ISSN 1021-4437, Russian Journal of Plant Physiology, 2017, Vol. 64, No. 1, pp. 41–47. © Pleiades Publishing, Ltd., 2017. Original Russian Text © A.P. Tyunin, K.V. Kiselev, 2017, published in Fiziologiya Rastenii, 2017, Vol. 64, No. 1, pp. 47–54.

RESEARCH PAPERS

Influence of Increased Expression of VaMyb1 Transcription Factor on Biosynthesis of Resvetralol in the Cells of Amur Grape (Vitis amurensis) A. P. Tyunina, * and K. V. Kiseleva, b aInstitute of Biology and Soil Science, Far Eastern Branch, Russian Academy of Sciences, pr. Stoletiya Vladivostoka 159, Vladivostok, 690022 Russia b Far Eastern Federal University, Vladivostok, 690950 Russia *e-mail: [email protected]

Received January 29, 2016

Abstract—Among the many secondary plant metabolites, resveratrol attracts the attention of researchers because of its unique biological and pharmacological properties. Amur grape (Vitis amurensis Rupr.), including resveratrol-producing plant, has a high level of content of phenolic compounds. Despite a number of activities aimed at the study of the regulation of the biosynthesis of resveratrol, an understanding of the mechanism of transcriptional regulation of genes of key enzymes of this metabolic pathway—the STS gene—it has a lot of white spots. This study aims to examine the role in the biosynthesis of resveratrol transcription factor VaMyb1 belonging to a large group R2R3-Myb transcription factors plant. During the study of the transcription factor gene expression in the cells of V. amurensis and the impact of its increased expression in the content of resveratrol and the expression of STS genes, evidence of its negative role in the biosynthesis of resveratrol was obtained. Keywords: Vitis amurensis, resveratrol, R2R3-Myb transcription factors, STS DOI: 10.1134/S1021443716060145

INTRODUCTION

with the formation of resveratrol molecule [5]. Despite a detailed study of the mechanism of reaction of resveratrol formation in vivo, the greatest interest is raised by the questions on the value of genetic diversity of stilbene synthases and possible ways of regulating their expression in genomes of plants producing stilbenes. Two closely related STS genes have been identified in the genome of a peanut Arachis hypogaea [6], the presence of four genes of this family was shown in the genome of Scots pine Pinus sylvestris [7], and 48 STS genes were described in the genome of grape Vitis vinifera after whole-genome sequencing [8]. The value of such a large number of STS genes in the genome of V. vinifera is not reducible to a simple need to increase the content of stilbenes in plant tissues, but it is probably related to the presence of many different signaling pathways, leading to the activation of the expression of individual STS genes [8]. Activation of stilbenes’ biosynthesis in grapes is associated with mechanical damage, higher doses of UV irradiation [9], water deficit [10], and pathogenic infection [11]. It is most likely that such a number of stimuli of different nature, affecting different signaling pathways of plant cell and leading to the activation of resveratrol biosynthesis, was the cause of a functional differentiation of genes within the STS family in grapes [8]. However, the

Stilbenes are a small group of low molecular weight phenolic compounds, derivatives of phenylpropanoid biosynthetic pathway of secondary metabolites. Despite a relatively low normal level of stilbenes, the impact of unfavorable factors of abiotic or biotic nature on plants greatly increases this indicator. Stilbenes contained in plants, such as grapes, cranberries, blueberries, peanuts, and sorghum, have become objects of attention of scientists because of their unique pharmacological properties [1]. Among others, resveratrol (3, 4', 5-trihydroxy-trans-stilbene) has powerful antioxidant properties and can prevent the lipid oxidation process [1], reducing the likelihood of cardiovascular diseases [2]. Being a founder of stilbene biosynthesis in grapes, resveratrol possesses cytotoxic properties against tumor cells and the ability to stop their proliferation, acting through many signaling pathways [3, 4]. Stilbene synthase is the key enzyme in the biosynthesis of resveratrol (STS, EC 2.3.1.95); it directly catalyzes the aldol condensation of three molecules of malonyl-CoA and one molecule of coumaryl CoA Abbreviations: S.E.—standard error; STS—stilbene synthase.

41

42

TYUNIN, KISELEV

transcriptional regulation of the large family of genes encoding stilbene synthases in grapes, leading to the activation or inhibition of resveratrol biosynthesis process, still has a lot of white spots. Phenylpropanoid pathway of secondary metabolism in plants of the genus Vitis is not limited to the biosynthesis of stilbenes, producing and distributing a group of substances collectively named as flavonoids. It was found that the regulation of flavonoid biosynthesis is carried out by a large group of transcription factors belonging to R2R3-MYB family and including 108 enzymes in V. vinifera [12]. It is known that the members of this family of transcription factors regulate many important life processes of plant organism: the differentiation of epidermal cells [13], cold tolerance [14], resistance to drought and pathogenic infections [15, 16]. Taking into account a wide range of functions of transcription factors from R2R3-MYB family, including the regulation of the biosynthesis of flavonoids and a conjugation between the biosyntheses of flavonoids and stilbenes, it is most likely that STS genes are regulated by R2R3-MYB transcription factors. Thus, the main objective of this study is to examine the role of individual representatives of R2R3-MYB transcription factors in the regulation of resveratrol biosynthesis in the cells of the Amur grape Vitis amurensis Rupr. Cell cultures of the Amur grape V. amurensis are a convenient model system for studying the processes of regulation of resveratrol biosynthesis and the role of R2R3-MYB transcription factors. Among other members of the genus Vitis, Amur grape has a high tolerance to abiotic stresses and relatively high levels of resveratrol [17]. Among other things, cell cultures of V. amurensis synthesized mainly resveratrol instead of its derivatives and other phenolic compounds [18], which is particularly important in studying the regulation of stilbene biosynthesis. In the course of the study, we were able to isolate mRNA of VaMyb1 (GenBank: KM196537), whose expression was inversely related to the level of resveratrol production in the cells of V. amurensis. Transgenic cell cultures of grape V. amurensis with decreasing resveratrol content, expressing increased levels of VaMyb1 gene, were obtained with Agrobacterium-mediated transformation. According to results, VaMyb1 transcription factor is able to negatively regulate the process of resveratrol biosynthesis in the cells of V. amurensis. MATERIALS AND METHODS Callus cell cultures of V. amurensis. V2 cell culture, which was produced at the Laboratory of Biotechnology in Biology and Soil Institute (Far Eastern Branch, Russian Academy of Sciences) in 2004 from young stems of V. amurensis, was used to investigate the effect of inductors of resveratrol production on the cells of the Amur grape (Vitis amurensis Rupr.). Calli repre-

sent a loose and actively growing homogeneous tissue, exhibiting no tendency to differentiation. Phenylalanine (PA), the precursor in the biosynthesis of resveratrol, was used as an inducer of resveratrol production. Cultivation of cells was carried out in 15 mL glass tubes on a solid WB/A medium [19], containing 2 mg/L BAP and 0.5 mg/L NAA, in the dark at 24–25°C with 35 days of subcultivation [18, 19]. Isolation of nucleic acids and reverse transcription PCR (RT-PCR). Total RNA was isolated by the method that had been optimized for plant tissues rich in secondary metabolites, using lithium chloride [20]. Complementary DNA (cDNA) was prepared using 1.5 μg of total RNA with a kit for reverse transcription (Sileks M, Russia). To perform RT-PCR, 50 μL reaction mixture, containing 1x RT buffer, 0.25 mM of each of four dNTPs, 0.2 μM oligo-(dT)15 primer, and 200 e. u. of M-MLV-reverse transcriptase, was used. The reaction was carried out at 37°C during 1.5 h. Degenerate oligonucleotide primers 5'GCHCCHTGYTGYGAYAA and 5'TTVATYTCRTTRTCDGT, selected on the basis of known amino acid sequences of R2R3-MYB proteins from Arabidopsis Arabidopsis thaliana and grape V. vinifera (GenBank: XP_002884928, XP_002892910, XP_002891877, AEE36212, NP_001267930, NP_001268129, ABL14066, ABL14065, NP_001267946), were used to amplify cDNA areas of gene transcripts from R2R3MYB family in cDNA preparations from cell cultures and vines of V. amurensis. PCR reaction with cDNA and given primers was performed at 53°C, resulting in 403 bp amplicons specific to cDNA of R2R3-MYB transcripts [21]. Specific primers were used for the amplification of the complete cDNA sequence of VaMyb1 gene: 5'ATGGTAAGAGCTCCYTGTTGYGAT and 5'TCAAAGCTCCTGTAAGCCGCCAG; they were selected on the basis of the nucleotide sequence of Myb-related protein Myb4 transcription factor from V. vinifera, which had the closest nucleotide sequence (99% identity) to VaMyb1 (GenBank: XM_002285157). VTF1-1 and VTF1-2 transgenic cell lines of V. amurensis. Vector systems pSAT1 and pSAT1-EGFP were used to prepare VTF1-1 and VTF1-2 cell cultures, respectively [22]. Full-length cDNA sequences of VaMyb1 gene (GenBank: KM196537) were amplified with primers containing BglII and BamHI restriction sites that were necessary for cloning into pSAT1 and pSAT1-EGFP vectors under control of double 35S RNA CaMV promoter. Expression cassettes containing VaMyb1 nucleotide sequences were transferred into a binary vector pZP-RCS2-nptII [22]. We used restriction enzymes of the SibEnzim company (Russia). Used vector systems had been kindly provided by Professor Alexander Krichevsky (New York University, United States). To obtain transgenic cell cultures of V. amurensis, the strains of Agrobacterium tumefaciens

RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 64

No. 1

2017

INFLUENCE OF INCREASED EXPRESSION OF VaMyb1 TRANSCRIPTION FACTOR

(GV3101:pMP90), containing derived constructs with full-length nucleotide sequences of VaMyb1 gene (pZP-RCS2-VaMyb1-nptII), were cocultured with a suspension culture of V. amurensis according to [18]. After 7 days of culturing, cells were transferred to solid media, containing cefotaxime (250 mg/L) and kanamycin (10–20 mg/L) with a subcultivation period of 35 days for further selection. Aggregates of transgenic cells were taken in a further analysis after 3 months of selection on kanamycin. To confirm the transgenicity of produced lines, cDNA was analyzed for the expression of nptII gene for the resistance to the selective marker (kanamycin) by PCR with a primer pair: 5'ATTCGACCACCAAGCGAAAC and 5'TCAGAAGAACTCGTCAAGAA, flanking the site of 400 bp, with an annealing temperature of 55°C and elongation time 40 s. The absence of Agrobacterium-mediated contamination was confirmed by the PCR, using primers with a sequence specific to virB2 agrobacterial gene: 5'ATGCGATGCTTTGAAAGATACCG and 5'TTAGCCACCTCCAGTCAGCG, which flank the area of 366 bp with an annealing temperature of 55°C and an elongation time of 38 s. To analyze the expression of VaMyb1 transgenic sequence, real-time PCR with SYBR Green was carried out, using primer pairs S1: 5'AGGAGTACTCAACGGAATCATT and pSAT1a 5'GAGAGACTGGTGATTTTTGCG, complementary to the 3'-terminal protein-encoding nucleotide sequence of VaMyb1 and 35S CaMV terminator included into pSAT1 and pSAT1-EGFP vectors. Primers S1 and A2: 5'TTTCTCGGACTTTTCTGTGGA were used to analyze the expression of the endogenous nucleotide sequence of VaMyb1 gene. PCR was performed in 20 μL of a reaction mixture, containing 1x Taq buffer “B,” 2.5 mM MgCl2, 250 μM dNTP, 1 U Taq DNA polymerase, 0.5 μL (15 ng) of cDNA, 0.25 μM of each primer for each analyzed gene (Real-time PCR Kit, Syntol, Russia), and 1x EvaGreen (Biotium, United Statse) fluorescent dye. PCR conditions were 2 min at 95°C, followed by 50 cycles: 10 s at 95°C and 25 s at 62°C. Actin1 and GAPDH genes of V. amurensis (GenBank: AY907207; GU585870) were used as endogenous controls for normalization and calculation of data according to [23]. The data from three independent experiments were used for the calculations. The expression analysis of VaSTS gene family was performed using real-time PCR with TaqMan probes according to [19]. Components of nutrient media. The component of nutrient media, phenylalanine (PA), was received from ICN Biomedicals, United States. PA aqueous solution was added to the culturing media prior to autoclaving. The final concentrations of PA in media were 0.1 mM, 0.5 mM, and 2 mM [24]. High performance liquid chromatography (HPLC). To perform the HPLC analysis, 100 mg of dried RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 64

43

homogenized sample of cell cultures were extracted in 3 mL of 96% ethanol for 2 hours at 60°C. The solution of dried resveratrol (3,4',5-trihydroxy-trans-stilbene) (Sigma-Aldrich, United States), diluted in ethanol, was used as a standard to determine the concentration of resveratrol in the samples. Analytical HPLC with UV detection was carried out on the basis of the Center for Collective Use of the Federal State Institution of Science Institute of Biology and Soil Science, Far Eastern Branch, Russian Academy of Sciences. Quantitative determination of resveratrol in the samples was performed on a 1260 Infinity chromatograph (Agilent, United States) equipped with a Quaternary Pump G1311S high-pressure pump system, G1329B autoinjector, G1316A column thermostat, and detector with G1315D diode matrix. Separation of the extracts of components was performed on a Zorbax C18 column (150 × 2.1 mm, 3.5 μm, Agilent) at 40°C. The mobile phase consisted of a solution of acetic acid (0.1%) in deionized water (A) and acetonitrile (B). Gradient elution was performed with a solvent flow rate of 0.2 mL/min as follows: (0% B → 40% B) from 0 to 35 minutes (40% B → 50% B) from 35 to 40 minutes (50% B → 100% B) from 40 to 50 minutes. The extracts were filtered through a nylon filter (Millipore, United States) with a pore size of 0.45 μm before the analysis, and 1.5 μL aliquots were used for the analytical chromatography. UV spectra were recorded in the range of λ from 200 nm to 400 nm. Chromatograms were recorded at λ = 310 nm for the quantitative determination of resveratrol [18]. Sequencing of RT-PCR products. Sequencing was performed using a kit Big Dye Terminator Cycle Sequencing Kit v3.1 according to the manufacturer’s protocol and ABI 3130 Genetic Analyzer (Applied Biosystems, United States) on the basis of the Federal State Institution of Science Institute of Biology and Soil Science (Far Eastern Branch, Russian Academy of Sciences). Statistical analysis. Results were processed using the Statistica v. 10 software. All data were presented as mean value ± standard error and tested by Student’s ttest. The significance level P < 0.05 was chosen as the minimum value of statistical difference in all experiments. RESULTS AND DISCUSSION VaMyb1 Transcription Factor Phenolic metabolism in the cells of the Amur grape Vitis amurensis Rupr. provides the biosynthesis of many important compounds, including resveratrol as one of the most valuable ones, because of its high pharmacological activity. Despite this fact, the role of transcription factors in the regulation of the biosynthetic pathway was not covered in detail for a long time. To determine the potential regulator of the expression of major genes for resveratrol biosynthesis, No. 1

2017

44

TYUNIN, KISELEV

Amount of gene PCR products VaMyb1, %

100 * 75

**

50 25 0

V2-C

degenerate primers, we were able to note a statistically significant reduction in the number of cloned PCR products of VaMyb1 gene in the cDNA preparations with PA treatment compared with control (Fig. 1). Data on the frequency of occurrence of VaMyb1 transcript showed strong expression of this gene in the cell culture of grape V. amurensis under normal conditions and the decrease of its expression under the influence of PA; thus, obtaining the full-length nucleotide sequence of protein-coding region of the gene and studying its role in resveratrol biosynthesis was our further aim.

V2-PA(0.1) V2-PA(0.5) V2-PA(2)

Fig. 1. Number of colonies of VaMyb1 gene PCR products in the cDNA from V2 cell culture of Vitis amurensis with added phenylalanine (PA). The data were obtained by analyzing the frequency of occurrence of clones [23]. V2-C— normal V2 cells, V2-PA(0.1), V2-PA(0.5), and V2-PA(2) — V2 cells treated with PA in the concentrations of 0.1 mM, 0.5 mM, and 2 mM, respectively. Data were obtained from three independent experiments and presented as a mean value ± S.E.

we analyzed the frequency of occurrence of individual transcripts of R2R3-MYB transcription factors in cDNA preparations from V. amurensis cell culture, obtained from V2 cell culture under normal conditions and after adding phenylalanine (PA), the precursor of resveratrol biosynthesis, to the culturing medium. Degenerate primers flanked the area of 305 bp and were selected on the basis of gene nucleotide sequences of R2R3-MYB transcription factors from A. thaliana and grape V. vinifera. Based on the data on partial nucleotide sequences of R2R3-MYB genes obtained using degenerate primers, we were able to describe four transcripts of R2R3-MYB transcription factors in the grape V. amurensis: VaMyb1, VaMyb2, VaMyb3, and VaMyb4. The frequency of occurrence of cloned PCR products derived from cDNA preparations of V. amurensis cells that were grown under normal conditions and on the nutrient medium supplemented with PA was analyzed; it was shown that more than 60% of the analyzed transcripts corresponded to the nucleotide sequence of VaMyb1. It had been shown that PA added to the nutrient media at concentrations of 0.1 mM, 0.5 mM, and 2 mM leads to a significantly increased production of resveratrol in the cells of V. amurensis [24]. Based on data obtained using

Sequencing the complete protein-coding cDNA sequence of VaMyb1 transcript could assign this transcript to the representatives of R2R3-MYB family due to the presence of conserved N-terminal DNA-binding domain, which is typical for the representatives of this group (Fig. 2). Based on the identified amino acid sequence, we were able to determine that this transcription factor consists of 253 amino acid residues and includes two “SG2"-motives (IDxSFW-MxFWFD), typical for transcription factors regulating the processes of biosynthesis of plant phenolic compounds in response to pathogenic infections [25]. The presence of conservative "SG2"-motives (from SubGroup 2) indicates the membership in the widespread group of R2R3-Myb transcription factors, which includes R2R3-Myb DcMyb1 transcription factor from carrots, involved in the regulation of key steps in the biosynthesis of phenolic compounds in response to UV light [26]. After determining the full-length proteincoding cDNA sequence of VaMyb1 gene, it was deposited in the GenBank database (KM196537). Phenotype of VTF1-1 and VTF1-2 Transgenic Cell Lines of Amur Grape Cell lines VTF1-1 and VTF1-2, having a high expression level of VaMyb1 gene, represent a wellgrowing, green-yellow callus without any signs of differentiation on tissues and organs. A ninefold increase in raw biomass was marked after 35 days of subculturing. Differentiated structures did not appear in either cell lines at selected ratio of auxins and cytokinins in the nutrient medium and temperature and illumination used for culturing.

1 a.a.

85 a.a.

86 a.a.

170 a.a.

171 a.a.

253 a.a.

Fig. 2. Identified amino acid sequence of VaMyb1. The figure shows schematically R2R3 DNA-binding domain (in a box) and “SG2"-motives (in italics). Explanations are in the text. RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 64

No. 1

2017

INFLUENCE OF INCREASED EXPRESSION OF VaMyb1 TRANSCRIPTION FACTOR

(а) NC

М

bp 1000

500

1

2

(b) NC

(а)

3 PC

Expression of endogenous VaMyb1, rel. units

2

2

1

0 PC

М

bp 3000 1000 500

Fig. 3. Electrophoregrams after RT-PCR of nptII (a) and virB2 (b) products. Tracks 1 and 2 correspond to the cDNA preparations derived from VTF1-1 and VTF1-2 cells, respectively. NC—negative control (PCR mixture with no matrix added); PC—positive control (PCR mixture with cloned (a) nptII and (b) virB2 genes; M—synthetic molecular weight marker.

Expression of VaMyb1 Gene in VTF1-1 and VTF1-2 Cell Lines To prove the successful transfer of VaMyb1 transgene, we carried out PCR analysis on the presence of the transcripts of nptII selective gene marker in both cDNA preparations from VTF1-1 and VTF1-2 cell lines (Fig. 3a). According to the design, oligonucleotide primers flanked the 400 bp region of nptII gene, which corresponded to derived fragments (Fig. 3a). We have proved also the absence of Agrobacterium contamination by PCR with primers specific to the sequence of virB2 agrobacterial gene (Fig. 3b). According to the design, oligonucleotide primers flanked the 366 bp region, which corresponded to a fragment obtained in the positive control sample, wherein the electrophoretogram indicates the absence of the amplification in the samples containing cDNA from VTF1-1 and VTF1-2 cell lines (Fig. 3b). The endogenous expression of VaMyb1 was analyzed with real-time PCR using cDNA preparations from both transgenic lines and the control cell line V2. Cell lines VTF1-1 and VTF1-2 were obtained with an independent transformation; using two different vector systems, we did not observe any statistically significant changes in the expression of the endogenous VaMyb1 sequence in any of obtained cell lines compared with V2 control cell line (Fig. 4a). The lack of statistically significant changes in the expression level RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 64

V2

VTF1-1

VTF1-2

(b) **

10 Expression of transgenic VaMyb1, rel. units

1

45

8

**

6 4 2 0

V2

VTF1-1

VTF1-2

Fig. 4. Expression of endogenous (a) and transgenic (b) sequences of VaMyb1 in VTF1-1 and VTF1-2 cells measured by real-time PCR. Data were obtained from three independent experiments and presented as a mean value ± S.E. ** P < 0.01.

of endogenous VaMyb1 sequence eliminates incorrect interpretation of data due to the reasons of epigenetic nature. Expression analysis of transgenic VaMyb1 sequence in cDNA preparations from VTF1-2 and VTF1-1 calli showed an increase of this parameter by 8.5 and 6 times, respectively, compared with V2 cells, indicating the success of transformation (Fig. 4b). Effect of Increased Expression of VaMyb1 on Resveratrol Content and Expression of VaSTS Genes in the Cells of V. amurensis The HPLC found the presence of resveratrol in VTF1-1 and VTF1-2 cells, expressing increased level of VaMyb1 gene. According to the data, cell lines VTF1-1 and VTF1-2 contained 0.005 ± 0.003 and 0.007 ± 0.005% of resveratrol from dry cell biomass, respectively. The original V2 culture contains 0.02 ± 0.01% of resveratrol from dry cell biomass, which was 4 and 2.9 times higher than its content in VTF1-1 and VTF1-2 cells, respectively. Moreover, decreased content of resveratrol in VTF1-1 line was statistically significant (P = 0.043). Being a quite convenient model system for studying the regulation of the biosynthesis of secondary metabNo. 1

2017

46

TYUNIN, KISELEV

Expression of VaSTS genes defined by the real-time PCR in the cell lines of V. amurensis V2

VTF1-1

VTF1-2

VaSTS1

0.225 ± 0.074

0.210 ± 0.070

0.535 ± 0.151

VaSTS2

0.155 ± 0.092

0.121 ± 0.098

0.230 ± 0.089

VaSTS3

0.046 ± 0.029 0.063 ± 0.039

0.153 ± 0.098

VaSTS4

0.082 ± 0.030

0.051 ± 0.031

0.196 ± 0.086

VaSTS5

0.017 ± 0.010

0.115 ± 0.099 0.092 ± 0.040

VaSTS6

0.061 ± 0.022 0.043 ± 0.011

VaSTS7

0.134 ± 0.101

0.053 ± 0.040 0.045 ± 0.039

VaSTS8

0.160 ± 0.122

0.090 ± 0.056 0.093 ± 0.042

VaSTS9

0.109 ± 0.083

0.122 ± 0.085

0.183 ± 0.087

VaSTS10 0.220 ± 0.127

0.157 ± 0.057

0.175 ± 0.043

0.030 ± 0.012

V2 is unmodified cell culture of V. amurensis. VTF1-1 and VTF12 are transgenic cell lines of V. amurensis, expressing increased levels of VaMyb1 gene. Data were obtained from three independent experiments and presented as a mean value ± S.E.

olites, cell culture of V. amurensis has a high potential for using it as a source of resveratrol. Intensive studies on the regulation of resveratrol biosynthesis in the cells of V. amurensis revealed the important role of calcium signaling system in this process [27]. A key process in the biosynthesis of resveratrol is the induction of the transcription of key biosynthetic genes—STS genes. It was found that cytosine DNA methylation is an epigenetic factor that plays an important role in the regulation of expression of VaSTS genes in the cells of V. amurensis [28–30]. Expression analysis of VaSTS gene family by real-time PCR showed no significant changes in the expression levels of VaSTS genes in cDNA preparations from VTF1-1 and VTF1-2 cell lines compared with the original V2 culture (table). Thus, the data indicate the negative role of VaMyb1 transcription factor in the regulation of resveratrol biosynthesis. Following this conclusion, it is important to note that a further search for a targeted inhibition of VaMyb1 gene expression in the cells of V. amurensis is not only an important qualitative check of the data but it is also likely to lead to the creation of a resveratrol superproducing cell culture. ACKNOWLEDGMENTS We thank Valeria Petrovna Grigorchuk, the Senior Engineer of the Laboratory of Biotechnology of the Federal State Institution of Science Institute of Biology and Soil Science, Far Eastern Branch, Russian Academy of Sciences, for conducting HPLC analyses. This work was supported by the Russian Science Foundation, project no. 14-14-00366.

REFERENCES 1. Frankel, E.N. and Waterhouse, A.L., Inhibition of human LDL oxidation by resveratrol, Lancet, 1993, vol. 341, pp. 1103–1104. 2. Bradamante, S., Barenghi, L., and Villa, A., Cardiovascular protective effects of resveratrol, Cardiovasc. Drug Rev., 2004, vol. 22, pp. 169–188. 3. Aggarwal, B., Bhardwaj, A., Aggarwal, R., Seeram, N., Shishodia, S., and Takada, Y., Role of resveratrol in prevention and therapy of cancer: preclinical and clinical studies, Anticancer Res., 2004, vol. 24, pp. 2783– 2840. 4. Kundu, J.K. and Surh, Y.J., Cancer chemopreventive and therapeutic potential of resveratrol: mechanistic perspectives, Cancer Lett., 2008, vol. 269, pp. 243–261. 5. Austin, M.B., Bowman, M.E., Ferrer, J.L., Schröder, J., and Noel, J.P., An aldol switch discovered in stilbene synthases mediates cyclization specificity of type III polyketide synthases, Chem. Biol., 2004, vol. 11, pp. 1179–1194. 6. Schröder, G., Brown, J.W., and Schröder, J., Molecular analysis of resveratrol synthase cDNA, genomic clones and relationship with chalcone synthase, Eur. J. Biochem./FEBS, 1988, vol. 172, pp. 161–169. 7. Preisig-Müller, R., Schwekendiek, A., Brehm, I., Reif, H.J., and Kindl, H., Characterization of a pine multigene family containing elicitor-responsive stilbene synthase genes, Plant Mol. Biol., 1999, vol. 39, pp. 221–229. 8. Parage, C., Tavares, R., Rety, S., Baltenweck-Guyot, R., Poutaraud, A., Renault, L., Heintz, D., Lugan, R., Marais, G.A.B., Aubourg, S., and Hugueney, P., Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine, Plant Physiol., 2012, vol. 160, pp. 1407–1419. 9. Guerrero, R.F., Puertas, B., Fernandez, M.I., Palma, M., and Cantos-Villar, E., Induction of stilbenes in grapes by UV-C: comparison of different subspecies of Vitis, Innov. Food Sci. Emerg. Technol., 2010, vol. 11, pp. 231–238. 10. Deluc, L.G., Decendit, A., Papastamoulis, Y., Mérillon, J.M., Cushman, J.C., and Cramer, G.R., Water deficit increases stilbene metabolism in Cabernet Sauvignon berries, J. Agric. Food Chem., 2011, vol. 59, pp. 289–297. 11. Yang, M.H., Kuo, C.H., Hsieh, W.C., and Ku, K.L., Investigation of microbial elicitation of trans-resveratrol and trans-piceatannol in peanut callus led to the application of chitin as a potential elicitor, J. Agric. Food Chem., 2010, vol. 58, pp. 9537–9541. 12. Czemmel, S., Heppel, S.C., and Bogs, J., R2R3 MYB transcription factors: key regulators of the flavonoid biosynthetic pathway in grapevine, Protoplasma, 2012, vol. 249, pp. 109–118. 13. Ramsay, N. and Glover, B., MYB-bHLH-WD40 protein complex and the evolution of cellular diversity, Trends Plant Sci., 2005, vol. 10, pp. 63–70. 14. Agarwal, M., Hao, Y., Kapoor, A., Dong, C.H., Fujii, H., Zheng, X., and Zhu, J.K., A R2R3 type MYB transcription factor is involved in the cold regulation of CBF genes and in acquired freezing tolerance, J. Biol. Chem., 2006, vol. 281, pp. 37 636–37 645.

RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 64

No. 1

2017

INFLUENCE OF INCREASED EXPRESSION OF VaMyb1 TRANSCRIPTION FACTOR 15. Abe, H., Yamaguchi-Shinozaki, K., Urao, T., Iwasaki, T., Hosokawa, D., and Shinozaki, K., Role of Arabidopsis MYC and MYB homologs in drought and abscisic acidregulated gene expression, Plant Cell, 1997, vol. 9, pp. 1859–1868. 16. Lee, M.W., Qi, M., and Yang, Y., A novel jasmonic acid-inducible rice myb gene associates with fungal infection and host cell death, Mol. Plant–Microbe Interact., 2001, vol. 14, pp. 527–535. 17. Xin, H., Zhu, W., Wang, L., Xiang, Y., Fang, L., Li, J., Sun, X., Wang, N., Londo, J.P., and Li, S., Genomewide transcriptional profile analysis of Vitis amurensis and Vitis vinifera in response to cold stress, PLoS ONE, 2013, vol. 8, p. e58740. 18. Aleynova, O.A., Grigorchuk, V.P., Dubrovina, A.S., Rybin, V.G., and Kiselev, K.V., Stilbene accumulation in cell cultures of Vitis amurensis Rupr. overexpressing VaSTS1, VaSTS2, and VaSTS7 genes, Plant Cell Tissue Organ Cult., 2016. doi 10.1007/s11240-016-0954-0 19. Kiselev, K.V., Dubrovina, A.S., and Bulgakov, V.P., Phenylalanine ammonia-lyase and stilbene synthase gene expression in rolB transgenic cell cultures of Vitis amurensis, Appl. Microbiol. Biotechnol., 2009, vol. 82, pp. 647–655. 20. Bekesiova, I., Nap, J.P., and Mlynarova, L., Isolation of high quality DNA and RNA from leaves of the carnivorous plant Drosera rotundifolia, Plant Mol. Biol. Rep., 1999, vol. 17, pp. 269–277. 21. Kiselev, K.V. and Dubrovina, A.S., A new method for analyzing gene expression based on frequency analysis of RT-PCR products obtained with degenerate primers, Acta Physiol. Plant., 2010, vol. 32, pp. 495–502. 22. Tzfira, T., Tian, G.W., Lacroix, B., Vyas, S., Li, J.X., Leitner-Dagan, Y., Krichevsky, A., Taylor, T., Vainstein, A., and Citovsky, V., pSAT vectors: a modular series of plasmids for autofluorescent protein tagging and expression of multiple genes in plants, Plant Mol. Biol., 2005, vol. 57, pp. 503–516. 23. Livak, K.J. and Schmittgen, T.D., Analysis of relative gene expression data using real-time quantitative PCR

RUSSIAN JOURNAL OF PLANT PHYSIOLOGY

Vol. 64

24.

25.

26.

27.

28.

29.

30.

47

and the 2(-Delta Delta C(T)) method, Methods, 2001, vol. 25, pp. 402–408. Kiselev, K.V., Shumakova, O.A., and Manyakhin, A.Yu., Effect of plant stilbene precursors on the biosynthesis of resveratrol in Vitis amurensis Rupr. cell cultures, Appl. Biochem. Microbiol., 2013, vol. 49, pp. 53–58. Chezem, W.R. and Clay, N.K., Regulators and pathway enzymes that contribute to chemical diversity in phenylpropanoid and aromatic alkaloid metabolism in plant immunity, The Formation, Structure and Activity of Phytochemicals, Jetter, R., Ed., Heidelberg: SpringerVerlag, 2015, pp. 137–162. Maeda, K., Kimura, S., Demura, T., Takeda, J., and Ozeki, Y., DcMYB1 acts as a transcriptional activator of the carrot phenylalanine ammonia-lyase gene (DcPAL1) in response to elicitor treatment, UV-B irradiation and the dilution effect, Plant Mol. Biol., 2005, vol. 59, pp. 739–752. Kiselev, K.V., Shumakova, O.A., Manyakhin, A.Y., and Mazeika, A.N., Influence of calcium influx induced by the calcium ionophore, A23187, on resveratrol content and the expression of CDPK and STS genes in the cell cultures of Vitis amurensis, Plant Growth Regul., 2012, vol. 68, pp. 371–381. Tyunin, A.P., Kiselev, K.V., and Karetin, Y.A., Differences in the methylation patterns of the VaSTS1 and VaSTS10 genes of Vitis amurensis Rupr., Biotechnol. Lett., 2013, vol. 35, pp. 1525–1532. Kiselev, K.V., Tyunin, A.P., and Karetin, Y.A., Salicylic acid induces alterations in the methylation pattern of the VaSTS1, VaSTS2, and VaSTS10 genes in Vitis amurensis Rupr. cell cultures, Plant Cell Rep., 2014, vol. 34, pp. 311–320. Tyunin, A.P. and Kiselev, K.V., Alternations in VaSTS gene cytosine methylation and t-resveratrol production in response to UV-C irradiation in Vitis amurensis Rupr. cells, Plant Cell Tissue Organ Cult., 2015, vol. 124, pp. 33–45.

Translated by M. Shulskaya

No. 1

2017