J Mol Med (1997) 75:145–152

© Springer-Verlag 1997

O R I G I NA L A RT I C L E

&roles:Stefanie André · Octavian Schatz Johannes R. Bogner · Heinz Zeichhardt Marina Stöffler-Meilicke · Hans-Ulrich Jahn Reiner Ullrich · Anne-Katharina Sonntag Roland Kehm · Jürgen Haas

Detection of antibodies against viral capsid proteins of human herpesvirus 8 in AIDS-associated Kaposi’s sarcoma &misc:Received: 3 August 1996 / Accepted: 28 November 1996

&p.1:Abstract Sequences of a new herpesvirus with homology to gammaherpesvirinae were recently identified in AIDS-associated Kaposi’s sarcoma (KS). Subsequently this novel virus, called KS-associated virus (KSHV) or human herpesvirus (HHV) 8 was detected in classical KS and AIDS-associated body cavity based lymphomas by polymerase chain reaction. In this report major and minor capsid proteins of HHV-8 were molecularly cloned and produced as recombinant proteins in Escherichia coli. Sera from 69 HIV-1 infected patients with KS, 30 HIV-1 infected patients without KS and 106 control individuals were tested by enzyme-linked immunosorbent assay for anti-HHV-8 capsid IgM and IgG antibodies. Sera from four patients were tested over periods ranging from 18 months to 6 years. IgG antibodies directed against HHV-8 capsid antigens were detected in patients with AIDS-associated KS and in some AIDS patients without KS. Seroconversion with IgM and IgG antibodies directed against HHV-8 capsid proteins occurred more than 1 year prior to diagnosis of KS. In a considerS. André · J. Haas (✉) Max-von-Pettenkofer Institut für Virologie, Genzentrum, Universität München, Feodor-Lynen-Strasse 25, D-81377 Munich, Germany O. Schatz · J.R. Bogner Medizinische Poliklinik, Universität München, Pettenkofer Strasse 8a, D-80336 Munich, Germany H. Zeichhardt · M. Stöffler-Meilicke Institut für Klinische und Experimentelle Virologie, Universitätsklinikum Benjamin Franklin, Freie Universität Berlin, Hindenburgdamm 27, D-12203 Berlin, Germany H.-J. Jahn · R. Ullrich Medizinische Klinik, Universitätsklinikum Benjamin Franklin, Freie Universität Berlin, Hindenburgdamm 30, D-12200 Berlin, Germany A.-K. Sonntag Universitätshautklinik, Universität Heidelberg, Voßstrasse 2, D-69115 Heidelberg, Germany R. Kehm Institut für Medizinische Virologie, Universität Heidelberg, Im Neuenheimer 324, D-69120 Heidelberg, Germany&/fn-block:

able portion of KS patients no IgM or IgG antibodies against HHV-8 capsid proteins were detected. In these patients there was an inverse relationship between antibodies against HHV-8orf26 and the CD4/CD8 ratio, suggesting that the inconsistency of anti-HHV-8orf26 antibodies is due at least partly to an impaired immune response. No reactivity against HHV-8 capsid antigens was detected in the vast majority of sera from HIV-negative control individuals. Our findings indicate that a specific humoral immune response against capsid proteins is raised in HHV-8 infected individuals, and that anti-capsid antibodies can be used to diagnose HHV-8 infection. The correlation between occurrence of anti-HHV-8 antibodies and KS supports the hypothesis of a causative role of HHV-8. &kwd:Key words Antibody · Capsid antigens · HHV-8 · Kaposi’s sarcoma Abbreviations AIDS Acquired immunodeficiency syndrome · EA Early antigen · EBNA Epstein-Barr nuclear antigen · EBV Epstein-Barr virus · ELISA Enzyme-linked immunosorbent assays · GST Glutathion-S-transferase · HHV Human herpesvirus · HIV Human immunodeficiency virus · HSV Herpesvirus saimiri · KS Kaposi’s sarcoma · KSHV KS-associated herpesvirus · PCR Polymerase chain reaction · VCA Viral capsid antigen&bdy:

Introduction Kaposi’s sarcoma (KS) is the most frequent tumor in patients with the acquired immunodeficiency syndrome (AIDS). Since KS is more prevalent in AIDS patients infected by homosexual transmission than in those infected by other routes, an infectious etiology was suspected early. Several pathogens have been discussed as potential agents causing KS including human immunodeficiency virus (HIV), mycoplasma, papilloma viruses, cytomegalovirus, and human herpesvirus (HHV) 6, but none has

146

been confirmed to be responsible [1, 2]. Unique DNA sequences were recently identified in KS tissue of an HIVinfected individual by representational difference analysis [3]. These sequences were shown to be homologous to gammaherpesvirinae, particularly to Epstein-Barr virus (EBV) in humans and Herpesvirus saimiri (HSV) in squirrel monkeys [3, 4]. Subsequently this newly discovered virus, referred to as KS-associated herpesvirus (KSHV) or HHV-8, was detected by polymerase chain reaction (PCR) in classical KS [5–7], body cavity based lymphomas [8], Castleman’s disease [9], skin lesions of transplant patients [10], and angiosarcomas [11]. Since first detected in KS tissue, a causative role in KS has been suggested for HHV-8, similar to than for other tumorigenic herpesviruses [3]. Although first identified in only a very limited number of different tumors, subsequent studies have detected HHV-8 sequences in skin biopsies [10], semen [12, 13], lymphoid tissue [14], and peripheral blood mononuclear cell [15] of immunosuppressed transplantation patients and healthy donors. These studies used PCR, which is extremely sensitive to false-positive results caused by contaminations, and which have in part not been able to be reproduced by other groups; because of this the relationship between HHV-8 and KS remains controversial [16, 17]. Serological tests have been considered able to solve this controversy since they are less sensitive to sample contamination and can detect previous virus infection without ongoing virus replication. Serological data have recently become available using western blot [18, 19] and immunofluorescence [20–22] techniques with HHV-8 infected cell lines and enzyme-linked immunosorbent assays (ELISA) based on recombinant viral protein [23]. In these reports there was wide variation in prevalence rates among healthy individuals, for example, rates in North America ranging from 0% [21] to 25% [22]. Prevalence rates are consistently higher in Mediterranean and African countries and are also increased in homosexual risk groups. It therefore remains unresolved whether HHV-8 causes KS or is at least an important cofactor, or whether HHV-8 is merely a passenger in KS tissue enriched by optimal growth conditions, for example, through soluble mediators. Both autocrine and paracrine mechanisms appear to play a key role in tumorigenesis of KS spindle cells, and several factors such as basic fibroblast growth factor, HIV-1 Tat, scatter factor, and c-met have been discussed as mediating the morphological changes leading to the characteristic spindle cell formation [24–27]. Alternatively, HHV-8 itself may stimulate the production of viral or cellular growth factors instrumental in KS development. In the present study we used recombinant viral capsid proteins to determine the prevalence of anti-HHV-8 antibodies in individuals with and without KS. We detected anti-capsid antibodies in KS patients and in a small subset of sera from healthy controls.

Patients and methods Sera from 106 controls, 30 HIV-infected KS-negative individuals, and 69 HIV-positive KS-positive patients were collected in AIDS care centers at three German university hospitals (Heidelberg, Munich, and Berlin). KS was diagnosed histologically in skin biopsies. Sera from 24 EBV+ individuals were collected from patients with either mononucleosis or EBV reactivation and were positive for viral capsid antigen (VCA) and early antigen (EA) IgM and negative (mononucleosis) or positive (reactivation) for Epstein-Barr nuclear antigen (EBNA) IgG antibodies. EBV-negative sera were drawn from 24 individuals negative for VCA, EA, and EBNA IgG antibodies. EBV serology was tested using commercial kits detecting VCA IgG (Fresenius, Bad Homburg) and IgM (Viramed, Martinsried), EA IgG and IgM (Biotest, Dreieich), and EBNA IgG antibodies (Biotest, Dreieich). IgG antibodies against herpes simplex virus I were detected with a commercial ELISA kit (Behring, Marburg). The carboxyterminal half of the HHV-8 homologue to the major capsid protein or BcLF1 of EBV was cloned by PCR from KS tissue using the oligonucleotides 5′cgcggggctagcacctgcgagataattcccacg3′ and 5′cgcggg gaattctttaatacaccaccttgtttccgag3′ as forward and reverse primers, respectively. This sequence, termed HHV8orf25, was cloned by Nhe1 and EcoR1 restriction sites into plasmid pRset-a (Invitrogen, San Diego, Calif.) and expressed as a HIS-tagged protein under control of a T7 promoter. Denatured HHV-8orf25 protein was purified from inclusion bodies by metal chelate chromatography and refolded as previously described [28, 29]. Similarly, the HHV-8orf26 gene with homology to the minor capsid protein (VP23) or BDLF1 of EBV was cloned into the prokaryotic expression vector pGEX-4T-1 (Pharmacia, Uppsala) using the oligonucleotides 5′cgcggggaattcatggcactc gacaagagtata3′ and 5′cgcgggctcgagtttagcgtggggaataccaacagga3′ with EcoR1 and Xho1 restriction sites as forward and reverse primers, respectively, and expressed as a glutathion-S-transferase (GST) fusion protein. The recombinant HHV-8orf26 protein was purified in native form using glutathion sepharose according to standard protocols [30]. Protein yields were approximately 8 mg for HHV-8orf25 and 2 mg for HHV-8orf26 per liter of bacterial culture. Microtiterplates (Greiner, Fricklingen) were coated overnight at 4°C using either 1 µg of the respective recombinant protein or 0.5 µg GST in 50 mM Tris pH 9.5 buffer. Sera were preabsorbed overnight at 4°C with lyophilized E. coli to minimize cross-reactivity against bacterial proteins. All subsequent steps and incubations were carried out at room temperature. After four washes microtiterplates were blocked with wash buffer (PBS/0.1% Tween 20) for 2 h. Diluted sera (100 µl) were incubated for 2 h at room temperature on the microtiterplate. After four washes 100 µl of an affinity-purified peroxidase-coupled anti-human IgG or anti-human IgM antiserum (Jackson ImmunoResearch) was added at a dilution of 1:5000–to 1:10000 and incubated for 1 h. Mi-

147

crotiterplates were washed again four times and 200 µl of ABTS substrate (Boehringer Mannheim, Mannheim) was added. Optical density at 405 nm was measured in a Dynatech spectrophotometer (Dynatech, Burlington). In the case of HHV-8orf26 the reactivity against GST was subtracted at each dilution. The statistical analysis was performed using SAS version 6.06 software.

Results HHV-8 is highly homologous to EBV in humans and HVS, which causes lymphoma in New World monkeys. Homology to other HHVs, which might cause interference by cross-reactive antibodies, is considerably lower. Fig. 1 Protein sequence comparison between HHV-8, EBV, and HVS major (A) and minor (B) capsid proteins. Clustal analysis of the carboxyterminal part of HHV-8orf25, EBV BcLF-1, and HVSorf25 proteins (A) and of complete HHV-8orf26, EBV BDLF-1, and HVSorf26 proteins (B). Asterisks, identical amino acids; points, conservative amino acid exchanges&ig.c:/f

Comparison of HHV-8 and EBV indicates 49% identity for the minor capsid protein (HHV-8orf26) and 68% identity for the major capsid protein (HHV-8orf25; Fig. 1). We molecularly cloned HHV-8orf25 and orf26 capsid sequences by PCR from KS tissue into prokaryotic expression vectors, expressed either as GST fusion (HHV-8orf26) or HIS-tagged (HHV-8orf25) proteins in E. coli and purified them by affinity chromatography (Fig. 2). To test whether cross-reactive antibodies directed against EBV interfere with detection of antibodies against HHV-8 capsid proteins, we first tested sera derived from either EBV-negative individuals or patients with mononucleosis or EBV reactivation. As anticipated by the higher homology to EBV, we detected cross-reactive antibodies against the major capsid protein, as indi-

148

Fig. 2 Generation of recombinant HHV-8 major (HHV-8orf25) and minor (HHV-8orf26) capsid proteins. HHV-8orf25 and orf26 sequences were cloned by PCR from KS biopsies, prokaryotically expressed as HIS-tagged (HHV-8orf25) or GST fusion (HHV8orf26) proteins and purified by affinity chromatography. Purified proteins were run on a 10% SDS-PAGE, followed by Coomassie blue staining&ig.c:/f

cated by the higher titers of EBV+ sera against HHV8orf25 (Fig. 3A). In contrast, no obvious cross-reactivity to EBV was observed with the minor capsid antigen HHV-8orf26 (Fig. 3B). We then tested sera from a large number of AIDS-patients with KS against the minor capsid antigen HHV8orf26, which is not sensitive to cross-reactive antibodies (Table 1). Sera of KS patients were tested separately to exclude artifacts due to different handling of samples (Fig. 4). KS sera in all the groups showed similar patterns of reactivity, ranging from nonreactive to highly reactive (Fig. 4). However, there was no clear distinction between reactive and nonreactive sera. One-third of the sera from KS patients were reactive with HHV-8orf26, but approximately two-thirds of the KS sera were negative or had low reactivity. Sera from control individuals were mainly nonreactive or of low titer, with the exception of few sera with high reactivity. Among HIV-infected individuals without KS there were more sera with a high reactivity than in the control group but fewer than in the KS group. At least 60% of these individuals had become infected with HIV by homo-/bisexual transmission, and therefore this reactivity against HHV-8 can be explained by previous virus contact (Table 1). Since we speculated that the absence of HHV-8 specific antibodies is due to an insufficient immune response in immunocompromised patients, we compared anti-HHV-8orf26 IgG levels with CD4/CD8 ratios as a parameter of immunosuppression. KS patients with high

Fig. 3 Reactivity of EBV-positive and EBV-negative sera against HHV-8 major capsid protein HHV-8orf25 (A) and against HHV-8 minor capsid protein HHV-8orf26 (B). Sera were diluted 1:50 and preabsorbed with E. coli prior to ELISA analysis. Purified recombinant proteins HHV-8orf25 or HHV-8orf26 were used to coat ELISA plates and reacted with sera from 24 individuals negative for antibodies directed against EBV and 24 sera from EBV-infected patients with either mononucleosis or EBV reactivation. Data are shown as a box and whisker plot of the optical density. Bound IgG antibodies were detected with a peroxidase-coupled goat antihuman IgG antiserum. The differences between EBV-negative and EBV-positive sera were significant for HHV-8orf25 (Wilcoxon rank sum test, P<0.0007) but not for HHV-8orf26. Similar results were obtained in two experiments&ig.c:/f

anti-HHV-8 titers (cutoff: mean+2 SD controls) had a significantly higher CD4/CD8 ratio (0.20±0.17, n=13) than patients with low antibody levels (0.06±0.06, n=32; P<0.0019), suggesting that AIDS patients in later stages are unable to produce HHV-8 capsid-specific antibodies (Fig. 5). Additional parameters, such as disease progression, probably play a role but were not considered here since the data were not available. However, IgG antibody reactivity depended neither on tumor localization nor on the duration from diagnosis of KS until blood sampling. Serum IgM against HHV-8orf26 were detected in some KS patients, predominantly those with high anti-HHV8orf26 IgG antibody titers (data not shown). IgG antibody titers against the HHV-8orf26 protein were generally low in sera from controls, suggesting that they had not previously had contact with HHV-8, and we therefore sought to detect signs of seroconversion in HIV-infected individuals developing KS. For this we tested sera from four KS patients which had been drawn at different times over a period of 2–4 years. The time course of the patient in Fig. 6A shows an increase of IgM antibodies against both capsid proteins 15 months prior to diagnosis of KS. This increase was paralleled by

149

Fig. 4A–C Reactivity of sera from patients with AIDS-associated KS (HIV+, KS; n=56), HIV-positive individuals without KS (HIV+; n= 30), and healthy controls (n=55) against the HHV-8 minor capsid antigen HHV-8orf26. Sera from three AIDS care centers were investigated separately (A,B,C). Sera were diluted 1:50 and preabsorbed with E. coli prior to ELISA analysis. Purified recombinant protein HHV-8orf26 was coated to ELISA plates and reacted with the sera. Bound IgG antibodies were detected with a peroxidase-coupled goat anti-human IgG antiserum. The statistical significance by Wilcoxon rank sum test was P<0.0009 between control and HIV-positive KS sera A, not significant in B, and P<0.0024 C. When the data from the three different centers were pooled, the statistical difference was P<0.041 between control and HIV-positive KS sera. Similar results were obtained in at least three experiments&ig.c:/f

Table 1 Patient data&/tbl.c:&

a

Controls’ mean age is relatively low since these data include the EBV-negative sera used for evaluating cross-reactivity shown in Fig. 1. Mean and standard deviation of control sera not included in this experiment were similar to those in the other two groups b n=28 c n=50&/tbl.:

a small and transient increase in IgG antibodies against the HHV-8orf25 major capsid antigen. However, no increase against the minor capsid antigen HHV-8orf26 was detected. Furthermore, the increased IgG titer against HHV-8orf25 did not persist but rather declined to levels below the previous titer. The anti-HHV-8orf25 titer before the IgM and IgG increase in June 1990 was somewhat higher than antibody titers against HHV-8orf26, which probably indicates cross-reactivity with EBV. We detected no IgM antibodies against EBV capsid antigen VCA in any of the sera in this period, indicating (a) that there was no general reactivation of herpesviruses at the time of HHV-8 seroconversion, and (b) that the increase

Controls (n=106)

HIV+ (n=30)

HIV+ KS (n=69)

Age Mean (years) Range (years)

20.0±19.8a 0–78

39.7±7.8 28–54

41.9±8.2 27–63

Sex Female Male

38 68

5 25

2 67

Mode of HIV-1 infection Homo-/bisexual IVDU Heterosexual Unknown

– – – –

18 3 6 3

55 2 3 9

Distribution of KS Skin Gastrointestinal Disseminated Unknown

– – – –

– – – –

31 3 33 2

CD4+ T-lymphocytes (per µl) CD4/CD8 Ratio

n.d. n.d.

147±136b 0.24±0.24b

51±63c 0.09±0.11c

Duration from diagnosis of KS to blood sampling (months)

–

–

18.3±19.1

– – –

– – –

18 47 4

Therapy against KS before blood sampling No Yes Unknown

150

two-thirds of the KS patients shown in Fig. 4 and the continuously declining IgG levels seen for the patient presented in Fig. 6A, we detected no IgM or IgG antibodies at any time point in these patients (data for sera of one of them are shown in Fig. 6B).

Discussion

Fig. 5 Correlation between anti HHV-8orf26 antibody reactivity and CD4/CD8 ratio in HIV-infected individuals with KS. The CD4/CD8 ratio as a parameter for immunosuppression is shown for HIV-infected KS patients with low (–2 SD of controls) and high (+2 SD) anti HHV-8orf26 antibody levels (Wilcoxon rank sum test, P< 0.0019)&ig.c:/f

Fig. 6A, B Time course analysis of IgM and IgG antibodies against major (HHV-8orf25) and minor (HHV-8orf26) capsid antigens of two HIV-infected individuals who developed KS. Sera were diluted 1:50 and preabsorbed with E. coli prior to ELISA analysis. Purified recombinant proteins HHV-8orf25 and HHV8orf26 were coated to ELISA plates and reacted with sera of two patients with AIDS-associated KS (A, B). Bound IgM and IgG antibodies were detected with peroxidase-coupled goat anti-human immunoglobulin antisera. All sera were tested for IgG antibodies against herpes simplex virus 1 to control for integrity. Similar results were obtained in two experiments

in IgG and the occurrence of IgM antibodies against HHV-8orf25 cannot be explained by cross-reactive antiEBV antibodies. Sera from three additional KS patients were tested over a period of 18 months–6 years. In accordance with the negative serology of approximately

In this study we determined antibody reactivity against two recombinant HHV-8 capsid proteins in sera of individuals with and without KS. Similar to other reports, IgG antibodies against the HHV-8orf26 protein, which is expressed during the lytic phase, were found in a subset of KS patients [19, 22, 23]. However, only approximately 30% of sera from HIV-positive KS patients reacted with HHV-8orf26. There are two lines of evidence suggesting that the inconsistency of anti-HHV-8orf26 antibodies in AIDS patients with KS is due at least partly to an impaired immune response. First, patients with high anti-HHV-8orf26 reactivity had significantly higher CD4/CD8 ratios than patients with low reactivity (Fig. 5). Second, one KS patient with high CD4/CD8 ratio generated IgM antibodies against both and IgG antibodies against HHV-8orf25 capsid antigens prior to diagnosis of KS, whereas three individuals with low CD4/CD8 ratio (<0.1) showed no antibody response against these antigens at all either before or after the diagnosis of KS (Fig. 6). This is consistent with previous data showing an impaired humoral response to several pathogens and vaccines in AIDS patients, probably caused by an insufficient T-cell help [31]. Furthermore, the low detection rate of HHV-8orf26 antigen is reminiscent of other herpesvirus infections, in which basically all individual virus proteins are detected only by sera of a subset of infected individuals [32–35]. In EBV none of the most immunogenic viral proteins p18 (BFRF3), p40 (BdRF1), and BALF2 is reactive with more than 80% of sera [34]. Similarly, in cytomegalovirus infection only one viral protein, pp150, is recognized by a majority of sera [32, 33]. There is also some evidence for more immunogenic antigens in HHV-8, as Simpson and colleagues [23] recently detected HHV8orf65 in approximately 80% of KS patients. To achieve a reliable sensitivity of more than 98% in serological assays, however, it appears to be necessary to combine multiple viral components. This problem of serological tests based on recombinant proteins can be circumvented by the use of HHV-8 infected cell lines. However, crossreactivity against other herpesviruses cannot be excluded as stringently as with recombinant proteins. Transiently increased levels of IgM antibodies are detected in herpesvirus infection during both primary infection and reactivation. During primary infection the IgM increase is followed by the occurrence of IgG antibodies, which persist after the acute phase. As discussed above, in immunocompromised patients negative antibody titers do not necessarily indicate that the individual had not had previous virus contact. However, serocon-

151

version of an individual previously IgG negative as shown in Fig. 6A most likely indicates that an immunocompetent host has recently been infected with a new pathogen. Evidence in favor of a primary infection is thus provided by the transient increase in IgM and IgG antibody titers approximately 15 months prior to diagnosis of KS in one patient whose sera samples were tested over a period of 4 years (Fig. 6A), in conjunction with the previous lack of anti-HHV-8orf26 antibodies. Antibodies against HHV-8orf26 antigen were detected in only 3 of 106 control sera. This is in accordance with several recent reports using HHV-8 infected cell lines in western blot and immunofluorescence tests [18, 19, 21, 23]. These studies show low serological prevalence rates among healthy individuals in northern Europea and North America but considerably higher rates among homosexuals and in Central and West African countries. However, Lennette and coworkers [22] detected antibodies against HHV-8 in approximately 25% of sera from healthy North American adults. As this is in contrast to our results and to the results of other groups, it may reflect either a drastically increased sensitivity of the assay system used or enhanced non-specific binding. Improved serological assays based on (multiple) defined recombinant viral proteins may solve this problem, as cross-reactivity can be excluded more reliably. In summary, the data presented here, in concert with data previously published using other assay systems, are consistent with the role of HHV-8 as a cofactor for KS. &p.2:Acknowledgements We acknowledge the expert technical assistance of Anja Weiß, help with the statistical analysis by Thomas Böhler and Winfried Schraut, data documentation by Wolfgang Kronitz, and helpful discussions with Ulrich Koszinowski. This report was supported in part by grants BMG/RKI AZ 415-4476-08 (clinical data documentation) and BMBF FKZ 01 KI 9468.

References 1. Beral V, Peterman TA, Berkelman RL, Jaffe HW (1990) Kaposi’s sarcoma among persons with AIDS: a sexually transmitted infection? Lancet 335:123–128 2. Siegal B, Levington-Kriss S, Schiffer A, Sayar J, Engelberg I, Vonsover A, Ramon Y, Rubenstein E (1990) Kaposi’s sarcoma in immunosuppression. Possibly the result of a dual viral infection. Cancer 65:492–498 3. Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM, Moore PS (1994) Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 266:1865–1869 4. Moore PA, Gao S-J, Dominguez G, Cesarman E, Lungu O, Knowles DM, Garber R, Pellett PE, McGeoch DJ, Chang Y (1996) Primary characterization of a herpesvirus agent associated with Kaposi’s sarcoma. J Virol 70:549–558 5. Huang YC, Kaplan MH, Katabira E, Zhang WC, Feiner D, Friedman-Kien AE (1995) Human herpesvirus-like nucleic acid in various forms of Kaposi’s sarcoma. Lancet 345:759–761 6. Moore PA, Chang Y (1995) Detection of herpesvirus-like DNA sequences in Kaposi’s sarcoma in patients with and without HIV infection. N Engl J Med 332:1181–1185 7. Dupin N, Grandadam M, Calvez V, Gorin I, Aubin JT, Havard S, Lamy F, Leibowitch M, Huraux JM, Escande JP, Agut H (1995) Herpesvirus-like DNA sequences in patients with mediterranean Kaposi’s sarcoma. Lancet 345:761–762

8. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM (1995) Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 332:1186–1191 9. Soulier J, Grollet L, Oksenhendler E, Cacoub P, Cazals-Hatem D, Babinet P, d’Agay MF, Clauvel JP, Raphael M, Degos L (1995) Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman’s disease. Blood 86: 1276–1280 10. Rady PL, Yen A, Rollefson JL, Orengo I, Bruce S, Hughes TK, Tyring SK (1995) Herpesvirus-like DNA sequences in non-Kaposi’s sarcoma skin lesions of transplant patients. Lancet 345:1339–1340 11. Gyulai R, Kemeny L, Kiss M, Adam E, Nagy F, Dobozy A (1996) Herpesvirus-like DNA sequence in angiosarcoma in a patients without HIV infection. N Engl J Med 334:540–541 12. Lin J-C, Lin S-C, Mar E-C, Pellett PE, Stamey FR, Stewart JA, Spira TJ (1995) Is Kaposi’s-sarcoma-associated herpesvirus detectable in semen of HIV-infected homosexual men? Lancet 346:1601–1602 13. Monini P, DeLellis L, Fabris M, Rigolin F, Cassai E (1996) Kaposi’s sarcoma-associated herpesvirus DNA sequences in prostate tissue and human semen. N Engl J Med 334:1168– 1172 14. Bigoni B, Dolcetti R, DeLellis L, Carbone A, Boiocchi M, Cassai E, DiLuca D (1996) Human herpesvirus 8 is present in the lymphoid system of healthy persons and can reactivate in the course of AIDS. J Infect Diseases 173:542–549 15. Decker LL, Shankar P, Khan G, Freeman RB, Dezube BJ, Lieberman J, Thorley-Lawson DA (1996) The Kaposi sarcomaassociated herpesvirus (KSHV) is present as an intact latent genome in KS tissue but replicates in the peripheral blood mononuclear cells of KS patients. J Exp Med 184:283–288 16. Cohen J (1995) Controversy: Is KS really caused by new herpesvirus? Science 268:1847–1848 17. Boshoff C, Talbot S, Kennedy M, O’Leary J, Schulz T, Chang Y (1996) HHV8 in skin cancers in immunosuppressed patients. Lancet 347:338–339 18. Gao S-J, Kingsley L, Hoover DR, Spira TJ, Rinaldo CR, Saah A, Phair J, Detels R, Parry P, Chang Y, Moore PS (1996) Seroconversion to antibodies against Kaposi’s sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposi’s sarcoma. N Engl J Med 335:233–241 19. Miller G, Rigsby MO, Heston L, Grogan E, Sun R, Metroka C, Levy JA, Gao S-J, Chang Y, Moore P (1996) Antibodies to butyrate-inducible antigens of Kaposi’s sarcoma-associated herpesvirus in patients with HIV-1 infection. N Engl J Med 334:1292–1297 20. Kedes DH, Operskalski E, Busch M, Kohn R, Flood J, Ganem D (1996) The seroepidemiology of human herpesvirus 8 (Kaposi’s sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nature Med 2:918–924 21. Gao S-J, Kingsley L, Li M, Zheng W, Parravicini C, Ziegler J, Newton P, Rinaldo CR, Saah A, Phair J, Detels R, Chang Y, Moore PS (1996) KSHV antibodies among Americans, Italians, and Ugandans with and without Kaposi’s sarcoma. Nature Med 2:925–928 22. Lennette ET, Blackbourn DJ, Levy JA (1996) Antibodies to human herpesvirus type 8 in the general population and in Kaposi’s sarcoma patients. Lancet 348:858–861 23. Simpson GR, Schulz TF, Whitby D, Cook PM, Boshoff C, Rainbow L, Howard MR, Gao S-J, Bohenzky RA, Simmonds P, Lee C, de Ruiter A, Hatzakis A, Tedder RS, Weller IVD, Weiss RA, Moore PS (1996) Prevalence of Kaposi’s sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen. Lancet 348:1133–1138 24. Ensoli B, Gendelman R, Markham P, Fiorelli V, Colombini S, Raffeld M, Cafaro A, Chang HK, Brady JN, Gallo RC (1994) Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi’s sarcoma. Nature 371:674–680

152 25. Ensoli B, Nakamura S, Salahuddin SZ, Biberfeld P, Larsson L, Beaver B, Wong-Staal F, Gallo RC (1989) AIDS-Kaposi’s sarcoma-derived cells express cytokines with autocrine and paracrine growth effects. Science 243:223–226 26. Stürzl M, Roth WK, Brockmeyer NH, Zietz C, Speiser B, Hofschneider PH (1992) Expression of platelet-derived growth factor and its receptor in AIDS-related Kaposi sarcoma in vivo suggests paracrine and autocrine mechanism of tumor maintenance. Proc Natl Acad Sci USA 89:7046–7050 In summary, 27. Roth WK, Werner S, Schirren CG, Hofschneider PH (1989) Depletion of PDGF from serum inhibits growth of AIDS-related and sporadic Kaposi’s sarcoma cells in culture. Oncogene 4:483–487 28. Hochuli E, Döbeli H, Schacher A (1987) New metal chalte adsorbent selective for proteins and peptides containing neighoring histidine residues. J Chromatography 411:177–184 29. Nakagawa Y, Yip T-T, Blew M, Porath J (1988) High-performanace immobilized metal ion affinity chromatography of peptides. Anal Biochem 168:75–81 30. Smith DB, Johnson KS (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31–40

31. Pinching AJ (1991) Antibody responses in HIV infection. Clin Exp Immunol 84:181–184 32. van Zanten J, van der Giessen M, van Son WJ, The TH (1993) Antibody responses to human cytomegalovirus-specific polypeptides studied by immunoblotting in relation to viral load during cytomegalovirus infection. J Med Virol 39:80–87 33. Vornhagen R, Plachter B, Hinderer W, The TH, van Zanten J, Matter L, Schmidt CA, Sonneborn HH, Jahn G (1994) Early serodiagnosis of acute human cytomegalovirus infection by enzyme-linked immunosorbent assay using recombinant antigens. J Clin Microbiol 32:981–986 34. van Grunsven WM, Nabbe A, Middeldorp JM (1993) Identification and molecular characterization of two diagnostically relevant marker proteins of the Epstein-Barr virus capsid antigen complex. J Med Virol 40:161–169 35. Yamamoto M, Black JB, Stewart JA, Lopez C, Pellett PE (1990) Identification of a nucleocapsid protein as a specific serological marker of human herpesvirus 6 infection. J Clin Microbiol 28:1957–1962