttgggttcatcttcggtatcc

KYNase

101

5

31 (0.008 ng)

22.5 (80 ng)

82.2

gactattccacctaagaacggaga acaggaagacacaaactaaggtcg

KAT-1

110

6

32 (0.1 ng)

23.5 (102 ng)

KAT-2

100

5

30 (0.4 ng)

23 (102 ng)

KAT-3

102

5

32 (0.008 ng)

81

caccactgacgaagatcctgg ctgagcgggtctatctcctga

19.5 (80 ng)

84.6 78.3

gatagacccgctcaggaatgt atgacctcgtctccttcgtcc cgctgatgtgtctttgctagatcc cagaatgctgaaacggggatgg

KMO

106

4

32 (0.08 ng)

23 (80 ng)

QPRTase

89

4

32 (1.6 ng)

22.5 (102 ng)

76.8

gcatctactaggtgacagccactg aactctgccaggaagagccttatc

91

atttacccaactcaactgccaagtc ctgccacgtgcccagtccag

3-HAAO

99

5

30 (0.008 ng)

18 (80 ng)

85.4

gcgaaggcggctggagac tcagagctgaagaactcctggatg

ACMSDase

108

4

37 (0.1 ng)

29 (102 ng)

80

tgaacccgaagaaatacct cagctcacctagtggaaa

Efficiency is presented as a percentage, Ct value at lowest detectable concentration represents the level of primer sensitivity for low cDNA concentration. Ct value at highest cDNA concentration represents the Ct value beyond which results are not reliable, due to inhibiting factors, Tm is the melting temperature on the dissociation curve where the peak for each specific PCR product appears

Briefly, the protein was precipitated in culture supernatants by the addition of an equal volume of 10 % TCA (1:1) and centrifuged at 1000 rpm for 5 min. For the derivatization procedure, standards and sample solutions (10–50 lL) were then transferred to glass tissue culture vials (100 9 10 mm) with the addition of 10 lL PIC and 20 lL QUIN internal standards and then evaporated to dryness using the SpeedVac. 60 lL of TFAA and 60 lL of HFP were then added to the residues. The glass vials were then capped and sealed immediately and heated at 60 °C for 30 min to produce the hexafluoroisopropyl ester of the respective acids. The ester products were then dissolved in 180–250 lL of toluene, washed with 5 % sodium bicarbonate (1 mL) and water (1 mL), dried over anhydrous sodium sulphate (approx. 500 mg), and transferred to autosampler vials prior to injection (1 lL) into the GC/MS via 7683 autosampler (Agilent). The final concentrations of unknowns were calculated by interpolation of the standard curve. The limits of quantification were ±1 fmol (injected onto the column) at signal-to-noise ratios of 10:1. Experiments were performed in triplicate. All results are expressed as the mean ± SEM.

T Cell Cultures Total human PBMCs were isolated by density gradient sedimentation using Histopaque-1077 (Sigma) according to the manufacturer’s protocol. Briefly, whole blood was layered on an equal volume of Histopaque and centrifuged at 2000 rpm for 20 min at room temperature and stopped without any brake. PBMCs were isolated and resuspended in RPMI 1640 ? 10 % FBS and pelleted by centrifugation at 2000 rpm for 10 min and were further washed twice in PBS ? 1 % FBS. Using PE-conjugated mouse anti-human CD3 mAb (BD, Oakville, ON), FITC-conjugated mouse anti-human CD4 mAb (BD), and allophycocyanin-conjugated mouse anti-human CD8 mAb (BD) at the concentration of 20 lL/106 cells, we stained the PBMCs. The cells were then incubated at room temperature for 30 min. Thereafter, cells were washed twice and resuspended at 107 cells/mL in PBS ? 1 % FBS for fluorescent-activated cell sorting (FACS). For preparation of a pure population of CD3?CD4? and CD3?CD8? T cells, we gated on CD3?CD4? and CD3?CD8? T cells after excluding the dead cells and cell debris based on FSC and SSC

123

Neurotox Res

parameters and sorted these two cell populations into separate tubes. After being sorted from blood, T cells were propagated in RPMI 1640 (Hyclone, UT) supplemented with 10 % FBS, 0.1 U penicillin/mL, and 0.1 mg streptomycin/mL at 37 °C in a humidified 5 % CO2 atmosphere to be used for further treatment. T Cell Survival The survival of CD4? T cells in the presence or absence of 4 lM of the IDO inhibitor, dextro-1-methyltryptophan (1-MT), 4 lM of the inhibitor to KMO, tranilast (an analogue of 3-HAA), CD8? DCs, and IFN-c was compared with 7-AAD staining. 7-AAD intercalates into double-stranded nucleic acids and penetrates cell membranes of damaged cells. After each treatment, cells were harvested, washed in PBS, stained for 7-AAD, and then examined using FACS analysis, according to the manufacturer’s protocol (BD). Flow Cytometry The method for flow cytometry has been previously described (Sheipouri et al. 2015). Briefly, cells were harvested and 0.2 9 106 cells were aliquoted into FACS tubes. Cells were washed two times by adding 2 mL PBS, centrifuging at 3009g for 5 min, and then decanting the buffer from pelleted cells. Afterwards, cells were resuspended in 100 lL of flow cytometry staining buffer (R&D Systems). We then added 5 lL of 7-AAD staining solution (1 mg/mL 7-AAD in PBS) to a control tube of unstained cells, mixed gently, and incubated for 30 min at 4 °C in the dark. 7-AAD is a membrane impermeant dye that is released from viable cells. 7-AAD can be excited at 488 nm with an argon laser. It has a relatively large Stokes shift, emitting at a maximum wavelength of 647 nm. A minimum of 104 viable cell-gated events were acquired using the FL-2 channel on a FACScalibur flow cytometer using Cell Quest software (Becton–Dickinson, Grenoble, France), and data were analysed using WinMDI software (developed by JC Trotter). For flow cytometry, 0.2 9 106 cells were stained along with appropriate isotypic controls. Statistical Analysis Results obtained are presented as the means – SEM. Oneway analysis of variance and post hoc Tukey’s multiple comparison tests were used to determine statistical significance between treatment groups. Differences between treatment groups were considered significant if p was less than 0.05 (p \ 0.05).

123

Results Expression of KP Enzymes in Human DCs and Macrophages Primer sets were developed and validated to identify mRNA transcripts for IDO, tryptophan 2,3 dioxygenase (TDO), kynureninase (KYNase), kynureninase aminotransferase I (KAT-1), kynureninase aminotransferase II (KAT-2), kynureninase aminotransferase III (KAT-3), kynureninase 3-hydroxylase (KMO), quinolinate phosphoribosyl transferase (QPRTase), 3-hydroxyanthranilate 3,4-dioxygenase (3-HAAO), and picolinic carboxylase (ACMSDase). All enzymes were analysed 24 h after application of IFN-c (100 IU/L) as indicated by time course studies examining the mRNA expression of KP enzymes (Guillemin et al. 2007). Using RT-PCR, we have shown herein that all of the investigated transcripts were found to be expressed in human DCs and macrophages, however, in highly variable levels (Fig. 1a). IDO was expressed in both stimulated and unstimulated DCs and macrophages, and strong IDO expression was detected after IFN-c stimulation in both cell types. TDO and KYNase were expressed by both IFNc stimulated and unstimulated DCs and macrophages. TDO and KYNase expressions were significantly increased following IFN-c stimulation in both cell types. Both IFN-c stimulated and unstimulated DCs and macrophages showed low expression of both KAT-1 and KAT-2. The expression of KAT-1 was significantly greater in macrophages than DCs. KMO and 3-HAAO were clearly expressed in both DCs and macrophages. The expression of QPRTase and ACMSDase was detectable in stimulated and unstimulated DCs and macrophages at low levels. We further quantified the mRNA expression of KP transcripts using qPCR (Fig. 1b). Transcripts encoding IDO-1 were expressed at 2-fold of untreated DCs and 10-fold of untreated macrophages following treatment with IFN-c. The basal expression of IDO-1 was significantly greater in DCs (5-fold) compared with macrophages. Transcripts encoding IDO-2 showed no significant changes following treatment with IFN-c. Transcripts encoding IDO-1 were expressed at 2-fold of untreated DCs and 4-fold of untreated macrophages following treatment with IFN-c. KYNase levels showed significant increases by IFN-c (4.2- and 5.0-fold, respectively) in DCs and macrophages. A significant decline in response to IFN-c treatment was also reported for KAT-1 (1.1- and 1.2-fold, respectively), KAT-2 (1.5- and 1.8-fold, respectively), and KAT-3 (2.0- and 2.1-fold, respectively) in DCs and macrophages. KMO transcripts in DCs and macrophages showed up regulation (3.1-, and 4.4-fold increased,

Neurotox Res

Fig. 1 a Detection of KP enzyme expression using PCR. a Ethidium bromide-stained gels showing mRNA expression for (from top to bottom) IDO, TDO, KYNase, KAT-1, KAT-2, KMO, HAAO, QPRTase, ACMSDase, and GAPDH expression. The first column corresponds to unstimulated CD8? DCs, the second to IFN-cstimulated CD8? DCs, the third to unstimulated human macrophages, and the fourth to IFN-c-stimulated macrophages, and used as a positive control for KYNaserenine pathway enzyme expression.

b Relative levels of transcripts encoding enzymes in the KP (IDO-1, IDO-2, TDO, KYNase, KAT-1, KAT-2, KAT-3, KMO, QPRTase, 3-HAA, and ACMSDase) following treatment with IFN-c (100 U/mL). Levels of all transcripts are normalized to levels observed in untreated control cells (base-line) and expressed in a logarithmic scale. *p \ 0.05 compared with control in human DCs (n = 3 for each treatment group)

Fig. 2 Immunodetection of KP enzymes and products in human DCs. Cultures of human DCs were immunostained for the enzymes IDO, KMO, as well as for QUIN and CD1a as indicated

123

Neurotox Res Fig. 3 Quantification of KP products by HPLC and GC/MS. Media samples derived from cultures of DC cells either untreated or treated for 24 h with 100 IU/mL IFN-c were analysed by HPLC for TRP (a), KYN (b), KYNA (c), and using GC/MS for QUIN (d) and PIC (e). Statistical differences comparing the untreated and IFN-c-treated conditions (a–e). *p \ 0.05 compared to control in human DCs (n = 3 for each treatment group)

respectively). 3-HAAO displayed up regulation of transcripts following treatment with IFN-c (2.1- and 2.9-fold, respectively). Levels of transcripts encoding QPRTase showed a significant decrease in response to IFN-c (2.5-

123

and 2.9-fold decline, respectively) in DCs and macrophages. Transcripts encoding ACMSDase were down regulated by 3-fold in response to IFN-c in DCs and macrophages.

Neurotox Res

metabolite being analysed from levels present in control (untreated) cells. Concentrations of PIC in DCs decreased following immune stimulation with IFN-c (Fig. 3d). In contrast, QUIN concentrations increased significantly with IFN-c treatment (Fig. 3e) in DCs. Effect of IFN-c Treatment and KP Inhibition on Cell Survival Rate of T Cells

Fig. 4 IFN-c treatment and KP inhibition on cell survival rate of CD4? T cells. The results are shown for DCs treated with 1-MT, tranilast, and IFN-c. *p \ 0.05 compared to untreated cells

Immunocytochemical Detection of KP Components in DCs Immunocytochemical detection of KP enzymes is in general agreement with the real-time PCR results (Fig. 2). For DCs, immunostaining for IDO and KMO was perinuclear and cytoplasmic. QUIN immunostaining was located in the cytoplasm. In DCs, staining for the structural protein CD1a indicated localization throughout the cytoplasm. HPLC Quantification of TRP, KYN, and KYNA in DCs DCs were treated with IFN-c (100 IU/L) and allowed to incubate for 24 h at 37 °C before HPLC analysis. Concentrations were calculated as a change in the levels of the metabolite being analysed from levels present in control (untreated) cells. TRP levels were significantly reduced compared with non-treated groups (Fig. 3a). DCs treated with IFN-c showed a significant increase in KYN production (Fig. 3b). Changes in concentrations of KYNA occurred in DCs following treatment with IFN-c. Concentration of KYNA declined significantly in response to IFN-c treatment (Fig. 3c). GC/MS Quantification of PIC and QUIN in DCs DCs were treated with IFN-c (100 IU/L) and allowed to incubate for 24 h at 37 °C before GC/MS analysis. Concentrations were calculated as a change in the levels of the

As the KP has a profound effect on immune tolerance, it is vital to determine whether altered KP expression can also differentially influence the viability of immune cells. Therefore, we co-cultured DCs treated with IFN-c, 4 lM of the IDO inhibitor 1-MT, and 4 lM of tranilast (an inhibitor to KMO analogous to 3-HAA), with CD4? T cells. After day 4, bystander cells were collected, and their survival rates were determined using 7-AAD staining with flow cytometry. As demonstrated in Fig. 4, no significant differences were observed in cells co-cultured with nontreated DCs. Treatment with IFN-c significantly reduced survival rates for CD4? T cell (32 %). The decline in survival rates was attenuated in T cells exposed to DCs treated with IFN-c and 1-MT (62 %) and tranilast (78 %). Of interest, no significant difference on cell survival rate of T cells was observed either as such or after immune stimulation with IFN-c and inhibition of the KP with 1-MT and tranilast.

Discussion It is well established that DCs are major regulators of the immune response and are capable of promoting or suppressing T cell responses (Fig. 5). Apart from immune activation, accumulating evidence suggests that DCs are also capable of inducing tolerance to presenting antigens (Mellor and Munn 2004; Li and Shi 2015). However, the involvement of TRP metabolism as a mechanism of immunosurveillance requires further clarification. In particular, the contribution of IDO and other KP enzymes in immune tolerance, and the function of specific KP catabolites in immunosuppression remain unclear. In this study, we are the first to show that (1) IDO and KMO represent major targets for the pharmacological inhibition of the KP when 1-MT and tranilast are used to mediate enzyme inhibition, (2) the KP is fully expressed and functional in human MDDCs leading to the production of QUIN, (3) the KP is activated in response to IFN-c in MDDCs, (4) macrophages and DCs differ in their patterns of KP enzyme expression and modulation of T cell survival, and (5) inhibition of the KP downstream of IDO in DCs can prevent apoptosis and increase the survival rate of T cells treated with IFN-c.

123

Neurotox Res Fig. 5 Scheme indicating the expression of the KP in DCs and macrophages with respect to the production of KP metabolites and their effects on neurons and T cells

While it is well established that human macrophages can catabolize TRP to produce QUIN, little was previously known regarding the functional expression of the KP in human DCs apart from IDO. Previous work has shown that IDO is constitutive in CD8? murine DCs and IFN-c induction can stimulate QUIN production (Belladonna et al. 2006; Hu et al. 2006). On the contrary, while IDO expression is absent in CD8- cells, these cells are still capable of producing QUIN in the presence of KYN, a downstream metabolite of IDO (Fallarino et al. 2002; Belladonna et al. 2006; Orabona et al. 2006). Our study is the first to demonstrate the existence of a

123

functional KP in human DCs. Significant TRP metabolism is induced by IFN-c in macrophages and DCs. However, IDO-1 is more highly expressed in DCs under basal conditions compared with macrophages. Similar to what we have previously observed in astrocytes and microglial cells, IFN-c stimulation induces TRP depletion and increased production of KYN which is necessary for the production of QUIN (Guillemin et al. 1996, 1999, 2000, 2005b). The importance of KP enzymes and KMO in particular suggests that specific catabolism of KP metabolites takes place in DCs. This is further illustrated by the presence of similar positive

Neurotox Res

staining for selected KP enzymes and metabolites in human DCs using immunocytochemistry. In accordance with previous studies by our group, our data show that there is a significant reduction in the expression of KAT-1–3 following immune stimulation in DCs and macrophages. This is likely to shift the KP away from the production of KYNA, thus committing the KP towards QUIN production. KYNA is an endogenous antagonist of NMDA and a-7 nicotinic receptors, leading to neuroprotection (Stone 1993). KYNA has also been shown to protect striatal neurons from QUIN toxicity (Hilmas et al. 2001). However, ionotropic glutamate receptor ligands such as glutamate and QUIN can inhibit KYNA synthesis (Curatolo et al. 1996). Additionally, ACMSDase, another enzyme that is downregulated following immune stimulation, regulates NAD? synthesis and generation of QUIN through the KP (Tanabe et al. 2002). Unlike KYNA, PIC, a metabolite of the catalytic activity of ACMSDase can attenuate QUIN neurotoxicity without altering the excitotoxic effect (Fukuoka et al. 2002). Although the mechanism for PICmediated neuroprotection remains unclear, it is thought that PIC does not compete with QUIN at the glutamate/ NMDA-binding site of the NMDA receptor (Fukuoka et al. 2002). Downregulation of ACMSDase appears to be a cellular mechanism promoting higher non-enzymatic conversion of aminocarboxymuconate semialdehyde (ACMS) to QUIN (Lim et al. 2013). Apart from ACMSDase, the expression of QPRTase is also reduced following immune stimulation of DCs with IFN-c. QPRTase represents the catabolizing enzyme of QUIN. We have previously shown that neuronal QPRTase activity begins to be saturated at QUIN concentrations C300 nM (Rahman et al. 2009). Neurons can take up and catabolize QUIN to produce more NAD?, which would provide more energy to the cell and improve DNA repair (Braidy et al. 2009, 2011; Sheipouri et al. 2012). The excessive accumulation of QUIN is likely to induce a cytotoxic cascade within neurons (Guillemin et al. 2003b; Guillemin 2012; Braidy et al. 2014). The overall effect of increased IDO-1, IDO-2, and TDO mRNA expression and reduced QPRTase expression leads to an increased production of QUIN in human DCs. This is confirmed by our data indicating increased production of QUIN and low levels of PIC. Interestingly, we have also shown that CD8? DCs can regulate the survival of T cells in vitro. This is in line with a previous study which showed that immune activation of murine CD8? DCs induces apoptosis of T cells (Fallarino et al. 2002). Inhibition of the KP using 1-MT and tranilast attenuated apoptosis of T cells in our study. 1-MT has been previously shown to inhibit IDO-1 in human DCs and ameliorate IDO-induced arrest of T cells (Qian et al. 2009).

This suggests that while IDO is important for the production of important KP metabolites, it is also important for mediating T cell suppression. Moreover, 3,4dimethoxycinnamonyl-anthranilic acid (tranilast) is an orally available anti-allergic drug that exhibits a chemical structure homologous to several immunosuppressive catabolites of the KP. One study previously demonstrated tranilast can inhibit the activation and purification of purified CD4? and CD8? T cells stimulated via the T cell receptor, at a concentration less than 10 lM. This is below plasma levels achieved following oral administration of approved human doses ranging between 200 and 600 mg. The same study further showed that tranilast interferes with the production of inflammatory cytokines and chemokines, and limits the phosphorylation of signal transducer and activator of transcription 1 (Hertenstein et al. 2011). In summary, it is likely that DCs represent the only antigen-presenting cells which express high levels of endogenous IDO. Both 1-MT and tranilast have been shown to reduce tumour proliferation in a variety of experimental tumour settings (Qian et al. 2009; Mitsuno et al. 2010; Sato et al. 2010; Subramaniam et al. 2010; Ohshio et al. 2014). The identification of IDO and KMO as potential enzyme targets for pharmacological inhibition of the KP may pave the way for the development of novel and efficacious antitumoural and immunomodulatory agents. Our data adds further insight into the complex role of DCs in the regulation of immunity and the multiplicity of the KP effects as an immunomodulator. Acknowledgments The National Health and Medical Research Council (Fellowship and Program Grant), the NSW Health Department, the University of New South Wales, the Rebecca L. Cooper Medical Foundation and Private Donation from M. Terry Gammel have supported this work. NB is the recipient of an Alzheimer’s Australia Viertel Foundation Postdoctoral Research Fellowship and the NHMRC Early Career Researcher Postdoctoral Fellowship at the University of New South Wales.

References Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P (2006) Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. J Immunol 177(1):130–137 Braidy N, Grant R, Adams S, Brew BJ, Guillemin GJ (2009) Mechanism for quinolinic acid cytotoxicity in human astrocytes and neurons. Neurotox Res 16(1):77–86 Braidy N, Guillemin GJ, Grant R (2011) Effects of kynurenine pathway inhibition on NAD metabolism and cell viability in human primary astrocytes and neurons. Int J Tryptophan Res 4:29–37 Braidy N, Brew BJ, Inestrosa NC, Chung R, Sachdev P, Guillemin GJ (2014) Changes in Cathepsin D and Beclin-1 mRNA and protein expression by the excitotoxin quinolinic acid in human astrocytes and neurons. Metab Brain Dis 29(3):873–883

123

Neurotox Res Curatolo L, Caccia C, Speciale C, Raimondi L, Cini M, Marconi M, Molinari A, Schwarcz R (1996) Modulation of extracellular kynurenic acid content by excitatory amino acids in primary cultures of rat astrocytes. Adv Exp Med Biol 398:273–276 Curzon G (1996) Brain tryptophan. Normal and disturbed control. Adv Exp Med Biol 398:27–34 Espey MG, Chernyshev ON, Reinhard JJ, Namboodiri MA, Colton CA (1997) Activated human microglia produce the excitotoxin quinolinic acid. Neuroreport 8(2):431–434 Fallarino F, Vacca C, Orabona C, Belladonna ML, Bianchi R, Marshall B, Keskin DB, Mellor AL, Fioretti MC, Grohmann U, Puccetti P (2002) Functional expression of indoleamine 2,3-dioxygenase by murine CD8 alpha(?) dendritic cells. Int Immunol 14(1):65–68 Foster AC, Vezzani A, French ED, Schwarcz R (1984) Kynurenic acid blocks neurotoxicity and seizures induced in rats by the related brain metabolite quinolinic acid. Neurosci Lett 48(3):273–278 Fukuoka S, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H, Shibata K (2002) Identification and expression of a cDNA encoding human alpha-amino-beta-carboxymuconate-epsilonsemialdehyde decarboxylase (ACMSD). A key enzyme for the tryptophan–niacin pathway and quinolinate hypothesis. J Biol Chem 277(38):35162–35167 Guillemin GJ (2012) Quinolinic acid, the inescapable neurotoxin. FEBS J 279(8):1356–1365 Guillemin G, Boussin FD, Le Grand R, Croitoru J, Coffigny H, Dormont D (1996) Granulocyte macrophage colony stimulating factor stimulates in vitro proliferation of astrocytes derived from simian mature brains. Glia 16(1):71–80 Guillemin G, Boussin FD, Croitoru J, Franck-Duchenne M, Le Grand R, Lazarini F, Dormont D (1997) Obtention and characterization of primary astrocyte and microglial cultures from adult monkey brains. J Neurosci Res 49(5):576–591 Guillemin GJ, Kerr SJ, Smythe GA, Armati PJ, Brew BJ (1999) Kynurenine pathway metabolism in human astrocytes. Adv Exp Med Biol 467:125–131 Guillemin GJ, Smith DG, Kerr SJ, Smythe GA, Kapoor V, Armati PJ, Brew BJ (2000) Characterisation of kynurenine pathway metabolism in human astrocytes and implications in neuropathogenesis. Redox Rep 5(2–3):108–111 Guillemin GJ, Kerr SJ, Smythe GA, Smith DG, Kapoor V, Armati PJ, Croitoru J, Brew BJ (2001) Kynurenine pathway metabolism in human astrocytes: a paradox for neuronal protection. J Neurochem 78:1–13 Guillemin GJ, Smith DG, Smythe GA, Armati PJ, Brew BJ (2003a) Expression of the kynurenine pathway enzymes in human microglia and macrophages. Adv Exp Med Biol 527:105–112 Guillemin GJ, Williams KR, Smith DG, Smythe GA, CroitoruLamoury J, Brew BJ (2003b) Quinolinic acid in the pathogenesis of Alzheimer’s disease. Adv Exp Med Biol 527:167–176 Guillemin GJ, Brew BJ, Noonan CE, Takikawa O, Cullen KM (2005a) Indoleamine 2,3 dioxygenase and quinolinic acid immunoreactivity in Alzheimer’s disease hippocampus. Neuropathol Appl Neurobiol 31(4):395–404 Guillemin GJ, Smythe G, Takikawa O, Brew BJ (2005b) Expression of indoleamine 2,3-dioxygenase and production of quinolinic acid by human microglia, astrocytes, and neurons. Glia 49(1):15–23 Guillemin GJ, Wang L, Brew BJ (2005c) Quinolinic acid selectively induces apoptosis of human astrocytes: potential role in AIDS dementia complex. J Neuroinflamm 2(1):16 Guillemin GJ, Cullen KM, Lim CK, Smythe GA, Garner B, Kapoor V, Takikawa O, Brew BJ (2007) Characterization of the kynurenine pathway in human neurons. J Neurosci 27(47):12884–92 Hartai Z, Klivenyi P, Janaky T, Penke B, Dux L, Vecsei L (2005) Kynurenine metabolism in multiple sclerosis. Acta Neurol Scand 112(2):93–96

123

Hertenstein A, Schumacher T, Litzenburger U, Opitz CA, Falk CS, Serafini T, Wick W, Platten M (2011) Suppression of human CD4? T cell activation by 3,4-dimethoxycinnamonyl-anthranilic acid (tranilast) is mediated by CXCL9 and CXCL10. Biochem Pharmacol 82(6):632–641 Heyes MP (1996) The kynurenine pathway and neurologic disease. Therapeutic strategies. Adv Exp Med Biol 398(125):125–129 Heyes MP, Saito K, Markey SP (1992) Human macrophages convert L-tryptophan into the neurotoxin quinolinic acid. Biochem J 283:633–635 Heyes MP, Chen CY, Major EO, Saito K (1997) Different kynurenine pathway enzymes limit quinolinic acid formation by various human cell types. Biochem J 326:351–356 Hilmas C, Pereira EF, Alkondon M, Rassoulpour A, Schwarcz R, Albuquerque EX (2001) The brain metabolite kynurenic acid inhibits alpha7 nicotinic receptor activity and increases nonalpha7 nicotinic receptor expression: physiopathological implications. J Neurosci 21(19):7463–7473 Hu J, Yuan X, Belladonna ML, Ong JM, Wachsmann-Hogiu S, Farkas DL, Black KL, Yu JS (2006) Induction of potent antitumor immunity by intratumoral injection of interleukin 23-transduced dendritic cells. Cancer Res 66(17):8887–8896 Jhamandas KH, Boegman RJ, Beninger RJ, Miranda AF, Lipic KA (2000) Excitotoxicity of quinolinic acid: modulation by endogenous antagonists. Neurotox Res 2(2–3):139–155 Kapoor V, Kapoor R, Chalmers J (1994) Kynurenic acid, an endogenous glutamate antagonist, in SHR and WKY rats: possible role in central blood pressure regulation. Clin Exp Pharmacol Physiol 21(11):891–896 Kerr SJ, Armati PJ, Pemberton LA, Smythe G, Brew BJ (1997a) Kynurenine pathway inhibition with 6-chloro-D-tryptophan reduces neurotoxicity of HIV-infected macrophage supernatants (abstract). Neurology 48(3):A94 Kerr SJ, Armati PJ, Pemberton LA, Smythe G, Tattam B, Brew BJ (1997b) Kynurenine pathway inhibition reduces neurotoxicity of HIV-1-infected macrophages. Neurology 49(6):1671–1681 Krause D, Suh HS, Tarassishin L, Cui QL, Durafourt BA, Choi N, Bauman A, Cosenza-Nashat M, Antel JP, Zhao ML, Lee SC (2011) The tryptophan metabolite 3-hydroxyanthranilic acid plays anti-inflammatory and neuroprotective roles during inflammation: role of hemeoxygenase-1. Am J Pathol 179(3):1360– 1372 Lapin IP, Prakhie IB, Kiseleva IP (1982) Excitatory effects of kynurenine and its metabolites, amino acids and convulsants administered into brain ventricles: differences between rats and mice. J Neural Transm 54(3–4):229–238 Li H, Shi B (2015) Tolerogenic dendritic cells and their applications in transplantation. Cell Mol Immunol 12(1):24–30 Lim CK, Yap MM, Kent SJ, Gras G, Samah B, Batten JC, De Rose R, Heng B, Brew BJ, Guillemin GJ (2013) Characterization of the kynurenine pathway and quinolinic acid production in macaque macrophages. Int J Tryptophan Res 6:7–19 Mellor AL, Munn DH (2004) IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat Rev Immunol 4(10):762–774 Mellor AL, Baban B, Chandler P, Marshall B, Jhaver K, Hansen A, Koni PA, Iwashima M, Munn DH (2003) Cutting edge: induced indoleamine 2,3 dioxygenase expression in dendritic cell subsets suppresses T cell clonal expansion. J Immunol 171(4):1652–1655 Mitsuno M, Kitajima Y, Ohtaka K, Kai K, Hashiguchi K, Nakamura J, Hiraki M, Noshiro H, Miyazaki K (2010) Tranilast strongly sensitizes pancreatic cancer cells to gemcitabine via decreasing protein expression of ribonucleotide reductase 1. Int J Oncol 36(2):341–349 Moffett JR, Namboodiri MA (2003) Tryptophan and the immune response. Immunol Cell Biol 81(4):247–265

Neurotox Res Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL (1998) Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 281(5380):1191–3 Ohshio Y, Hanaoka J, Kontani K, Teramoto K (2014) Tranilast inhibits the function of cancer-associated fibroblasts responsible for the induction of immune suppressor cell types. Scand J Immunol 80(6):408–416 Orabona C, Puccetti P, Vacca C, Bicciato S, Luchini A, Fallarino F, Bianchi R, Velardi E, Perruccio K, Velardi A, Bronte V, Fioretti MC, Grohmann U (2006) Toward the identification of a tolerogenic signature in IDO-competent dendritic cells. Blood 107(7):2846–2854 Pemberton LA, Kerr SJ, Smythe G, Brew BJ (1997) Quinolinic acid production by macrophages stimulated with IFN-gamma, TNFalpha, and IFN-alpha. J Interferon Cytokine Res 17(10):589–595 Qian F, Villella J, Wallace PK, Mhawech-Fauceglia P, Tario JD Jr, Andrews C, Matsuzaki J, Valmori D, Ayyoub M, Frederick PJ, Beck A, Liao J, Cheney R, Moysich K, Lele S, Shrikant P, Old LJ, Odunsi K (2009) Efficacy of levo-1-methyl tryptophan and dextro-1-methyl tryptophan in reversing indoleamine-2,3-dioxygenase-mediated arrest of T-cell proliferation in human epithelial ovarian cancer. Cancer Res 69(13):5498–5504 Rahman A, Ting K, Cullen KM, Braidy N, Brew BJ, Guillemin GJ (2009) The excitotoxin quinolinic acid induces tau phosphorylation in human neurons. PLoS One 4(7):e6344 Sato S, Takahashi S, Asamoto M, Naiki T, Naiki-Ito A, Asai K, Shirai T (2010) Tranilast suppresses prostate cancer growth and osteoclast differentiation in vivo and in vitro. Prostate 70(3): 229–238 Schwarcz R, Whetsell WO Jr, Mangano RM (1983) Quinolinic acid: an endogenous metabolite that produces axon-sparing lesions in rat brain. Science 219(4582):316–318 Sheipouri D, Braidy N, Guillemin GJ (2012) Kynurenine pathway in skin cells: implications for UV-induced skin damage. Int J Tryptophan Res 5:15–25

Sheipouri D, Grant R, Bustamante S, Lovejoy D, Guillemin GJ, Braidy N (2015) Characterisation of the kynurenine pathway in skin-derived fibroblasts and keratinocytes. J Cell Biochem 116(6):903–922 Smythe GA, Braga O, Brew BJ, Grant RS, Guillemin GJ, Kerr SJ, Walker DW (2002) Concurrent quantification of quinolinic, picolinic, and nicotinic acids using electron-capture negative-ion gas chromatography–mass spectrometry. Anal Biochem 301(1): 21–26 Smythe GA, Poljak A, Bustamante S, Braga O, Maxwell A, Grant R, Sachdev P (2003) ECNI GC–MS analysis of picolinic and quinolinic acids and their amides in human plasma, CSF, and brain tissue. In: Allegri G, Costa CVL, Ragazzi E, Steinhart H, Varesio L (eds) Developments in tryptophan and serotonin metabolism, vol 527. Kluwer Academic/Plenum Publ., New York, pp 705–712 Stone TW (1993) Neuropharmacology of quinolinic and kynurenic acids. Pharmacol Rev 45(3):309–379 Subramaniam V, Chakrabarti R, Prud’homme GJ, Jothy S (2010) Tranilast inhibits cell proliferation and migration and promotes apoptosis in murine breast cancer. Anticancer Drugs 21(4): 351–361 Tanabe A, Egashira Y, Fukuoka S, Shibata K, Sanada H (2002) Expression of rat hepatic 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase is affected by a high protein diet and by streptozotocin-induced diabetes. J Nutr 132(6):1153–1159 Turville SG, Arthos J, Donald KM, Lynch G, Naif H, Clark G, Hart D, Cunningham AL (2001) HIV gp120 receptors on human dendritic cells. Blood 98(8):2482–2488 Wirthgen E, Hoeflich A (2015) Endotoxin-induced tryptophan degradation along the kynurenine pathway: the role of indolamine 2,3-dioxygenase and aryl hydrocarbon receptormediated immunosuppressive effects in endotoxin tolerance and cancer and its implications for immunoparalysis. J Amino Acids 2015:973548

123