Tumor Biol. DOI 10.1007/s13277-014-2815-y

RESEARCH ARTICLE

Downregulation of RIP140 in hepatocellular carcinoma promoted the growth and migration of the cancer cells Dexiang Zhang & Yueqi Wang & Yuedi Dai & Jiwen Wang & Tao Suo & Hongtao Pan & Han Liu & Sheng Shen & Houbao Liu

Received: 17 August 2014 / Accepted: 4 November 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014

Abstract Hepatocellular carcinoma (HCC) is one of the most common malignancies with a poor response to chemotherapy. It is very important to identify novel diagnosis biomarkers and therapeutic targets. RIP140, a regulator of estrogen receptor, recently has been found to be involved in the tumorigenesis. However, its function in the progression of HCC remains poorly understood. Here, we found that the expression of RIP140 was downregulated in the HCC tissues. Moreover, overexpression of RIP140 in HCC cells inhibited cell proliferation and migration, while downregulation of RIP140 promoted the tumorigenicity of HCC cells in vitro and in vivo. Mechanistically, RIP140 interacted with beta-catenin and negatively regulated beta-catenin/TCF signaling. Taken together, our study suggests the suppressive roles of RIP140 in the pathogenesis of HCC. Keywords HCC . RIP140 . Beta-catenin . Cell proliferation and migration

Introduction Hepatocellular carcinoma (HCC) is one of the most prevalent human cancers worldwide, and ranks as the third leading Dexiang Zhang and Yueqi Wang contributed equally to this work. D. Zhang : Y. Wang : J. Wang : T. Suo : H. Pan : H. Liu : S. Shen : H. Liu General Surgery Department, Zhongshan Hospital, General Surgery Institute, Fudan University, Shanghai 200032, China Y. Dai Department of Medical Oncology, Cancer Hospital of Fudan University, Minhang Branch, Shanghai 200240, China H. Liu (*) Zhongshan Hospital, Fudan University, 180 Fenglin Rd, Shanghai 200032, China e-mail: [email protected]

cause of cancer-related death in many countries, especially in the East Asian countries [1]. The major risk factors include chronic hepatitis B virus and hepatitis C virus infection, aflatoxin exposure, and cirrhosis of any etiology [2–6]. Surgical resection or liver transplantation is usually considered the first choice of treatment for localized disease, and unresectable tumors are also treated with radiofrequency ablation or chemoembolization [7, 8]. However, HCC patients succumb to the tumor-aggressive behaviors of metastasis and recurrence, deterioration of liver function, and high resistance to chemotherapy drugs, and most cases still have a poor prognosis [9]. Thus, it is necessary to identify novel molecular markers suitable for early diagnosis and new therapeutic targets to improve the outcome of patients with HCC. Wnt/beta-catenin signaling plays important roles in tumorigenesis [10, 11]. In the absence of Wnt ligands, Ser/Thr residues in the N-terminus of beta-catenin are phosphorylated GSK3beta, which facilitates beta-catenin ubiquitination by beta-TrCP E3 ligase [11]. The binding of Frizzled/LRP coreceptor with Wnt ligands results in the inactivation of GSK 3beta [12]. Consequently, beta-catenin accumulates in the cytoplasm and subsequently translocates into the nucleus, where it forms a complex with T-cell factor 4 (TCF4) and activates the transcription of the target genes, c-Myc, cyclinD1, Snail, and so on [13, 14]. Activation of Wnt/betacatenin signaling is one of the major causes of HCC development [15, 16]. Nuclear accumulation of beta-catenin, a hallmark of Wnt signaling activation, is found in more than 50 % of HCC [17]. The transcription cofactor receptor-interacting protein of 140 kDa (RIP140) is first identified as a partner of estrogen receptor [18, 19]. Recent studies have found that RIP140 could interact with lots of nuclear receptors and transcription factors. For example, RIP140 is involved in the regulation of cell cycle by directly binding to E2F and repressing its transactivation [20]. In addition, RIP140 has been reported

Tumor Biol.

to interact with NF-κB subunit RelA [21], cAMP-responsive element binding protein (CREB)-binding protein (CBP) and androgen receptor and is involved in inflammation and hormone signaling [22, 23]. The function of RIP140 is tightly regulated by both post-translational modifications and transcription [24]. It has been found that sumoylation and acetylation played important roles in controlling the subcellular location and repressive activity of RIP140 [25, 26]. Also, the transcription of RIP140 is regulated by both NRs and E2F [24]. Depletion of RIP140 in mice causes a wide range of phenotypic alterations, such as infertility of female mice, reduced body fat content, severe cognitive impairments, and mammary gland morphogenesis [27–31]. However, the roles of RIP140 in the tumorigenesis remain poorly understood. Previous studies have shown that liver-specific knockdown of RIP140 led to increased hepatic triglycerides (TG) release [32, 33], while the function of RIP140 in the progression of HCC remains unclear. Here, we showed that the expression level of RIP140 was decreased in HCC tissues. Moreover, forced expression of RIP140 in HCC cells inhibited cell growth and migration, while knockdown the expression of RIP140 promoted the tumorigenicity of HCC cells. Mechanistically, RIP140 was found to interact with beta-catenin and negatively regulate beta-catenin/TCF signaling in HCC cells. Taken together, our study suggested that downregulation of RIP140 was very important in the progression of HCC, and restoring the function of RIP140 might be a promising therapeutic strategy for HCC.

Materials and methods Cell culture Human normal hepatocellular cell line 7701 and HCC cell lines Hep3B, 7404, HepG2, and MHCC97 were purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10 % fetal bovine serum (FBS; PAA Laboratories, Pasching, Austria), 10 units/ml penicillin-G, and 10 mg/ml streptomycin. All cells were incubated at 37 °C in a humidified atmosphere containing 5 % CO2.

Plasmid construction and transfection To generate the RIP140 expression vector, the open reading frame of human RIP140 cDNAwas cloned into the expression vector pcDNA 3.1 and pCMV-HA, respectively, which resulted in the HA-tagged RIP140 protein. The coding sequence of beta-catenin was cloned to the expression vector pCMVTag2B and fused with a Flag tag. The RIP140 expression vector and empty pcDNA3.1 were transfected into Hep3B and MHCC97 cells using Lipofectamine 2000 reagent (Invitrogen). The transfected cells were selected in the presence of 600 μg/ml G418, and resistant cells were pooled and further confirmed the expression of exogenous RIP140 by Western blot. RNA extraction and real-time PCR analysis Total RNA was isolated from HCC tissues and matched normal tissues of HCC patients after their informed consent using TRIzol reagent (Invitrogen). The RNA samples were separated in 2 % agarose gels containing ethidium bromide, and their quality was then determined by visibility of 18S and 28S RNA bands under UV light. Two micrograms of total RNA with high quality was processed directly to cDNA with the reverse transcription kit (Promega, Madison, WI), following the manufacturer’s instructions, in a total volume of 25 μl. The primer pair used for amplification of the human RIP140 gene was as follows: forward primer, 5′-ATAGCCCTCAGTCATGATT3′, and reverse primer, 5′-CAGCACATGACAACGGTTCA3′. As an internal standard, a fragment of human beta-actin was amplified by PCR using the following primers: forward primer, 5′-GATCATTGCTCCTCCTGAGC-3′, and reverse primer, 5′-ACTCCT GCTTGCTGATCCAC-3′. Amplification reactions were performed in a 20 μl volume of the LightCycler-DNA Master SYBR Green I mixture from Roche Applied Science as follows: with 10 pmol of primer, 2 mM MgCl2, 200 μM dNTP mixture, 0.5 units of Taq DNA polymerase and universal buffer. All of the reactions were performed in triplicate in an iCycler iQ System (Bio-Rad), and the thermal cycling conditions were as follows: 95 °C for 3 min; 40 cycles of 95 °C for 30 s, 58 °C for 20 s, and 72 °C for 30 s; 72 °C for 10 min. To confirm specificity of amplification, the PCR products from each primer pair were subjected to a melting curve analysis and electrophoresis in 2 % agarose gel.

Clinical samples

Western blot analysis

Primary tissues were collected from patients who received surgery for HCC at Zhongshan Hospital which was affiliated to Fudan University. All of the patients have given informed consent. Dissected samples were frozen immediately after surgery and stored at −80 °C until needed.

Cells were plated into 35-mm dishes and cultured to 80 % confluence. The cells were then scraped and lysed in RIPA buffer, and cell lysates were centrifuged at 10,000g (4 °C for 20 min). Protein concentrations were determined using Bradford reagent (Sigma) according to the Manufacturer’s

Tumor Biol.

In our experiments, FG12 lentiviral vector, which has an independent open reading frame of green fluorescence protein (GFP), was used to produce small, double-stranded RNA

(siRNA) to inhibit target gene expression in MHCC97 and 7404 cells. To construct the hairpin siRNA expression cassette, complementary DNA oligonucleotides for siRNA of RIP140 (si RIP140) or mutated sequence as control (si con) were synthesized, annealed, and inserted into FG12. Two RIP140 siRNA constructs were used as follows: RIP140 siRNA 1# (highlighted sequence was the complementary sequence with RIP140 mRNA), 5′-ACCGGGATAGCACA TTACTGGCTTCAAGAGAGCCAGTAATGTGCTAT CCTTTTTTGGATCCC-3′And5′-TCGAGGGATCCAAA AAGGGATAGCACATTACTGGCTCTCTTGAAGCCA GTAATGTGCTATCC-3′; and RIP140 siRNA 2# (highlighted sequence was the complementary sequence with RIP140 mRNA), 5′-ACCGGGACAAAGTGGAACAAAGTTCAAGAGACTTTGTTCCACTTTGTCCTTTTTTGG ATCCC-3′ and 5′-TCGAGGGATCCAA AAAGGGACAA AGTGGAACAAAGTCTCTTGAACTTTGTTCCACT TTGTCC-3′; si con vector (highlighted sequence was the random sequence as control that was not related to RIP140 mRNA), 5′-ACCGGTACATAGGGACGTAACGTTCAA GAGACGTTACGTCCCTATGTACCTTTTTGGATCCC3′ and 5′-TCGAGGGATCCAAAAAGGTACATAGGG ACGTAACGTCTCTTGAACGTTACGTCCCTATGT AC-3′. FG12 vector with si RIP140 or si con was transfected into HEK293T, and the virus with RIP140 siRNA or si con

Fig. 1 Decreased expression level of RIP140 was found in HCC. a Relative mRNA level of RIP140 in human HCC samples and normal tissues. Real-time PCR was performed on 53 HCC samples and 53 normal tissues. The RIP140 expression was normalized to that of betaactin. Data was calculated from triplicates. Each bar was the log2 value of the ratio of RIP140 expression levels between HCC tissues (T) and

matched normal tissues (N) from the same patient. b The protein level of RIP140 in HCC samples and paired normal tissues was examined by immunohistochemistry. c The protein level of RIP140 in HCC tissues and paired normal tissues was examined by Western blot. d The protein level of RIP140 in normal liver cell lines (7701) and HCC cell lines (Hep3B, 7404, MHCC97, and HepG2)

instructions. Equal amounts of total cellular protein were mixed with loading buffer (62.5 mM Tris-HCl, pH 6.8, 10 % glycerol, 2 % SDS, 2 % beta-mercaptoethanol, and bromophenol blue), boiled for 5 min, and subjected to 10 % SDS-PAGE. Proteins were transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with Tris-buffered saline containing 0.05 % Tween 20 (TBST) and 5 % fat-free dry milk for 1 h at room temperature and incubated overnight with primary antibodies in TBST with 1 % bovine serum albumin. After washing with TBST, the membranes were further incubated for 1 h at room temperature with corresponding horseradish peroxidase-conjugated secondary antibody in appropriate dilution and then washed five times with the same buffer. The immunoreactive protein bands were visualized by ECL kit (Pierce). Antibodies to Flag, HA, RIP140, c-Myc, cyclinD1, Snail and GAPDH were purchased from Santa Cruz Biotechnology and antibody to beta-catenin was purchased from Cell Signaling Technology. RNAi-mediated knockdown of RIP140

Tumor Biol.

was harvested from culture medium. The harvested virus was purified by centrifugation at 25,000g (4 °C, 150 min), and appropriate amounts of virus were used to infect 7404 and MHCC97 cells. After 3 days of infection, the GFP-positive cells were sorted by flow cytometry (BD Biosciences), which all stably expressed si RIP140 or si con.

Immunohistochemistry HCC tissues were fixed in formalin, embedded in paraffin, and 5-μm-thick consecutive sections were cut and mounted on glass slides. After deparaffin and antigen recovery, the sections were washed thrice in 0.01 mol/l PBS (8 mmol/l Na2HPO4, 2 mmol/l NaH2PO4 and 150 mmol/l NaCl) for 5 min each, blocked for 1 h in 0.01 mol/l PBS supplemented with 0.3 % Triton X-100 and 5 % normal goat serum, followed by addition of anti-RIP140 (1:100) antibody at 4 °C overnight. After brief washes in 0.01 mol/l PBS, sections were exposed for 2 h to 0.01 mol/l PBS containing horseradish peroxidase-conjugated rabbit anti-goat IgG (1:500), followed by development with 0.003 % H2O2 and 0.03 % 3,30-diaminobenzidine in 0.05 mol/l Tris-HCl (pH 7.5).

Fig. 2 Overexpression of RIP140 inhibited the growth and migration of Hep3B and MHCC97 cells. a The Hep3B and MHCC97 cells were stably transfected with either the pcDNA3.1 vector or the RIP140 expression vector. G418-resistant cells were pooled and confirmed the expression of exogenous RIP140 by Western blot analysis. b The effects of RIP140 on the growth of Hep3B and MHCC97 cells were measured by Crystal violet assay. c The effects of RIP140 on the anchorageindependent growth of Hep3B cells were measured by soft agar assay. Data shown was the representative results from three independent experiments. **P<0.01 compared to the control group. d The effects of RIP140 on the migration of Hep3B and MHCC97 cells. **P<0.01

Immunoprecipitation Cells were washed with ice-cold PBS and lysated in Trisbuffered saline (pH 7.4), containing 50 mM Tris, 150 mM NaCl, 1 % NP-40, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF, 2.5 mg/ml aprotinin and leupeptin, 1 mM betaglycerophosphate and 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF), and 10 mM iodoacetate. Lysates were incubated on ice for 15 min before cellular debris and nuclei were removed by centrifugation at 10,000g for 20 min. Cell lysates were incubated with the corresponding primary antibodies overnight at 4 °C. Protein A Sepharose (Amersham Biosciences, Piscataway, NJ, USA) beads in a 50:50 mixture in 50 mM Tris buffer, pH 7.0, were added, and further incubated for another 4 h at 4 °C. The immunoprecipitates were washed four times in Tris-buffered saline and boiled for 5 min in 40 μl Laemmli buffer containing 0.02 % blue bromophenol and 2 % beta-mercaptoethanol. In vivo metastasis assay The MHCC97-Luciferase stable cell line (overexpression of luciferase) was established with G418 selection. Luciferase

Tumor Biol.

expression was determined by using luciferin (Xenogen) and an in vivo imaging system (Xenogen). The luciferase-expressing MHCC97/si con cells and luciferase-expressing MHCC97/si RIP140 cells (1×106 cells in 200 μl PBS) were injected into the left ventricle of the nude mice. The metastasis lesions were monitored every 10 days. Before mice were anesthetized with Forane (Abbott), an aqueous solution of luciferin (150 mg/kg intraperitoneally) was injected 10 min before imaging. The animals were placed into a light-tight chamber of the CCD camera system (Xenogen), and the photons emitted from the luciferase-expressing cells within the animal were quantified for 1 min, using the software program Living Image (Xenogen) as an overlay on Igor (Wavemetrics).

Fig. 3 Knockdown the expression of RIP140 promoted the growth and migration of MHCC97 and 7404 cells. a Knock down the expression of RIP140 in MHCC97 and 7404 cells. b The growth of RIP140 siRNA cells and control cells was measured by crystal violet assay. c Knockdown the expression of RIP140 promoted the anchorageindependent growth of 7404 cells measured by soft agar assay. Data shown was the representative results from three independent experiments. d Knockdown the expression of RIP140 promoted the migration of MHCC97 and 7404 cells

Crystal violet assay For cell growth assay, equal number of cells were seeded in sixwell plates and cultured in medium supplemented with 10 % FBS for 7 days. Medium was changed every other day. Cell growth was stopped after 7 days in culture by removing the medium and adding 0.5 % crystal violet solution in 20 % methanol. After staining for 5 min, the fixed cells were washed with phosphate-buffered saline (PBS) and photographed.

Soft agar assay For clonogenic assay, cells were plated into six-well flatbottomed dishes using a two-layer soft agar system with

Tumor Biol.

1.0×104 cells per well in a volume of 1 ml per well. After 14 days of incubation, the colonies were counted and measured. All of the experiments were done at least three times.

well were counted. Three wells were examined for each cell type, and the experiments were repeated for at least three times.

Boyden chamber assay

Results

Boyden chambers (8 μm pore size polycarbonate membrane) were obtained from Neuroprobe Corporation, Bethesda, MD, USA. Cells (2×105) in 0.05 ml medium containing 1 % FBS were placed in the upper chamber, and the lower chamber was loaded with 0.152 ml medium containing 10 % FBS. After 10 h of incubation, cells migrated to the lower surface of filters was detected with traditional H&E staining, and five fields of each

RIP140 was frequently downregulated in HCC clinical samples and cells

Fig. 4 RIP140 interacted with beta-catenin and inhibited betacatenin/TCF signaling. a Overexpression of RIP140 inhibited the TOPflash reporter activation induced by betacatenin in Hep3B and MHCC97 cells. Error bars indicated SD of three independent experiments. **P<0.01. b Overexpression of RIP140 inhibited the expression of beta-catenin/TCF target genes, Snail, c-Myc and CyclinD1. c Knockdown the expression of RIP140 promoted the expression of beta-catenin/TCF target genes. d The interaction between HARIP140 and Flag-beta-catenin was examined by immunoprecipitation assay in MHCC97 cells. e Immunoprecipitation assay demonstrated the endogenous interaction between RIP140 and beta-catenin in MHCC97 cells. f Dominant negative beta-catenin (DN beta-catenin) rescued the function of RIP140

To determine the expression pattern of RIP140 in HCC tissues, we performed real-time PCR on 53 pairs of HCC tissues and their corresponding nontumorous liver tissues. RIP140 transcripts were frequently (70 %, 38/53) downregulated in

Tumor Biol.

the HCC tissues as compared with the nontumorous tissues (Fig. 1a). To investigate whether the difference in the mRNA levels was reflected at the protein level, we first examined the protein level of RIP140 in HCC tissues using immunohistochemistry. Decreased protein level of RIP140 in HCC tissues was observed (Fig. 1b). In the next study, six randomly chosen HCC tissues and paired normal tissues were used in Western blot analysis. Consistent with the real-time PCR results, the levels of RIP140 protein were significantly lower in the HCC tissues than the nontumorous tissues (Fig. 1c). Furthermore, we examined the expression of RIP140 in a panel of hepatocellular cell lines. The highest expression of RIP140 was found in normal cell line 7701 while the lowest expression of RIP140 was observed in HCC cell line Hep3B and MHCC97. Taken together, these observations suggested that the expression of RIP140 was downregulated in HCC samples and cell lines.

RIP140 negatively regulated beta-catenin/TCF signaling in HCC cells Our previous findings promoted us to investigate the underlying molecular mechanism through which RIP140 inhibited the progression of HCC. In a preliminary screen to explore whether RIP140 might modulate various cellular signaling pathways with the reporter assay, we discovered that overexpression of RIP140 could inhibit the activation of Wntresponsive reporter TOPflash induced by beta-catenin in Hep3B and MHCC97 cells (Fig. 4a). Moreover, it was found that overexpression of RIP140 in Hep3B and MHCC97 cells inhibited the expression of c-Myc, Snail and CyclinD1, target genes of beta-catenin/TCF signaling, while knockdown the expression of RIP140 enhanced the expression of c-Myc, Snail, and CyclinD1 (Fig. 4b, c). These observations suggested that RIP140 inhibited beta-catenin/TCF signaling.

Upregulation of RIP140 inhibited the growth and migration of HCC cells RIP140 was reported to inhibit the growth of intestinal epithelial cells. However, the function of RIP140 in the progression of HCC remained unknown. Here, we first overexpressed exogenous RIP140 in Hep3B and MHCC97 cells which showed lower basal expression of RIP140 (Fig. 2a). Overexpression of RIP140 inhibited the growth of Hep3B and MHCC97 cells in the crystal violet assay (Fig. 2b). Also, forced expression of RIP140 inhibited the colony formation of Hep3B cells on the soft agar, suggesting RIP140 impaired the tumorigenicity of Hep3B cells (Fig. 2c). Furthermore, upregulation of RIP140 inhibited the migration of Hep3B and MHCC97 cells (Fig. 2d). Collectively, these results suggested that overexpression of RIP140 impaired the growth and migration of HCC cells. Silencing the expression of RIP140 promoted the growth and migration of HCC cells To clarify the function of endogenous RIP140 expression in the growth and migration of liver cancer cells, we used siRNA to knock down the expression of RIP140 in MHCC97 and 7404 cells (Fig. 3a). The growth of MHCC97 and 7404 cells were then analyzed by crystal violet assay and soft agar assay. The results from crystal violet assay revealed that knockdown the expression of RIP140 promoted the growth of MHCC97 and 7404 cells (Fig. 3b). Meanwhile, to further characterize the function of RIP140 in the cell growth regulation, cells were subjected to anchorage-independent growth assay using soft agar. Decreasing the expression of RIP140 enhanced the anchorage-independent growth of 7404 cells significantly (Fig. 3c). Furthermore, downregulation of RIP140 enhanced the migration of MHCC97 and 7404 cells (Fig. 3d). In summary, knockdown the expression of RIP140 promoted the growth and migration of HCC cells.

Fig. 5 Downregulation of RIP140 promoted the metastasis of MHCC97 cells in vivo. a Monitoring metastasis of bioluminescent MHCC97/si con and MHCC97/si RIP140 cells. Images were obtained 10, 20, 30, 40, and 50 days after injection, respectively. b Mean photon counts of each group of mice were quantified and were displayed over time. Each point represented the mean±SD. *P<0.05; **P<0.01

Tumor Biol.

The finding that overexpression of RIP140 inhibited the activity of TOPflash reporter and the expression of beta-catenin/TCF4 target genes raised the possibility that RIP140 might interact with the component of beta-catenin/TCF transcriptional complex. In the next study, we used immunoprecpitation to examine the interaction between RIP140 and beta-catenin. Indeed, the result from immunoprecipitation assay showed that the ectopic expressed HARIP140 formed a complex with Flag-beta-catenin (Fig. 4d). Furthermore, in endogenous co-immunoprecipitation assays, co-existence of beta-catenin and RIP140 within a complex was observed in MHCC97 cells (Fig. 4e). Moreover, knockdown the expression of RIP140 enhanced the anchorageindependent growth of 7404 cells, which could be rescued by the dominant negative beta-catenin (DN beta-catenin) (Fig. 4f). These observations suggested that RIP140 inhibited the growth and migration of HCC cells through negatively regulating beta-catenin/TCF signaling. Downregulation of RIP140 promoted the metastasis of MHCC97 cells in vivo The in vitro studies suggested that knockdown the expression of RIP140 promote cell migration. Therefore, we evaluated whether modulating endogenous RIP140 expression could influence the metastasis of MHCC97 cells in vivo by utilizing a tumor metastasis mouse model. Consistent with our in vitro observations, in the in vivo metastasis assay, bioluminescent signals appeared in MHCC97/si RIP140 cells injected mice 20 days after injection, and developed progressively stronger in the following weeks. However, much weaker bioluminescent signals and fewer metastatic lesions were detected in mice injected with MHCC97/si con cells (Fig. 5a, b). Collectively, knockdown of RIP140 promoted the metastasis of MHCC97 cells in vivo.

that RIP140 was a survival factor for the HCC patients and restoration of RIP140 would be a new strategy for the HCC treatment. RIP140 was first identified as a negative regulator of estrogen receptor signaling [18, 19]. More and more studies have found that RIP140 could regulate multiple signal pathways. RIP140 regulated the mammary gland development by promoting the generation of key mitogenic signals [34]. Also, RIP140 was found to function as a coactivator for cytokine gene expression by interacting with the NF-κB subunit RelA and histone acetylase cAMP-responsive element binding protein (CREB)-binding protein (CBP) [21]. In addition, RIP140 was reported as a repressor of the androgen receptor activity by interacting with androgen receptor directly [23]. The regulation of RIP140 on these cancer-related signal pathways indicated the function of RIP140 in the tumorigenesis. Recently, the functions of RIP140 in the tumorigensis have attracted much attention. RIP140 might be an attractive target to sensitize tumor cells to retinoid-based differentiation therapy in the cancer stem cell model [35]. Moreover, RIP140 was reported to control the intestinal homeostasis and tumorigenesis through upregulation of APC [36], a negative regulator of Wnt/beta-catenin signaling, which was very consistent with our observation in this study though RIP140 negatively regulated beta-catenin/TCF signaling in colon cancer and HCC through different mechanism. These studies suggested that RIP140 might regulate the activity of beta-catenin/TCF signaling at different levels. In conclusion, our results demonstrated that RIP140 was downregulated in HCC and RIP140 played a suppressive role in the HCC progression by inhibiting cell growth, migration, and metastasis. Our findings suggest that restoration of the function of RIP140 might be a therapeutic strategy for HCC. Acknowledgments This work was supported by the National Natural Science Foundation of China (81272728).

Discussion Although the recent advances have been made in clinical treatment, the prognosis of HCC is still poor. This is also the reason why HCC remains one of the major challenges for us to overcome. The high malignant behaviors of HCC, such as metastasis and overgrowth, are critical reasons for the high mortality rate of HCC. Moreover, the molecular mechanisms for the aggressive behaviors of HCC are complicated, and details regarding the malignant behavior of HCC remain unknown. In the current study, we used a comprehensive approach to identify RIP140 as a negative regulator involved in this event. It was found that the expression of RIP140 was decreased in HCC tissues compared with normal liver tissues. Downregulation of RIP140 was crucial for the growth and migration of HCC cells. In terms of benefits, this could imply

Conflicts of interest None

References 1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63(1):11–30. 2. Dwyer JP, Hosking P, Lubel J. Multiple liver lesions in a patient with positive hepatitis C serology and elevated AFP: is it HCC? Gastroenterology. 2014;147:e12–3. 3. Cho JY, Paik YH, Sohn W, et al. Patients with chronic hepatitis B treated with oral antiviral therapy retain a higher risk for HCC compared with patients with inactive stage disease. Gut. 2014;63: 1943–50. 4. Levi D, Tzakis A. HBV and HCC: comment on “Role of hepatitis B virus infection in the prognosis after hepatectomy for hepatocellular carcinoma in patients with cirrhosis: a Western dual-center experience”. Arch Surg. 2009;144(10):913.

Tumor Biol. 5. Enwonwu CO. The role of dietary aflatoxin in the genesis of hepatocellular cancer in developing countries. Lancet. 1984;2(8409):956–8. 6. Trevisani F, Cantarini MC, Labate AM, et al. Surveillance for hepatocellular carcinoma in elderly Italian patients with cirrhosis: effects on cancer staging and patient survival. Am J Gastroenterol. 2004;99(8):1470–6. 7. Park EK, Kim HJ, Kim CY, et al. A comparison between surgical resection and radiofrequency ablation in the treatment of hepatocellular carcinoma. Ann Surg Treat Res. 2012;87(2):72–80. 8. Yamashita Y, Imai D, Bekki Y, et al. Surgical outcomes of anatomical resection for solitary recurrent hepatocellular carcinoma. Anticancer Res. 2012;34(8):4421–6. 9. Wan HG, Xu H, Gu YM, Wang H, Xu W, Zu MH (2014) Comparison osteopontin vs AFP for the diagnosis of HCC: a metaanalysis. Clin Res Hepatol Gastroenterol. 10. De Rienzo G, Bishop JA, Mao Y, et al. Disc1 regulates both betacatenin-mediated and noncanonical Wnt signaling during vertebrate embryogenesis. Faseb J. 2012;25(12):4184–97. 11. Kolligs FT, Bommer G, Goke B. Wnt/beta-catenin/tcf signaling: a critical pathway in gastrointestinal tumorigenesis. Digestion. 2002;66(3):131–44. 12. Cong F, Schweizer L, Varmus H. Wnt signals across the plasma membrane to activate the beta-catenin pathway by forming oligomers containing its receptors, Frizzled and LRP. Development. 2004;131(20):5103–15. 13. Li YJ, Wei ZM, Meng YX, Ji XR. Beta-catenin up-regulates the expression of cyclinD1, c-myc and MMP-7 in human pancreatic cancer: relationships with carcinogenesis and metastasis. World J Gastroenterol. 2005;11(14):2117–23. 14. Stemmer V, de Craene B, Berx G, Behrens J. Snail promotes Wnt target gene expression and interacts with beta-catenin. Oncogene. 2008;27(37):5075–80. 15. Dahmani R, Just PA, Perret C. The Wnt/beta-catenin pathway as a therapeutic target in human hepatocellular carcinoma. Clin Res Hepatol Gastroenterol. 2009;35(11):709–13. 16. Cavard C, Colnot S, Audard V, et al. Wnt/beta-catenin pathway in hepatocellular carcinoma pathogenesis and liver physiology. Future Oncol. 2008;4(5):647–60. 17. Li P, Cao Y, Li Y, Zhou L, Liu X, Geng M. Expression of Wnt-5a and beta-catenin in primary hepatocellular carcinoma. Int J Clin Exp Pathol. 2012;7(6):3190–5. 18. Lin J, Ding L, Jin R, et al. Four and a half LIM domains 1 (FHL1) and receptor interacting protein of 140 kDa (RIP140) interact and cooperate in estrogen signaling. Int J Biochem Cell Biol. 2009;41(7): 1613–8. 19. Cavailles V, Dauvois S, L'Horset F, et al. Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. Embo J. 1995;14(15):3741–51. 20. Docquier A, Harmand PO, Fritsch S, Chanrion M, Darbon JM, Cavailles V. The transcriptional coregulator RIP140 represses E2F1 activity and discriminates breast cancer subtypes. Clin Cancer Res. 2012;16(11):2959–70.

21. Zschiedrich I, Hardeland U, Krones-Herzig A, et al. Coactivator function of RIP140 for NFkappaB/RelA-dependent cytokine gene expression. Blood. 2008;112(2):264–76. 22. Heery DM, Hoare S, Hussain S, Parker MG, Sheppard H. Core LXXLL motif sequences in CREB-binding protein, SRC1, and RIP140 define affinity and selectivity for steroid and retinoid receptors. J Biol Chem. 2001;276(9):6695–702. 23. Carascossa S, Gobinet J, Georget V, et al. Receptor-interacting protein 140 is a repressor of the androgen receptor activity. Mol Endocrinol. 2006;20(7):1506–18. 24. Docquier A, Augereau P, Lapierre M, et al. The RIP140 gene is a transcriptional target of E2F1. PLoS One. 2012;7(5):e35839. 25. Rytinki MM, Palvimo JJ. SUMOylation modulates the transcription repressor function of RIP140. J Biol Chem. 2008;283(17):11586–95. 26. Ho PC, Gupta P, Tsui YC, Ha SG, Huq M, Wei LN. Modulation of lysine acetylation-stimulated repressive activity by Erk2-mediated phosphorylation of RIP140 in adipocyte differentiation. Cell Signal. 2008;20(10):1911–9. 27. Heim KC, Gamsby JJ, Hever MP, et al. Retinoic acid mediates longpaced oscillations in retinoid receptor activity: evidence for a potential role for RIP140. PLoS One. 2009;4(10):e7639. 28. Puri V, Virbasius JV, Guilherme A, Czech MP. RNAi screens reveal novel metabolic regulators: RIP140, MAP4k4 and the lipid droplet associated fat specific protein (FSP) 27. Acta Physiol (Oxf). 2008;192(1):103–15. 29. Morganstein DL, Christian M, Turner JJ, Parker MG, White R. Conditionally immortalized white preadipocytes: a novel adipocyte model. J Lipid Res. 2008;49(3):679–85. 30. Puri V, Chakladar A, Virbasius JV, et al. RNAi-based gene silencing in primary mouse and human adipose tissues. J Lipid Res. 2007;48(2):465–71. 31. Powelka AM, Seth A, Virbasius JV, et al. Suppression of oxidative metabolism and mitochondrial biogenesis by the transcriptional corepressor RIP140 in mouse adipocytes. J Clin Invest. 2006;116(1): 125–36. 32. Xue J, Zhao H, Shang G, et al. RIP140 is associated with subclinical inflammation in type 2 diabetic patients. Exp Clin Endocrinol Diabetes. 2012;121(1):37–42. 33. Berriel Diaz M, Krones-Herzig A, Metzger D, et al. Nuclear receptor cofactor receptor interacting protein 140 controls hepatic triglyceride metabolism during wasting in mice. Hepatology. 2008;48(3):782–91. 34. Nautiyal J, Steel JH, Mane MR, et al. The transcriptional co-factor RIP140 regulates mammary gland development by promoting the generation of key mitogenic signals. Development. 2012;140(5): 1079–89. 35. Heim KC, White KA, Deng D, et al. Selective repression of retinoic acid target genes by RIP140 during induced tumor cell differentiation of pluripotent human embryonal carcinoma cells. Mol Cancer. 2007;6:57. 36. Lapierre M, Bonnet S, Bascoul-Mollevi C, et al. RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis. J Clin Invest. 2012;124(5):1899–913.