J Cancer Res Clin Oncol (2014) 140:419–426 DOI 10.1007/s00432-013-1581-3
ORIGINAL PAPER
High expression of metabotropic glutamate receptor 4: correlation with clinicopathologic characteristics and prognosis of osteosarcoma Wu Yang · He Maolin · Zhao Jinmin · Wang Zhe
Received: 15 December 2013 / Accepted: 30 December 2013 / Published online: 8 January 2014 © Springer-Verlag Berlin Heidelberg 2014
Abstract Purpose Analyze protein and gene expression of mGluRs (mGluR1, mGluR5, mGluR4) in osteosarcoma tissues and discuss the relation between expression level and clinical characteristics of osteosarcoma, and study the clinical significance. Methods Detect protein and mRNA expression level of mGluRs (mGluR1, mGluR5, mGluR4) in 40 osteosarcoma tissues and the corresponding adjacent normal tissues by Western blot and RT-PCR accordingly. Immunohistochemistry was adopted to detect the expression of mGluRs (mGluR1, mGluR5, mGluR4) in 118 paraffin embedded osteosarcoma tissues and eight normal bone tissues. Then, the correlation between the expression and clinical characteristics of patients was analyzed. Furthermore, survival analysis of osteosarcoma was performed to study the relation between expression level of mGluRs and patient prognosis. Results No correlation of mGluR1 and mGluR5 with clinicopathologic characteristics of osteosarcoma was found. Statistical analysis demonstrated that the expression level of mGluR4 shared no significant correlation with gender, age, histologic type and tumor location of patient, but was related to Enneking stage and tumor metastasis (P < 0.05). High mGluR4 expression is more frequently noted in the osteosarcoma tissues with higher Enneking
W. Yang · H. Maolin (*) · W. Zhe Division of Spinal Surgery, The First Affiliated Hospital of Guangxi Medical University, Nanning 530021, Guangxi Zhuang Autonomous Region, China e-mail:
[email protected] Z. Jinmin Department of Orthopedic Trauma and Hand Surgery, The First Affiliated Hospital of Guangxi Medical University, No. 6 Shuang Yong Rd., Nanning, Guangxi, China
stage and metastasis. The results of Western blot and RTPCR indicated a significantly increased expression level of mGluR4 gene and protein in osteosarcoma tissues compared with normal tissues. Though higher gene and protein expression of mGluR5 and mGluR1 were also indicated in osteosarcoma tissues compared with normal tissues, no statistical significance was noted for the difference (P > 0.05). According to the survival analysis of 118 osteosarcoma patients, cases in the mGluR4 high-expression group showed inferior disease-free survival rate and poorer overall survival rate. Conclusion High expression of mGluR4 in osteosarcoma tissues is related to poor prognosis, thus holding certain reference value for estimating prognosis of osteosarcoma patients. Keywords Osteosarcoma · mGluRs · Clinicopathologic characteristics · Prognosis
Introduction Osteosarcoma is the most common primary malignant bone tumor (Gill et al. 2013), and the incidence rate is about 3/1,000,000, occurring more among children and adolescents (Errani et al. 2011). Osteosarcoma is originated from mesenchymal tissue and is much noted in distal femur, proximal tibia and proximal humeral metaphyseal. Major clinical therapeutic strategy follows such a procedure as preoperative chemotherapy, operation and postoperative chemotherapy. Neoadjuvant chemotherapy has enhanced 5-year survival rate of patients to 50–60 % (Harting and Blakely 2006; Carrle and Bielack 2009). However, prognosis of patients with recurrence and metastasis is still poor. Therefore, a novel and more reliable gene marker is needed
13
420
to be identified to help estimate clinicopathologic characteristics and prognosis of osteosarcoma. Glutamic acid, the most important excitatory neurotransmitter in brain, is responsible for regulating normal signal. Most studies about glutamic signal are limited within central nervous system while new studies emphasize its effect on periphery tissues. Not only can glutamic acid maintain stable state of cells in central nervous system, it acts as a periphery simulating signal. As a result, a series of studies begin to focus on the pathophysiology of glutamic system in human diseases. There are two types of glutamate receptor: (1) Ionotropic glutamate receptor. It belongs to ligandgated ion channel, including NMDA, AMPA (α-amino3-hydroxy-5-methyl-4-isoxazolepropionic acid) and KA (kainic acid) receptors (Traynelis et al. 2010). (2) Metabotropic glutamate receptors (mGluRs). The mGluRs are members of G-protein-coupled receptors, and the structure of mGluRs can be divided into 3 parts: extracellular domain, seven transmembrane domain and intracellular domain. After activated by the ligands, mGluRs come into effect through G protein and second messenger in cells. Moreover, mGluRs can be separated into three groups according to the differences in homology of amino acid sequence, pharmacological property and signal transduction mechanism (Skerry and Genever 2001). Group I includes mGluR1 and mGluR5, which activate phospholipase C (PLC) pathway, leading to the hydrolysis of phosphatidylinositol (PI) and mobilization of intracellular Ca2+. Group II (mGluR2 and mGluR3) and Group III (mGluR4, mGluR6, mGluR7 and mGluR8) coupled negatively with adenylyl cyclase (AC), inhibiting the formation of cyclic AMP (cAMP) and further suppress protein kinase A (PKA) (Tanabe et al. 1992; Aramori and Nakanishi 1992; Skerry and Genever 2001). Metabotropic glutamate receptors mainly involve in maintaining stability of internal environment of cells in central nervous system. An increasing number of evidences have showed that mGluRs are new targets of human malignancies in addition to the effects in synaptic transmission. Pollock et al. (2003) first proved that abnormal expression of mGluR1 is the driving force of melanoma in transgenic mice. Other mGluRs have also been proved to be correlated with incidence of many tumors such as malignant neuroglioma (Takano et al. 2001) and medulloblastoma. However, it remains unknown whether mGluRs have become a key factor in the onset of osteosarcoma. In this study, we explored the correlation of mGluRs with the onset of osteosarcoma and its influence on the prognosis of patients.
Materials and methods Forty osteosarcoma specimens and the corresponding adjacent normal tissues were obtained from patients of the First
13
J Cancer Res Clin Oncol (2014) 140:419–426
Affiliated Hospital of Guangxi Medical University for Western blot and RT-PCR. As for immunohistochemistry test, the samples were from the pathology department of the First Affiliated Hospital of Guangxi Medical University, including 118 paraffin embedded osteosarcoma specimens and eight normal bone tissues. Osteosarcoma specimens were confirmed by pathological method. Information about osteosarcoma patients such as age, gender, Enneking stage, metastasis, tumor location and histologic subtype was collected from medical records. Regular follow-ups (1– 24 months, 20 months in average) were performed after the treatment of all patients, with their survival time, date of death and date of last follow-up being recorded. The overall survival time was from the time when therapy began to death time or the date of last follow-up. Disease-free survival time referred to the period between the diagnosis and the first recurrence or metastasis of osteosarcoma. All participants have signed informed consent paper. This study was approved by the ethics committee of the First Affiliated Hospital of Guangxi Medical University. Immunohistochemistry was adopted to determine mGluRs expression in osteosarcoma. Tissue antigen was repaired after dewaxing and hydration of paraffin sections. For each section, 3 % hydrogen peroxide (H2O2) was added to inactivate endogenous peroxidase and then was incubated for 10 min under room temperature. After rinse with PBS, a drop of normal goat serum was added as blocking liquid, and incubation was conducted for 10 min under room temperature. Then, the serum was removed and antimGluRs antibody (1:100, Takara, China) was added to each section followed by being kept overnight at 4 °C. Biotinlabeled second antibody (Zhongshan Biotechnology) was then added to each section followed by a 10-min incubation. Next, another 10-min incubation was performed at room temperature after horseradish peroxidase-labeled streptomycin avidin was added dropwise. Afterward, newly prepared DAB (Zhongshan Biotechnology, China) solution was added as color reagent followed by a 5-min reaction at room temperature. Then, the chromogenic reaction was interrupted by washing with PBS solution. Next, hematoxylin was used for counterstaining and ethanol dehydration was conducted by grade followed by addition of xylene to make the sections transparent. Finally, mounting was performed with neutral balsam. For immunohistochemical staining of osteosarcoma tissues, positive result is noted when cytoplasm is stained brown. All the results were reviewed and statistically summarized by two senior doctors in the pathology department of the First Affiliated Hospital of Guangxi Medical University. For each section, 10 high-power fields (×400) were observed randomly and grading was conducted according to the staining extent and the percentage of positive stained cells in the field of view. Score of the percentage of positive
421
J Cancer Res Clin Oncol (2014) 140:419–426 Table 1 Oligonucleotide sequences used in the polymerase chain reaction (PCR) Target cDNA
Forward primers
Reverse primer
Size of PCR product (bp)
Denaturation
Annealing
Extension
Cycles
mGluR1
CAAGGCTAGAGTGGTGGTCT
AGGGATTCCTCGTGTTAGTG
254
94 °C−30 s
58 °C−30 s
72 °C−15 s
38
mGluR5
TCCAGAATTTGCTCCAGCTT
CTTCCATCCCACTTTCTCCA
216
94 °C−30 s
60 °C−30 s
72 °C−15 s
38
mGluR4
GCCAGACCTGAGTGACAACA
CCGTGGTATCTTCACCGACT
226
94 °C−30 s
56 °C−30 s
72 °C−15 s
38
stained cells: 0 (0 %), 1 (1–10 %), 2 (11–50 %) and 3 (>50 %).Score of staining extent: 0 (negative), 1 (weak), 2 (moderate) and 3 (strong).The final immunohistochemical grade was calculated by multiplying the score of the percentage of positive stained cells and the score of staining extent. As the average score of immunohistochemistry was five, mGluRs were further divided into a low-expression group (score of immunohistochemistry lower than 5) and high-expression group (score of immunohistochemistry higher than 5). Reverse transcriptase polymerase chain reaction (RTPCR) was adopted to determine the expression of GRMs (the encoding gene of mGluRs). Trizol was used to extract total RNA of the tissues, and reverse transcription was conducted with high-capacity cDNA synthesis kit (Takara, China). Table 1 shows primer sequence of each sample cDNA, length of amplification product and reaction condition. About 10-μl PCR products were obtained for agarose gel electrophoresis, and image was formed by gel imaging system. Ratio between target gene stripe and the corresponding GAPDH stripe of each sample was determined, respectively. Semi-quantitative measurement was performed for electrophoretic bands, and expression abundance of mRNA was recorded. Determination of mGluRs expression by Western blot. Total cell protein was extracted by splitting tissues with RIPA (400 μl RIPA + 4 μl PMSF). Protein concentration was determined by BCA method. About 50-μg protein samples were obtained for sodium dodecyl sulfnate– polyacrylamide gel electrophoresis (SDS–PAGE). Then, the protein was transferred to PVDF membrane after electrophoresis and blocked with blocking liquid overnight at 4 °C. The samples were incubated with mGluRs rabbit polyclonal antibody (1:200, Takara, China) and β-actin rabbit polyclonal antibody (l:1,000), respectively. Next, after gentle shake for 3 h at room temperature, washing was conducted for three times with TBS (10 min/time). Then, a 2-h room temperature incubation was, respectively, performed with horseradish peroxidase-labeled goat anti-rabbit IgG (1:2,000, Takara, China). Afterwards, TBS washing was performed for three times (15 min/time). Finally, the result was observed after exposure of X-ray radiographs, development and fixation.
Analysis of Western blot result: density scan of Western blot hybrid stripe was performed with Bio-Rad image analysis software. The expression level of mGluRs in each tissue was indicated by the specific value of mGluRs stripe gray value and β-actin stripe gray value (Gray value was the product of stripe density value multiplying area value, supposing the relative density value of blank control was 0). SPSS19.0 software (SPSS Inc,USA) was adopted for statistical analysis. Spearman rank correlation was used to analyze the relation between the expression of mGluRs gene and protein. Chi-squared test was used to analyze difference of classified variable. Kaplan–Meier method and log-rank test were used for survival analysis. Statistical significance exists when P < 0.05.
Results Relation between increased mGluRs expression and clinicopathologic characteristics of osteosarcoma The site for mGluR4-positive staining is cytoplasm (Fig. 1). In the 118 osteosarcoma sections, 86 featured high mGluR4 expression while 32 with low mGluR4 expression (among which seven osteosarcoma cases expressed no mGluR4). The eight normal tissues all showed negative results. In order to further explore the role mGluR4 plays in the occurrence and development of osteosarcoma, we analyzed the correlation between expression of mGluR4 and clinicopathologic characteristics of osteosarcoma. As shown in Table 2, mGluR4 expression is noted in each stage of the tumor, while high mGluR4 expression is more frequently noted in the osteosarcoma tissues with higher Enneking stage and metastasis. No significant difference was found between mGluR4 expression level and such conditions of patients as age, gender, tumor location and histologic type. For mGluR1, 58 of 118 osteosarcoma showed high expression and 60 were of low-expression level (including 24 negative ones). No statistical significance exists between mGluR1 expression level and such conditions of patients as age, gender, Enneking stage, metastasis, tumor location and histologic type. For
13
422
J Cancer Res Clin Oncol (2014) 140:419–426
Table 2 Relation between mGluRs expression and clinicopathologic characteristics of osteosarcoma Features
Age Age <20 Age ≥20 Gender Female Male Tumor metastasis No Yes Enneking stages I IIA IIB III Histologic type Osteoblastic Chondroblastic Fibroblastic Mixed Location Femur Tibia Humurs Others
Number of cases
mGluR5 expression
mGluR1 expression
High
Low
P value
High
Low
P value
High
Low
P value
68 50
39 (57.4 %) 28 (56.0 %)
29 (42.6 %) 22 (44.0 %)
0.88
32 (47.1 %) 26 (52.0 %)
36 (52.9 %) 24 (48.0 %)
0.6
54 (79.4 %) 32 (64.0 %)
14 (20.6 %) 18 (36.0 %)
0.06
43 75
23 (53.5 %) 44 (58.7 %)
20 (46.5 %) 31 (41.3 %)
0.59
19 (44.2 %) 39 (52.0 %)
24 (55.8 %) 36 (48.0 %)
0.41
28 (65.1 %) 58 (77.3 %)
15 (34.9 %) 17 (22.7 %)
0.15
26 92
12 (46.2 %) 55 (59.8 %)
14 (53.8 %) 37 (40.2 %)
0.22
15 (57.7 %) 43 (46.7 %)
11 (42.3 %) 49 (53.3 %)
0.32
14 (53.8 %) 72 (78.3 %)
12 (46.2 %) 20 (21.7 %)
0.013
8 27 71 12
5 (62.5 %) 10 (37.0 %) 45 (63.4 %) 7 (58.3 %)
3 (37.5 %) 17 (63.0 %) 26 (36.6 %) 5 (41.7 %)
0.13
4 (50.0 %) 13 (48.1 %) 37 (52.1 %) 4 (33.3 %)
4 (50.0 %) 14 (51.9 %) 34 (47.9 %) 8 (66.7 %)
0.69
3 (37.5 %) 16 (59.3 %) 57 (80.3 %) 10 (83.3 %)
5 (62.5 %) 11 (40.7 %) 14 (19.7 %) 2 (16.7 %)
0.017
38 40 12 28
25 (65.8 %) 19 (47.5 %) 6 (50.0 %) 17 (60.7 %)
13 (34.2 %) 21 (52.5 %) 6 (50.0 %) 11 (39.3 %)
0.38
17 (44.7 %) 23 (57.5 %) 5 (41.7 %) 13 (46.4 %)
21 (55.3 %) 17 (42.5 %) 7 (58.3 %) 15 (53.6 %)
0.62
31 (81.6 %) 27 (67.5 %) 8 (66.7 %) 20 (71.4 %)
7 (18.4 %) 13 (32.5 %) 4 (33.3 %) 8 (28.6 %)
0.51
56 38 16
34 (60.7 %) 22 (57.9 %) 9 (56.3 %)
22 (39.3 %) 16 (42.1 %) 7 (43.8 %)
0.3
29 (51.8 %) 20 (52.6 %) 6 (37.5 %)
27 (48.2 %) 18 (47.4 %) 10 (62.5 %)
0.65
44 (78.6 %) 28 (73.7 %) 9 (56.3 %)
12 (21.4 %) 10 (26.3 %) 7 (43.8 %)
0.31
8
2 (25.0 %)
6 (75.0 %)
3 (37.5 %)
5 (62.5 %)
5 (62.5 %)
3 (37.5 %)
mGluR5, 67 osteosarcoma sections indicate high mGluR5 expression while low expression is noted in 51 osteosarcoma sections (19 negative cases included).No significant difference is noted between mGluR5 expression and clinicopathologic characteristics.
mGluR4 expression
(P < 0.001). For mGluR5, higher expression of mRNA and protein was also noted in osteosarcoma compared with normal tissues, but the difference held no statistical meaning (P > 0.05). For mGluR1, there was also no significant difference between osteosarcoma and normal tissues in the mRNA and protein expression (P > 0.05).
High expression of mGluR4 was noted in osteosarcoma Figure 2 indicates a significant increase in mGluR4 gene expression in osteosarcoma compared with that of normal tissues. Statistical analysis shows a significantly higher mGluR4 mRNA expression in osteosarcoma (mean ± SD: 1.81 ± 0.33) than that (mean ± SD: 0.72 ± 0.25; P < 0.05) in normal tissues. In order to determine the constancy between protein and mRNA expression of mGluR4, Western blot was adopted to evaluate mGluR4 expression in osteosarcoma. As shown in Fig. 3, the mGluR4 protein expression level in osteosarcoma (mean ± SD: 1.31 ± 0.35) is significantly higher than that (mean ± SD: 0.37 ± 0.20) in normal tissues. More importantly, significant relevance has been noted between GRM4 (the encoding gene of mGluR4) expression and mGluR4 expression
13
mGluR4 expression is correlated with poor prognosis of patients with osteosarcoma Kaplan–Meier survival analysis was adopted to evaluate mGluR4 expression and survival time of patients with osteosarcoma. During the follow-up, 29 (33.7 %) of the 86 patients with high mGluR4 expression died, and 8 (25 %) of the 32 patients with low mGluR4 expression died. As shown in the log-rank test in Fig. 4, the overall survival rate and disease-free survival rate of osteosarcoma patients with high mGluR4 expression level are lower than that of patients with low mGluR4 expression (P < 0.05). It is evident that mGluR4 may be a significant biomarker for evaluating prognosis of osteosarcoma patients.
J Cancer Res Clin Oncol (2014) 140:419–426
Fig. 1 Immunostaining of mGluRs in osteosarcoma tissues. a Osteosarcoma tissues with high mGluR4 expression; b osteosarcoma tissues with low mGluR4 expression; c osteosarcoma tissues with high mGluR5 expression; d osteosarcoma tissues with low mGluR5
423
expression; e osteosarcoma tissues with high mGluR1 expression; f osteosarcoma tissues with low mGluR1 expression; g negative; h Normal tissue (OS is short for osteosarcoma, N is short for normal tissue)
Fig. 2 mRNA expression of 40 osteosarcoma tissues analyzed by RT-PCR. a The results of mGluRs RT-PCR analyzed by SDS–PAGE; b histograms show the mGluRs mRNA expression in osteosarcoma tissues and normal tissues (OS is short for osteosarcoma, N is short for normal tissue)
Discussion Most previous studies of mGluRs mainly focused on cells of central nervous system as mGluRs largely involve in studying, memorizing and pain transmission. Currently, mGluRs expression is also noted in peripheral nonneuronal tissues, including bone (Patton et al. 1998), skin (Genever et al. 1999), colon and pancreas (Brice et al. 2002). Potential relations of glutamate signals do exist, respectively, with proliferation of keratinocyte and regulation of insulin secretion, which suggests that peripheral glutamate receptors involve in various physiological functions. For example, glutamate signals participate in the differentiation of osteoblast, while bone relies on extracellular signal system
to maintain dynamic equilibrium of its structure and function. Glutamate acts as the most primary extracellular signal molecule in many tissues. Glutamate signals participate in the excitation of gonadotrophin-releasing hormone neurons. The expression of mGluR4 in osteoblast and osteoclast indicates glutamate signals involve in cell differentiation and regulation during bone formation and reabsorption (Skerry 2008). Once high expression of mGluR4 occurs, dynamic equilibrium between osteoblast and osteoclast will be broken, which may result in cancer. It is interesting to study the effect of mGluRs in osteosarcoma cases. Particularly, after Kalariti found the expression of mGluR1, mGluR2, mGluR3, mGluR4, mGluR5 and mGluR8 mRNA in MG-63 osteoblast-like osteosarcoma cells (Kalariti
13
424
J Cancer Res Clin Oncol (2014) 140:419–426
Fig. 3 Protein expression of 40 osteosarcoma tissues analyzed by Western blot. a mGluRs protein expression in osteosarcoma tissues and normal tissues analyzed by Western blot; b histograms show the mGluRs protein expression in osteosarcoma tissues and normal tissues (OS is short for osteosarcoma, N is short for normal tissue)
Fig. 4 Survival analysis of osteosarcoma patients. The overall survival time (a) and disease-free survival time (b) of patients in mGluR4 high-expression group and mGluR4 low-expression group; The 2-year survival rate of osteosarcoma patients with high mGluR4 expression is significantly lower than that of patients with low mGluR4 expression
et al. 2004), Savage proved that GRM4 is the candidate gene for osteosarcoma onset (Savage et al. 2013), further verifying the underlying correlation between the onset of osteosarcoma and mGluR4. This study explored the relation between mGluRs expression and the clinicopathologic characteristics of osteosarcoma, featuring its underlying clinical value in predicting cancer prognosis. It was noted from the data that the expression level of mGluR4 was higher than that of normal bone tissues. Moreover, an increasing number of evidences demonstrate the pathophysiological effect of mGluRs in oncogenesis. Recently, a study has been carried out about mGluRs expression in nerve cell lines and non-nerve cell lines (Stepulak et al. 2009). The study reported that mGluRs express in mRNA level in many human tumor cell lines. This study team utilized probe to detect mGluRs expression and further predict such tumors in central nervous system as spongiocytoma and medulloblastoma (Brocke et al. 2010). The team also identified high expression of mGluR1 and mGluR4-6 in tumors with higher malignancy grade. In
13
addition, Seidlitz and colleagues analyzed some tumor cell lines with bone metastasis tendency and found that these cell lines secrete more glutamic acid to the extracellular microenvironment through cysteine/glutamate antiporter (Seidlitz et al. 2009; Sharma et al. 2010). As glutamate signals play a role in maintaining bone homeostasis, transferred cancer cells may take advantage of this characteristic to be carcinogenic (Seidlitz et al. 2010). Chang and colleagues identified that mGluR4 is correlated with colorectal cancer. In their follow-up, high mGluR4 expression was noted in 54 % colorectal cancer cases and was related to poor prognosis. Moreover, this team found that the antagonist of mGluR4 could inhibit proliferation of colorectal cancer cells (Chang et al. 2005). Our data suggested that high mGluR4 expression was related to Enneking stage and metastasis of osteosarcoma, but the physiological effect of this molecule on the recurrence and metastasis of osteosarcoma remains unknown. Many regulating pathways couple with mGluR signals (including mitogen-activated protein kinases, phosphatidyl
425
J Cancer Res Clin Oncol (2014) 140:419–426
inositol 3-kinase and phospholipase C) to inhibit cAMP pathway (Peavy et al. 2001; Iacovelli et al. 2002; Thandi et al. 2002). All these pathways are correlated with cell proliferation, differentiation and anti-apoptosis, indicating that high mGluR4 expression may influence the biological behaviors of osteosarcoma cells (Marinissen and Gutkind 2001). Though our study could not explain the oncogenic mechanism of mGluR4 signaling pathway in detail, the results were in accordance with the previous conclusion that mGluR4 signaling pathway involved in tumor development and deterioration. In the immunohistochemical test, high mGluR4 expression was shown in both osteosarcoma tissues with higher Enneking stage and metastasis. GWAS indicated that GRM4 is the candidate gene for the onset of osteosarcoma (Savage et al. 2013). mGluR4 (encoded by GRM4) involves in intracellular signal transmission and couples negatively with adenylate cyclase (AC) to inhibit cAMP signaling cascade reation. In mice, cAMP relies on a kinase which is the product of a vital cancer suppressor gene in osteosarcoma (Molyneux et al. 2010; Griffin et al. 2004). When the cancer suppression effect of this kinase decreases, oncogenesis will be prompted. GRM4 expresses in osteosarcoma (Kalariti et al. 2004) and is related to poor prognosis of such tumors as colorectal cancer (Chang et al. 2005), pediatric central nervous system tumors (Brocke et al. 2010), rhabdomyosarcoma and multiple myeloma (Stepulak et al. 2009). This is in accordance with our results. Poor prognosis is noted in patients with high mGluR4 expression. The study of Park showed that in 131 oral cancer cases, 42 cases showed strong mGluR5 positive, along with 52 weak positive and 37 negative. mGluR5 may be related to migration and invasion of oral squamous cell carcinoma (Park et al. 2007). Teh and Chen (2012) found that 60 % of 175 melanoma biopsies expressed mGluR1 mRNA and protein, and mGluR1 plays an important role in the genesis of melanoma. It is obvious that mGluR5 and mGluR1 are related to the onset of other tumors. However, our immunohistochemical results showed that in 118 osteosarcoma tissues, 58 cases demonstrated high mGluR1 expression while 60 with low expression. For mGluR5, 67 of the 118 osteosarcoma tissues showed mGluR5 high expression and 51 with low expression. No correlation of mGluR1 and mGluR5 was noted with the clinical data of osteosarcoma. As a result, mGluR5 and mGluR1 may have no correlation with the occurrence of osteosarcoma, though they are expressed in osteosarcoma tissues. Deficiencies still exist in this study. First, inadequate samples undermined the statistical reliability, and it is necessary to conduct broader and better experiments to verify the pathophysiological effect of mGluR4 in the incidence of osteosarcoma. Second, theoretical foundation is insufficient as too few studies are about the carcinogenic mechanism
of mGluR4. Finally, in vivo animal experiments are needed as to determine the incidence rate of osteosarcoma in mice after mGluR4 gene is knocked out and observe whether there is a decline. In general, high mGluR4 expression is noted in osteosarcoma in both mRNA and protein levels, significantly influencing staging and metastasis of osteosarcoma. Though the carcinogenic mechanism of mGluR4 is still unknown, our results proved that high mGluR4 expression is correlated with poor prognosis of osteosarcoma. The studies above provide preliminary study for in vivo experiments of mGluR4, with further study being needed to verify the significance and clinical correlation of this discovery. Acknowledgments This research was supported by the National Natural Science Foundation of China (Grant No. 81160323) and the Guangxi Innovative Program of Graduate Education (Grant No. YCSZ2013035). Conflict of interest None.
References Aramori I, Nakanishi S (1992) Signal transduction and pharmacological characteristics of a metabotropic glutamate receptor, mGluR1, in transfected CHO cells. Neuron 8:757–765 Brice NL, Varadi A, Ashcroft SJ et al (2002) Metabotropic glutamate and GABA (B) receptors contribute to the modulation of glucosestimulated insulin secretion in pancreatic beta cells. Diabetologia 45:242–252 Brocke KS, Staufner C, Luksch H et al (2010) Glutamate receptors in pediatric tumors of the central nervous system. Cancer Biol Ther 9:455–468 Carrle D, Bielack S (2009) Osteosarcoma lung metastases detection and principles of multimodal therapy. Cancer Treat Res 152:165–184 Chang HJ, Yoo BC, Lim SB et al (2005) Metabotropic glutamate receptor 4 expression in colorectal carcinoma and its prognostic significance. Clin Cancer Res 11:3288–3295 Errani C, Longhi A, Rossi G et al (2011) Palliative therapy for osteosarcoma. Expert Rev Anticancer Ther 11:217–227 Genever PG, Maxfield SJ, Kennovin GD et al (1999) Evidence for a novel glutamate-mediated signaling pathway in keratinocytes. J Invest Dermatol 112:337–342 Gill J, Ahluwalia MK, Geller D et al (2013) New targets and approaches in osteosarcoma. Pharmacol Ther 137:89–99 Griffin KJ, Kirschner LS, Matyakhina L et al (2004) A transgenic mouse bearing an antisense construct of regulatory subunit type 1A of protein kinase a develops endocrine and other tumours: comparison with Carney Complex and other PRKAR1A induced lesions. J Med Genet 41:923–931 Harting MT, Blakely ML (2006) Management of osteosarcoma pulmonary metastases. Semin Pediatr Surg 15:25–29 Iacovelli L, Bruno V, Salvatore L et al (2002) Native group-III metabotropic glutamate receptors are coupled to the mitogenactivated protein kinase/phosphatidylinositol-3-kinase pathways. J Neurochem 82:216–223 Kalariti N, Lembessis P, Koutsilieris M (2004) Characterization of the glutametergic system in MG-63 osteoblast-like osteosarcoma cells. Anticancer Res 24:3923–3929
13
426 Marinissen MJ, Gutkind JS (2001) G-protein-coupled receptors and signaling networks: emerging paradigms. Trends Pharmacol Sci 22:368–376 Molyneux SD, Di Grappa MA, Beristain AG et al (2010) Prkar1a is an osteosarcoma tumor suppressor that defines a molecular subclass in mice. J Clin Invest 120:3310–3325 Park SY, Lee SA, Han IH et al (2007) Clinical significance of metabotropic glutamate receptor 5 expression in oral squamous cell carcinoma. Oncol Rep 17:81–87 Patton AJ, Genever PG, Birch MA et al (1998) Expression of an N-methyl-D-aspartate-type receptor by human and rat osteoblasts and osteoclasts suggests a novel glutamate signaling pathway in bone. Bone 22:645–649 Peavy RD, Chang MS, Sanders-Bush E et al (2001) Metabotropic glutamate receptor 5-induced phosphorylation of extracellular signal-regulated kinase in astrocytes depends on transactivation of the epidermal growth factor receptor. J Neurosci 21:9619–9628 Pollock PM, Cohen-Solal K, Sood R et al (2003) Melanoma mouse model implicates metabotropic glutamate signaling in melanocytic neoplasia. Nat Genet 34:108–112 Savage SA, Mirabello L, Wang Z et al (2013) Genome-wide association study identifies two susceptibility loci for osteosarcoma. Nat Genet 45:799–803 Seidlitz EP, Sharma MK, Saikali Z et al (2009) Cancer cell lines release glutamate into the extracellular environment. Clin Exp Metastasis 26:781–787 Seidlitz EP, Sharma MK, Singh G (2010) Extracellular glutamate alters mature osteoclast and osteoblast functions. Can J Physiol Pharmacol 88:929–936
13
J Cancer Res Clin Oncol (2014) 140:419–426 Sharma MK, Seidlitz EP, Singh G (2010) Cancer cells release glutamate via the cystine/glutamate antiporter. Biochem Biophys Res Commun 391:91–95 Skerry TM (2008) The role of glutamate in the regulation of bone mass and architecture. J Musculoskelet Neuronal Interact 8:166–173 Skerry TM, Genever PG (2001) Glutamate signalling in non-neuronal tissues. Trends Pharmacol Sci 22:174–181 Stepulak A, Luksch H, Gebhardt C et al (2009) Expression of glutamate receptor subunits in human cancers. Histochem Cell Biol 132:435–445 Takano T, Lin JH, Arcuino G et al (2001) Glutamate release promotes growth of malignant gliomas. Nat Med 7:1010–1015 Tanabe Y, Masu M, Ishii T et al (1992) A family of metabotropic glutamate receptors. Neuron 8:169–179 Teh J, Chen S (2012) mGlu Receptors and cancerous growth. Wiley Interdiscip Rev Membr Transp Signal 1:211–220 Thandi S, Blank JL, Challiss RA (2002) Group-I metabotropic glutamate receptors, mGlu1a and mGlu5a, couple to extracellular signal-regulated kinase (ERK) activation via distinct, but overlapping, signalling pathways. J Neurochem 83:1139–1153 Traynelis SF, Wollmuth LP, McBain CJ et al (2010) Glutamate receptor ion channels: structure, regulation, and function. Pharmacol Rev 62:405–496
