World J Microbiol Biotechnol (2011) 27:2203–2215 DOI 10.1007/s11274-011-0686-6

ORIGINAL PAPER

Isolation and characterization of a new Burkholderia pyrrocinia strain JK-SH007 as a potential biocontrol agent Jia Hong Ren • Jian Ren Ye • Hui Liu Xu Ling Xu • Xiao Qin Wu

•

Received: 13 September 2010 / Accepted: 1 February 2011 / Published online: 18 February 2011 Ó Springer Science+Business Media B.V. 2011

Abstract Poplar canker is a kind of serious disease of poplar branches in China and all over the world. In China, the poplar canker is mainly caused by three pathogens of Cytospora chrysosperma, Phomopsis macrospora and Fusicoccum aesculi, which is hard to control. A collection of 1,013 bacterial isolates obtained from the poplar stems in 9 regions of China. Of all the strains tested, 13 bacterial isolates inhibiting three pathogens (C. chrysosperma, P. macrospora and F. aesculi) growth were selected, whose inhibition zone width were more than 15 mm. Strain JKSH007 exhibited the most obvious antagonistic activity. Besides, this strain also produced extracellular hydrolytic enzymes (b-1, 3-glucanases, proteases and chitinases). This bacterium had no pathogenicity and was identified as Burkholderia cepacia complex (Bcc) genomovar IX: B. pyrrocinia by the Biolog identification system combined with 16S rDNA and recA gene sequence analysis and morphological, physiological and biochemical methods characteristics. B. pyrrocinia JK-SH007 exhibited the highest biocontrol and colonization capabilities. After 3 months, plant height and ground diameter in poplar seedlings inoculated with JK-SH007 were significantly (P \ 0.05) higher than in control (non-inoculated) plants. The selected B. cepacia isolate colonized poplar stems and leaves endophytically, promoting plant growth and suppressing pathogenic activities of C. chrysosperma, P. macrospora and F. aesculi on seedling of poplar. This is J. H. Ren  J. R. Ye (&)  H. Liu  X. L. Xu  X. Q. Wu College of Forest Resources and Environment, Nanjing forestry University, 210037 Nanjing, Jiangsu, China e-mail: [email protected] J. H. Ren The department of Biology Science and Technology, Changzhi College, 046011 Changzhi, Shanxi, China

one of the few reports dealing with isolation and characterization of B. cepacia strains with biocontrol activity against the poplar canker. The endophytic isolate also has the potential to perform as plant growth promoter. Keywords Poplar canker  Antagonistic bacteria  Identification  Isolation  Burkholderia pyrrocinia

Introduction Species and hybrids of Populus are being grown throughout many regions of the world for purposes including the production of fiber and energy, ornamental landscape plantings, and soil stabilization. To date, poplar plantation has exceeded seven million hectares in China. Unfortunately, poplar canker is a serious stem disease in the Populus genus, which has had a significant impact on the health and productivity of the Populus species in China (Huang and Su 2003). In 2003 and 2004, due to poplar canker occurred, poplar afforestation survival rates of many of seedlings were lower than 30% and even the poplar seedling death rate of some planting sites were 100% in north of Jiangsu province (Wang and Wu 2008). A complex of pathogens including fungi and bacteria are associated with poplar canker (Wang and Wu 2008; Zeng et al. 1999; Yang et al. 1999). vIn China, the poplar canker is mainly caused by three pathogens of Cytospora chrysosperma, Phomopsis macrospora and Fusicoccum aesculi (Wang and Wu 2008). Some of synthetic fungicides are often used in controlling poplar canker. So far, no effective control method has been developed for this poplar disease. Moreover, increasing use of chemical pesticides causes several negative effects on the environment as well as on human health (Gerhardson 2002).

123

2204

Also, environmental concerns and development of resistance in target populations have reduced the availability of effective fungicides. Consequently, there has been increased restriction on a variety of chemical fungicides. Many studies have reported on natural activity of some fungi and bacteria against fungal pathogens, and this is considered as a very appealing alternative to the use of chemical fungicides (Gerhardson 2002; Welbaum et al. 2004). Several species of bacteria are known to have beneficial effect on plant growth and disease suppression through the production of plant growth–promoting regulators and antibiotic substances. Organisms such as Burkholderia cepacia have shown effective ability in suppressing many plant diseases and promoting plant growth (Govindarajan et al. 2008; Chiarini et al. 2006; Bevivino et al. 2000; Sijam and Dikin 2005), however, there have been no reports on controlling poplar canker caused by three pathogens of C. chrysosperma, P. macrospora and F. aesculi. B. cepacia is a gram-negative bacterium widely distributed in agricultural and clinical environment. Recently, B. cepacia has been classified into ten genotypically distinct but phenotypically similar species (genomovars) referring to the B. cepacia complex (Bcc) (Payne et al. 2005; Vandamme et al. 2003; Coenye et al. 2001a, b, c; Mahenthiralingam et al. 2000; Vandamme et al. 1997). Strains of Bcc have been used in biological control of plant diseases and bioremediation (Chiarini et al. 2006; Quan et al. 2006; Parke and Gurian-Sherman 2001; Thomas 2008; Caraher et al. 2008), while some strains are plant pathogens or opportunistic pathogens of humans with cystic fibrosis. Bacteria have been known to exist within plant tissue for more than 50 years (Tervet and Hollis 1948; Hollis 1951). Endophytic bacteria may act as plant growth promoters (Ho¨flich et al. 1994) by fixing atmospheric nitrogen (Davison 1988), sequestering iron from the soil (Kloepper et al. 1986) and synthesizing phytohormones and enzymes (Lambert and Joos 1989). They have also been shown strong anti-fungal activity (Brooks et al. 1994; Hinton and Bacon 1995; Mukhopadhyay et al. 1997), antagonise bacterial pathogens (Buren et al. 1993) and control plant parasitic nematodes (Hallmann et al. 1995). In this article, the isolation and characterization of a nonpathogenic strain JK-SH007 was reported which showed inhibition activity to three pathogens that resulted in poplar canker. The potential antagonistic activity against three pathogens was discussed and the spectrum, endophytic colonization, biochemical characteristics, and the risk assessment related to biologic control were also investigated. For a better characterization of the antagonistic isolate, its potential production of hydrolytic enzymes was studied. JK-SH007 was identified as B. pyrrocinia, genomovar IX of B. cepacia complex (Bcc) and showed safety to plant, mammal by test and high

123

World J Microbiol Biotechnol (2011) 27:2203–2215

effectivity in suppressing three pathogens causing poplar canker. Moreover, this strain played significant functions in promoting growth on seedling of poplar. So, JK-SH007 had high potential to develop a biological control agent. This work will provide important clues for development of agricultural biofungicides.

Materials and methods Fungal strains Three highly aggressive isolates of C. chrysosperma, P. macrospore and F. aesculi were isolated from naturally infected poplar stem and maintained on potato dextrose agar (PDA) slants at 4°C in laboratory (Wang and Wu 2008). Pestalotiopsis vesicolor and Guignardia camelliae were collected by Forest Pathology laboratory of Nanjing Forestry University. Magnaporth grisea, Gibberella zeae, Phytophthora capsici, Pythium aphandeirmatum, Phytophthora sojae, Botryosphaeria berengeriana f. sp. piricola, Rhizoctonia solani, Sclerotinia sclerotiorum and Fusarium oxysporium were kindly provided by Daolong Dou (Department of Plant Pathology, Nanjing Agriculture University, Nanjing, China). Bacterial isolation and screening For bacterial isolation, samples were processed according to protocols described previously by Parka et al. (2005) with minor modification. The stems and branches of poplar were collected from 9 regions of China. The samples were placed in sterile plastic bags and stored at 4°C before isolation. 5 g samples were cut into 0.5 mm bars with a sterile knife blade, which were placed in a 250-ml flask with 45-ml sterile distilled water and shaken at 30°C with shaking (150 rpm) for 30 min. 1-ml bacterial suspension from the flask after standing 10 min was put into a tube with 9-ml sterile water. Serial dilutions were made and 0.1 ml aliquots (102–105) were spread on plates containing NA medium (peptone, 10.0 g; NaCl, 5.0 g; beef extract, 3.0 g; agar, 18.0 g; distilled water, 1,000 ml; pH 7.0). The plates were incubated for 7 days at 30°C and the different morphological colonies appeared on the medium were isolated and sub-cultured for further analysis. The isolates were tested for their ability to inhibit the growth of three pathogens caused poplar canker using the in vitro dual-culture analysis (Romero et al. 2004). Each isolated colony was transferred to a potato dextrose agar (PDA) plate on which placed 5-mm mycelial plug of C. chrysosperma, P. macrospore and F. aesculi, respectively. Bacteria were situated approximately 3.5 cm from the plug. After incubation at 28°C for

World J Microbiol Biotechnol (2011) 27:2203–2215

3–5 days, the most effective strains inhibited the fungal growth were selected. Spectrum of antimicrobial activity The antagonistic ability of JK-SH007 and JK-SX001 strains were checked against 11 phytopathogenic fungi by using confront culture each other (Romero et al. 2004). Enzyme activity assays Chitinase and protease activity of JK-SH007 was determined according to Tahtamouni et al. (2006). Cellulases activity of JK-SH007 was detected using the previous method (Essghaier et al. 2009). Glucanases activity was assayed according to the method described by Teather and Wood (1982) with minor modifications. JK-SH007 was tested for b-1,3-glucanases activity on a solid synthetic medium (glucan, 10.0 g; yeast extract, 1.0 g; MgSO4, 1.0 g; CaCl2, 0.01 g; agar, 15.0 g; distilled water, 1,000 ml; pH 7.0). After incubation at 30°C for 7 days, the plates were flooded, respectively with Congo-red (1 mg ml-1) for 15 min and NaCl 1 mol l-1 for 15 min. Cellulolytic and glucanases activity was taken as evidence by appearance of clear zone around the colonies. Test for pathogenicity Pathogenicity test of B. pyrrocinia JK-SH007 was evaluated by two tests: a bioassay with onion bulbs inoculated with JK-SH007 and an inoculation test of wounded alfalfa (Sijam and Dikin 2005; Bernier et al. 2003). Pathogenicity test on onion was designed using the method described by Sijam and Dikin (2005). At the same time, bulbs were injected with sterilized water as negative control and with reference strain LMG1222 as positive control. B. cepacia LMG1222 was acquired from BCCM/ LMG Bacteria Collection at the Ghent University, Belgium. Inoculated bulbs were incubated at 26 ± 2°C for 4 days before observation of rotting symptoms. Pathogenicity test on alfalfa was designed using the method described by Bernier et al. (2003). Disease symptoms including yellow leaves, stunted roots, and brown necrotic regions were recorded 6–7 days after inoculation. JK-SH007 impact on germination and seedling size To determine the influence of JK-SH007, a greenhouse trial was established with Populus deltoids producing from seeds and inoculated with bacteria. P. deltoids seeds were surface sterilized by soaking in 0.1% KMnO4 for 30 min, and rinsed thoroughly in six changes of sterile distilled water. They were then soaked in bacterial inocula (109 cfu ml-1) of

2205

JK-SH007 at 25°C for 3 h and a sterile distilled water control. Then these seeds were rinsed in sterile cool water and planted in a sterile soil in plastic pots (100 seeds per pot). The plants were arranged in the growth room in randomized complete blocks. Experimental blocks were rotated about the growth room bench to minimize any environmental effects. After 1 week, the germination rate of seeds was compared between plants inoculated with JK-SH007 and untreated samples. Numbers of germinated seeds in each pot were recorded. Then some seedlings were removed and the number of final seedling was 4 plants per pot. Three months after planting, plant height (length of the longest leaf-bearing stem), ground diameter, net photosynthetic rate, the transpiration rate and stomatal conductance were measured. Five top flag leaves of plants were analyzed nondestructively for net photosynthetic rates using a portable photosynthesis system LI-COR6400 (LICOR Biosciences) according to the manufacturer’s instructions. Simultaneously, the stomatal conductance and transpiration velocity within the flag leaves were recorded using the same instrument. Detection of the virulence genes with BCESM and cblA PCR-based detection of the B. cepacia epidemic strain marker (BCESM) and cable pili subunit gene (cblA) was carried out as previously described (Mahenthiralingam et al. 1997; Sajjan et al. 1995a, b; Richardson et al. 2001). The presence of BCESM and cblA were detected by PCRs with primers of BCESM1 (5-CCACGGACGTGACTAA CA-3), BCESM2 (5-CGTCCATCCGAACACGAT-3), cblA1 (5-CCAAAGGACTAACCCA-3) and cblA2 (5- ACGCGA TGTCCATCACA -3), respectively. All PCRs were performed with lysate cell suspensions and 0.5 U of taq DNA polymerase (polymed). Bcc strain isolates NF12 isolated from CF was used as positive controls. Endophytic bacterial isolation and field emission scanning electron microscopy (FESEM) The ability of JK-SH007 to endophytically colonize plants was performed with rifampin-resistant mutant. Spontaneous chromosomal rifampin resistant (rifr) mutant of JK-SH007 was generated on nutrient agar containing 300 lg ml-1 of rifampin (Sigma Chemical Co.). The rifampin-resistant mutant of JK-SH007 was obtained according to the method described by Bacon and Hinton (2002). The poplar seedling assay was used as the test for endophytic colonization by JKSH007. Populus deltoids seeds were surface sterilized by soaking in 0.1% KMnO4 for 30 min, and rinsed thoroughly in six changes of sterile distilled water. They were then soaked in bacterial inocula (109 cfu ml-1) at 25°C for 3 h, which were prepared from the rifr mutants, and rinsed in sterile cool water. These seeds were planted in a sterile soil

123

2206

in plastic pots (4 seeds per pot). Un-inoculated seeds were used as controls and planted as described for the treatment groups. Companion treatment groups consisting of non-rifr mutants were also used in both preliminary experiments and in the rifr mutant recovery experiments to confirm that the mutation did not alter the endophytic effects of the parental strains. One month after planting, the plant material used for recovery of bacteria consisted of shoots and leaves that were surfaced-disinfested with commercial bleach, full strength (5.25% sodium hypochlorite) for 5 min (Stone et al. 2000). The recovery of bacteria was carried out as previously described (Stone et al. 2000) with nutrient agar containing 300 lg ml-1 of rifampin. Petri plates were incubated at 30°C for 3–5 days at which time the number of colonyforming units (cfu) was counted. Numbers of bacteria cells recovered were expressed as cfu g-1 fresh tissue weight. For scanning electron microsconic (SEM) studies, the samples were treated according to Puente et al. (2009) with minor modification. Seeds of P. deltoids were soaked in 0.1% KMnO4 for 30 min, and rinsed thoroughly in six changes of sterile distilled water. Then, floating seeds were discarded. The remaining seeds were surface sterilized with 70% ethanol for 3 min, and then soaked in 0.1% aqueous HgCl2 (W/V) for 1 min followed by six rinses with sterile water. Finally, the seeds were transferred to test tubes (25 9 250 mm) containing 20 ml 1/2 MS medium (Murashige and Skoog 1962) for germination. These seedling explants were transferred once a month. After a serials of transfer culture (about 4 times), plantlets were the inoculated materials. Then, 5 ml bacterial suspensions (105 cfu ml-1) of JK-SH007 were slowly injected onto the root surface of poplar plantlets. After 7 days of co-cultivation, the plantlets were uprooted and washed with 70% ethanol for 3 min followed by six rinses with sterile water. The roots, stems and leaves of the poplar plantlets, 0.5–1.5 cm long, were fixed in 4% glutaraldehyde in 0.1 M PBS buffer (pH7.2) for 12 h. All samples were rinsed with the same buffer, dehydrated in an ethanol series, critical point dried (EMITECH K850), sliced with a sterile razor in half, mounted on specimen holders and coated with goldpalladium (HITACH E-1010). The samples were then examined using a FEI QUANTA 200 scanning electron microscope. Greenhouse control of poplar stem canker by antagonistic bacteria One year-old poplar cutting seedlings (Populus 9 euramericana cv. ‘NL 895’) were used for control of stem canker by antagonistic bacteria JK-SH007. NL 895 is one of fast growing species and sensitive to the pathogens of canker. Seedlings were inoculated with three pathogens using the previous method (Wang and Wu 2008). Scalds

123

World J Microbiol Biotechnol (2011) 27:2203–2215

were carried out on the surface of trunk between 100 cm and 150 cm out the ground. Seedlings were then wounded up to xylem with a sterile knife blade at the scalded site. 5-mm mycelial plugs of C. chrysosperma, P. macrospore and F. aesculi were inverted into these wounds, respectively. The wounds and agar plugs were covered with Parafilm to prevent desiccation of the inoculums and wounds. JK-SH007 was cultured for 36 h at 30°C in beef extract liquid medium (beef extract, 2 g; peptone, 20.0 g; NaCl, 5.0 g; distilled water, 1,000 ml; pH 7.0). Then the bacteria suspension (109 cfu ml-1) was sprayed onto the surface of poplar roots (50 ml per plant). The seedlings that were un-inoculated with JK-SH007 were used as controls. After 4 weeks, the disease severity was recorded on a 0–4 scale. The 0–4 scale of the disease severity was classified as follows: 0— No infection 1— Slight infection with one to three black blotches or blisters on the trunk. 2— Four to nine black blotches or blisters on the trunk. 3— Ten to twelve black blotches or blisters on the trunk. 4— Complete infection with more than thirteen black blotches or blisters on the trunk. Disease index (Di) and control effects (Ce) for pathogen are computed by the following equation: hX Di ¼ ðScale  Number of plants infectedÞ= i ðHighest scale  Total number of plantsÞ  100  Ce ð%Þ ¼ ðDi of the control  Di of the treatment  with JK  SH007Þ=ðDi of the controlÞ  100 Biochemical and physiologic characterization Preliminary identification of the bacterial strain JK-SH007 was based on the morphological, physiological and chemical analysis including colony and cell morphology, motility, spore production, pigmentation, Gram staining, catalase reaction, oxidase reaction, indole test, methylene red test (M.R. test), V-P test, gelatin liquefaction, citrate utilization, H2S production, litmus milk test, urease activity test and lipase activity test using a JK-SH007 colony from LB agar (Holt et al. 1994). The morphology of the cultured bacterial strain was also observed by electron microscopy. All tests were repeated at least twice for each isolate to assess the reliability of the test results. Other biochemical and physiologic characteristics of JK-SH007 were obtained using Biolog Identification System (Biolog, Hayward, CA). The bacterial isolate of JK-SH007 was sent to China Center for Type Culture Collection (CCTCC, China) for identification and confirmation of the specific epithet of the Bcc species.

World J Microbiol Biotechnol (2011) 27:2203–2215

2207

16S rDNA gene sequencing Genomic DNA of JK-SH007 was extracted and purified according to the method described by Sambrook et al. (2001). 16S rDNA was amplified with the primers: fd1 (50 -AGAGTTTGATCCTGGCTCAG-30 ) and rP2 (50 -AC GGCTACCTTGTTACGACT-30 ). The PCR amplification was performed as follows: one cycle of 5 min at 94°C, followed by 30 cycles of 30 s each at 94°C, 30 s at 56°C, and 1 min at 72°C, followed by one cycle of 5 min at 72°C (Weisburg et al. 1992). PCR products were purified and sequenced at the Invitrogen Corporation in Shanghai. DNA sequence homology searches were performed using the online BLAST search engine in GenBank (available at: http://www.ncbi.nlm.nih.gov). The phylogenetic tree for the data set was inferred by the neighbor-joining method, MEGA version 4.1. Genomovar identification by genus-specific recA PCR To determine quickly whether the strain JK-SH007 belong to B. cepacia complex, PCR was performed with B. cepacia

complex-specific primers (Table 1): BCR1 and BCR2 as described previously (Mahenthiralingam et al. 2005). To confirm genomovar of strain JK-SH007, the Burkholderia genus-specific recA PCR was used. PCR was performed with Premix Tag (Takara Bio, Otsu, Shiga, Japan), and nine pairs of primers were used (Table 1). The final concentration of each primer in the reaction mixture was 0.5 lM. The temperature programs was as follows: premelting at 94°C for 5 min, followed by 30 cycles of melting at 94°C for 50 s, annealing at different temperature (Table 1) for 40 s, and extension at 72°C for 1 min, followed by 5 min at 72°C. One microgram of the genomonic DNA of strain JK-SH007 was used in total reaction volume of 50 ll. The PCR-products were confirmed by 2% agarose-gel electrophoresis. Nucleotide sequence accession number The nucleotide sequences of the 16S rDNA gene and the recA gene of the JK-SH007 strain have been deposited in GenBank under accession number GQ169784 and GQ169786, respectively.

Table 1 Sequence of primers used in genomovar determination of the B. cepacia complex Species name B.cepacia

Primer number 1

Complex (Bcc) Genomovar I

2

Primer name

The sequence of primers (50 -30 )

PCR-annealing temperature (°C)

Product size (bp)

BCR1a

TGACCGCCGAGAAGAGCAA

58

1,042

BCR2a

CTCTTCTTCGTCCATCGCCTC 62

492

62

714

62

378

60

781

64

647

62

378

BCRG11a

CAGGTCGTCTCCACGGGGT

a

CACGCCGATCTTCATACGA

BCRG21a

CGGCGTCAACGTGCCGGAT

BCRG22a

TCCATCGCCTCGGCTTCGT

BCRG3A1a

GCTCGACGTTCAATATGCC

BCRG3A2a

TCGAGACGCACCGACGAG

BCRG3B1a

GCTGCAAGTCATCGCTGAA

BCRG12 Genomovar II Genomovar III-A Genomovar III-B

3 4 5

BCRG3B2 Genomovar IV Genomovar V

6 7

a

TACGCCATCGGGCATGCT

BCRG41a

ACCGGCGAGCAGGCGCTT

BCRG42a

ACGCCATCGGGCATGGCA

BCRG51a

GGGCGACGGCGACGTGAA

BCRG52a

TCGGCCTTCGGCACCAGT

Genomovar VI

8

BCRG61b BCRG62b

TGACCGCCGAGAAGAGCAA CGAGCGAGCCGGTCGAT

67

135

Genomovar VII

9

BCRG71c

GTCGGGTAAAACCACGCTG

62

810

BCRG72c

ACCGCAGCCGCACCTTCA

BCRG81d

TACGGTCCGGAATCGTCG

61

473

d

CGCACCGACGCATAGAAT

Genomovar VIII

10

BCRG82 a

Genomovar-specific primer designed by Mahenthiralingam et al. (2000)

b

Genomovar-specific primer designed by Vermis et al. (2004)

c

Genomovar-specific primer designed by Coenye et al. (2001a)

d

Genomovar-specific primer designed by Vandamme et al. (2002)

123

2208

World J Microbiol Biotechnol (2011) 27:2203–2215

Results Isolation and screening of antifungal bacteria One thousand and thirteen bacterial strains were isolated from poplar stem collected from 9 regions of China. Of all the strains tested, 13 bacterial isolates inhibiting three pathogens (C. chrysosperma, P. macrospore and F. aesculi) growth were selected, whose inhibition zone width were more than 15 mm, and the most potent bacteria were strain JK-SH007 and JK-SX001 (Table 2). Strain JKSH007 showed significant growth-inhibitory activity against a range of phytopathogenic fungi in vitro. But strain JK-SX001 in this work differed from JK-SH007 regarding their spectrum of antagonism to phytopathogenic fungi (Table 3). The bacterium only showed growthinhibitory activity against four phytopathogenic fungi. But, the strain JK-SH007 exhibited significant growth-inhibitory activity against a range of phytopathogenic fungi such as Magnaporth grisea, Phytophthora sojae, Macrophoma kawatsukai, Pestalotiopsis vesicolor and Guignardia camelliae (Table 3). Therefore, strain JK-SH007 was used for the further studies. Extracellular hydrolytic activities The isolate JK-SH007 was inoculated individually in colloidal chitin agar and skim milk agar plates, later the plates were incubated at 30°C for 4 days and observed for the clear zone around the colonies. This bacterium produced clear zones on colloidal chitin media ranging from 5.0 to 6.3 mm. The results indicated that the isolate has showed

chitinase activity in our study. Moreover, JK-SH007 can produced protesase which formed clearing zone on skim milk agar plates. In addition to, this bacterium tested positive for glucanase. A determination of cellulases revealed no cellulolytic activity. The production of hydrolytic enzymes which degrade fungal cell walls, especially chitinases and b-1,3-glucanases, are among key factors involved in the suppression of pathogenic fungi by biocontrol agents (Ordentlich et al. 1988). The biological control potential of strain JK-SH007 may be correlated with its ability to produce several extracellular antifungal hydrolytic enzymes (chitinase, protease and glucanase). Identification of strain JK-SH007 Strain JK-SH007 was able to grow on NA medium. The colony characteristics were yellowish-green, circular, convex, entire margin and glistening. The cells of JKSH007 were rod-shaped, Gram-negative, motile, single polar flagella and 0.8–1.0 lm wide by 1–2 um long in size, which did not form capsule and spores. When biochemically characterized, the strain of JK-SH007 was testing positive for catalase, oxidase, indole production, citrate utilization and negative for VP, MR, H2S production, litmus milk test and gelatin hydrolysis, respectively. The strain could not utilize starch and showed lipase activity. The phenotypic characterization of the isolate displayed broad similarity to the genus Burkholderia. Strain JK-SH007 was identified as B. pyrrocinia using the Biolog identification system, which was confirmed by 16S rDNA sequence analysis. This procedure in identification was more accurate than traditional method. The 16S

Table 2 Antagonistic function of 13 strains of antagonistic bacteria to C. chrysosperma, P. macrospore and F. aesculi Strains

Inhibition zone width (mm) C. chrysosperma

Sampling region P. macrospore

F. aesculi

JK-SH001

26.23 ± 0.72b

23.42 ± 0.99 cd

15.71 ± 1.04de

Sihong, Jiangsu

JK-SH002

26.51 ± 1.42b

21.09 ± 1.22ef

16.39 ± 2.08cde

Sihong, Jiangsu

JK-SH004

21.22 ± 1.00de

22.13 ± 1.67de

17.93 ± 0.85abcd

Sihong, Jiangsu

JK-SH006

23.49 ± 0.44c

20.65 ± 1.22ef

19.42 ± 1.34a

Sihong, Jiangsu

JK-SH007

29.12 ± 1.36a

25.76 ± 0.90b

18.58 ± 1.39abc

Sihong, Jiangsu

JK-SX001

30.76 ± 0.93a

27.91 ± 1.72a

16.35 ± 0.75cde

Changzhi, Shanxi

JK-SD001

15.46 ± 2.22f

17.38 ± 1.82g

19.11 ± 0.57ab

Dezhou, Shandong

JK-SD002

22.99 ± 0.84cd

23.75 ± 0.96bcd

15.71 ± 1.25de

Dezhou, Shandong

JK-SD003 JK-SD004

22.15 ± 1.05cd 22.06 ± 0.55cd

20.17 ± 0.32ef 19.46 ± 0.98 fg

18.38 ± 0.17abc 17.05 ± 0.77bcde

Dezhou, Shandong Weifang, Shandong

JK-SD005

16.72 ± 1.66f

17.73 ± 0.51g

15.19 ± 0.35e

Dezhou, Shandong

JK-NJ001

19.67 ± 0.50e

24.89 ± 1.07bc

16.39 ± 1.01cde

Nanjing, Jiangsu

JK-NJ002

19.46 ± 1.55e

23.67 ± 0.88bcd

19.21 ± 2.20ab

Nanjing, Jiangsu

Variances between experimental trials were homogeneous and, thus, data were pooled and statistically analysed. Values followed by the same letter in each vertical column are not significantly different (P [ 0.05) according to fisher’s protected LSD

123

0 0

2209

0

rDNA gene sequence of this strain exhibited 99% similarity to that of B. pyrrocinia. Result of a specific PCR also demonstrated that strain JK-SH007 belonged to B. cepacia complex. DNA fragment of the expected size (the specificity was testified by sequencing the PCR product) was amplified for strain JK-SH007 that was investigated with the primer pair BCR1 and BCR2 (Fig. 1). Until now, no clear distinction has been established between ten genomovars of B. cepacia complex, but only rRNA and recA gene-derived primer pairs are available for the identification of B. cepacia genomovarI, B. multivorans (II), B. cenocepacia (III), B. stabilis (IV), B. vietnamiensis(V), B. dolosa (VI), B. anthina (VII), and B. anthina (VIII). No primers are available yet for B. pyrrocinia (IX) and B. ubonensis (X) (Payne et al. 2005; Vandamme et al. 2003; Coenye et al. 2001a, b, c). There was no amplification product obtained when using 9 primer pairs (2–9) (Fig. 1). Therefore, Strain JK-SH007 belonged to B. cepacia genomovar IX, or X. Moreover, the recA gene sequence of this strain exhibited 99% similarity to that of B. pyrrocinia (IX). The phylogenetic tree was showed in Fig. 2. Putative transmissibility marker genes

0

0 0

7.45 ± 1.09 0

The presence of cblA and BCESM, genetic markers classically associated with virulence and the capacity of Bcc species to spread among cystic fibrosis (CF) patients, was investigated by PCR. Strain JK-SH007 did not exhibit the genetic markers cblA and BCESM (Fig. 3).

0 0 0

0

B. cepacia is known to cause bulb rot of onion. Strain JKSH007 was assayed for pathogenicity on onion bulb. After inoculation and incubation at 26 ± 2°C for 4 days, none of disease symptoms, including water-soaked, maceration, and necrosis were observed. Therefore, strain JK-SH007 was determined to be nonpathogenic on onion bulb. To determine whether strain JK-SH007 could cause infections in alfalfa or not, seedlings were inoculated with

0

0

0

Pathogenicity tests

CK

21.67 ± 1.77 20.54 ± 1.77 11.12 ± 1.04 7.52 ± 1.35

12.79 ± 1.35 0 22.67 ± 1.03 0

15.35 ± 0.97 16.42 ± 0.75 17.24 ± 0.39 20.15 ± 1.35

0

JK-SH007 22.27 ± 1.41 11.46 ± 0.42 9.29 ± 0.72

JK-SX001 30.12 ± 1.57 0

F. oxysporium P. capsici G. zeae M. grisea

Inhibition zone width (mm) Strains

Table 3 Antimicrobial activity of JK-SH007 and JK-SX001

P. atum

P. sojae

B. berengeriana R. solani f. sp. piricola

P. vesicolor

G. camelliae

S. sclerotiorum

World J Microbiol Biotechnol (2011) 27:2203–2215

Fig. 1 Result of 2% agarose gel electrophoresis of recA gene PCR product of JK-SH007. Numbers from 1 to 10 are the number of primers used in genomovar determination of the B. cepacia complex

123

2210

World J Microbiol Biotechnol (2011) 27:2203–2215

Fig. 2 Phylogenetic analysis based on recA gene sequence available from NCBI was constructed. Distances and clustering with the neighborjoining method was performed by using the software packages MEGA version 4.0. Bootstrap values based on 1,000 replications are listed as percentages at the branching points

bp

JK-SH007

NF12

JK-SH007

1

2

3

NF12

4

infection model is a useful tool for assessing virulence of strains of the B. cepacia complex and identifying new virulence-associated genes (Steve et al. 2003). Impact of JK-SH007 on germination and seedling development

2000 1000 750 500 250 100

Fig. 3 Result of 2% agarose gel electrophoresis of BCESM and cblA gene PCR product of JK-SH007. Lanes 1–4 contain, respectively PCR-amplified products of BCESM and cblA gene: Lanes 1–2, BCESM gene; lanes 3–4, cblA gene

bacterial cell suspensions (108 cfu -1) and examined for symptoms. The seedlings infected with strain JK-SH007 exhibited no visible symptoms 7 days. A simple alfalfa model was developed as an alternative infection model for virulence studies of the B. cepacia complex. Alfalfa

JK-SH007 did not affect germination of poplar seeds (Table 4). The rate of germination was not significantly different between treated and untreated control plants (JKSH007 98.50%; Control 97.50%, respectively). After 3 months after planting, plant height and ground diameter in plants inoculated with JK-SH007 were significantly (P \ 0.05) higher than in control (non-inoculated) plants (Table 4). Moreover, plants treated with JK-SH007 had an average net photosynthetic rate of 12.10 lmol CO2 m-2 s-1, transpiration rate of 2.97 mmol H2O m-2 s-1 and stomatal conductance of 0.56 mol H2O m-2 s-1, while shoots of untreated plants averaged 9.45 lmol CO2 m-2 s-1, 2.30 mmol H2O m-2 s-1 and 0.38 mol H2O m-2 s-1, respectively (Table 4). Plants inoculated with JK-SH007 increased net photosynthetic rate, stomatal conductance, and transpiration velocity obviously. It indicated that inoculation of poplar could also evoke physiological response, result in the increasing of photosynthetic capacity and resistance to plant disease. So, strain JK-SH007 could be useful for poplar grown.

Table 4 Effects of seed bacterization with B. pyrrocinia JK-SH007 on P. deltoids differing in their growth parameters Treatment

Seed germination (%)

Plant height (cm)

Ground diameter (cm)

Photo (lmol CO2 m-2 s-1)

Trans (mmol H2O m-2 s-1)

Cond (mol H2O m-2 s-1)

JK-SH007

98.50 ± 1.12a

34.40 ± 5.64a

4.27 ± 0.81a

12.10 ± 0.60a

2.97 ± 0.05a

0.56 ± 0.02a

CK

97.50 ± 1.36a

22.15 ± 3.69b

2.69 ± 0.35b

9.45 ± 0.36b

2.30 ± 0.10b

0.38 ± 0.05b

Variances between experimental trials were homogeneous and, thus, data were pooled and statistically analysed. Values followed by the same letter in each vertical column are not significantly different (P [ 0.05) according to fisher’s protected LSD

123

World J Microbiol Biotechnol (2011) 27:2203–2215

2211

Table 5 Endophytic colonization of poplar plant and in vitro assay for inhibition of three pathogens by the rifr mutant strain of JK-SH007 Treatment

Endophytic colonizer

In vitro inhibition(mm)

Stem

C. chrysosperma

Leaf

P. macrospore

F. aesculi

The mutant of JK-SH007

Y

Y

27.59 ± 0.71

25.16 ± 1.65

19.24 ± 0.64

CK

0

0

0

0

0

Y an endophyte Fig. 4 Endophytic bacteria inside poplar plantlet (Arrows indicate endophytic bacteria). a Endophytic bacteria inside the root, b Endophytic bacteria inside the stem, c Endophytic bacteria inside the petiole, d Endophytic bacteria inside the leaf

B

A

5 m

3 m

D

C

5 m

Endophytic colonization of JK-SH007 The rifr mutant strain of JK-SH007 was isolated from the surface-disinfected stems and leaves of poplar seedlings, indicating that this strain was endophytic (Table 5). However, the stems were more heavily colonized by bacteria than were the leaves of seedlings. This distribution was true for the mutants of JK-SH007. Therefore, Strain JK-SH007 has the ability to establish endophytic associations with poplar seedlings. This was corroborated by SEM observations (Fig. 4). Electron microscopy is a powerful tool for identifying and placing endophytic bacteria in plant tissue. The results showed the interior of disinfected poplar plantlets was heavily colonized with JK-SH007. Possible

5 m

transfer of strain JK-SH007 from root to stem, petiole and leaf was observed. This bacterium was found inside of the roots, stems, petioles and leaves of the seedlings (Fig. 4a–d). Control of poplar stem canker by JK-SH007 The strain JK-SH007 had good control effects on poplar canker under greenhouse conditions. The results were shown in Table 6. It showed that JK-SH007 had 90.23, 92.68 and 82.81% control effects against poplar canker that caused by C. chrysosperma, P. macrospore and F. aesculi, respectively. Greenhouse evaluation of JK-SH007 showed that its control effects were equivalent to that inhibited the mycelial growth of three pathogens in vitro. Therefore,

123

2212 Table 6 Effectiveness of strain JK-SH007 in controlling poplar canker pathogens

World J Microbiol Biotechnol (2011) 27:2203–2215

Treatment

Infection rate (%)

JK-SH007 and C. chrysosperma

10

3.56

C. chrysosperma

65

36.42

8

3.12

P. macrospore

57

28.98

JK-SH007 and F. aesculi

13

F. aesculi

60

JK-SH007 and P. macrospore

inoculation of JK-SH007 could significantly reduce the severity and development of disease. JK-SH007 was a potential bio-control agent.

Discussion The isolation of B. cepacia was first described by Burkholder in 1950. Burkholder isolated these bacteria from putrefactive onions (Burkholder 1950; Allan et al. 2003). Once thought to be a single species, B. cepacia is now regarded as a complex of at least ten closely related species. B. cepacia is a bacterial complex nanmed the B. cepacia complex (Bcc) with ten genomic species which have similar phenotypical traits and different genetic ones and are called genomovars (Cardona et al. 2005; Payne et al. 2005; Chiarini et al. 2006). Bcc is constituted by B. cepacia genomovar I (cepacia); B. cepacia genomovar II (multivorans); B. cepacia genomovar III (cenocepacia); B. cepacia genomovar IV (stabilis); B. cepacia genomovar V (vietnamiensis); B. dolosa genomovar VI; B. ambifaria genomovar VII; B. anthina as genomovar VIII; B. pyrrocinia as genomovar IX and B. ubonensis as genomovar X (Mahenthiralingam and Vandamme 2005; Vandamme et al. 2003; Segonds et al. 1999; Yabuuchi et al. 1992). Several Bcc species are considered to be beneficial in the natural environment. Species of Bcc are widespread in nature, particularly in the plant environment. These species are well known for their biological and metabolic properties, which can be exploited for biological control of fungal diseases in plants but also for bioremediation and plant growth promotion (Govan et al. 1996; Holmes et al. 1998; Parke and Gurian-Sherman 2001; Perin et al. 2006). Isolates of Bcc have been shown to antagonize a wide range of important plant pathogens, including Pythium, Rhizoctonia and Fusarium spp. (Li et al. 2002; Bevivino et al. 1998; Hebbar et al. 1998; Parke 1990; Hebbar et al. 1992; Burkhead et al. 1994; Heydari and Misaghi 1998). Production of cell wall degrading enzymes (glucanases, cellulases, proteases, and chitinases) and antifungal secondary metabolites are common mechanisms that bacteria use to inhibit fungal growth (Kim and Chung 2004;

123

Disease index

5 30.83

Control effects (%) 90.23 – 92.68 – 82.81 –

Fridlender et al. 1993; Budi et al. 2000; Dunne et al. 1997; Chang et al. 2007; Minaxi and Saxena 2010; Raaijmakers et al. 2002; Shoda 2000)). In this study, Burkholderia pyrrocinia JK-SH007 was found to produce extracellular enzyme (glucanases, proteases and chitinases). Cellulases activity was negative for strain JK-SH007. The ability to produce glucanases, proteases, and chitinases stipulated its role in biological control. These results are also in agreement with the earlier studies on extracellular enzyme production (Fridlender et al. 1993; McKevitt et al. 1989; Ogawa et al. 2002). Different strains of Bcc have been reported as the source of a large variety of antifungal compounds, such as cepacin (Parker et al. 1984), pyrrolnitrin (Hwang et al. 2002), and siderophores (Sokol et al. 1992). In our recent research, the higher level of antifungal activity was found in extraction of filter-sterilized culture supernatants of strain JK-SH007 grown in NB medium with ethyl acetate. To our knowledge, none of inhibitory compound similarly to this compound was isolated from JK-SH007. Further research on this study will be (1) more detail identification of a novel antibiotic compound of JK-SH007, and (2) application of the purified antibiotic as biofungicides. The recA-based PCR tests examined proved to be excellent diagnostic tools for the identification of B. cepacia complex members (Zhang and Xie 2007; Dalmastri et al. 2006; Coenye et al. 2001a, b, c). Based on 16S rRNA gene and recA gene sequence data, the isolate of JK-SH007 was assigned to B. pyrrocinia genomovar IX. Some strains of Burkholderia cepacia complex are genetically related but phenotypically diverse organisms that are important opportunistic pathogens in patients with cystic fibrosis (CF). Many researches indicated that there need for a more precise evaluation of the pathogenicities of isolates of each species belonging to the Bcc. Bcc is endowed with a wide range of potential virulence determinants. Among the candidate virulence determinants, two transmissibility markers (BCESM and cblA) were chosen (Speert 2001). Putative transmissibility markers for B. cepacia complex bacteria have now also been identified. These markers include the cable pilin subunit gene (cblA), which encodes a giant cable-like pilus that facilitates adherence to respiratory mucins (Sajjan et al. 1995a, b), and the B. cepacia epidemic strain marker (BCESM), a 1.4-

World J Microbiol Biotechnol (2011) 27:2203–2215

kb open reading frame with homology to several negative transcriptional regulatory genes (Mahenthiralingam et al. 1997). In addition, the abilities of the isolates to infect onion tissue and alfalfa seedlings were investigated, which were important traits related to pathogenicity for plants and human. In summary, the results suggested that JK-SH007 was safety to plant and human. Some species of Bcc have a closer relationship with their host plants, being internal tissues colonizers. Some species of Bcc are common endophytes. Endophytic Bcc have even been found in gymnospermae as described by Bal and Chanway (2000) who isolated B. pyrrocinia from the stems of lodgepole pine. For instance, B. cenocepacia has been isolated from Australian wheat and lupine tissues where it was present in low numbers (Balandreau et al. 2001). B. cepacia from branches of a Citrus sp. cultivated in Brazil (Araujo et al. 2001) and from roots of rice in India (Singh et al. 2006). In this study for the first time reported that B. pyrrocinia was not a plant pathogen in poplar and this species could colonize poplar. The biological control strategy with utilizing endophytic bacteria is expected to operate under the general mechanism of competitive exclusion, since bacterial growth within the intercellular spaces would preclude or reduce the growth by other microorganisms such as the intercellular hyphae of three pathogens C. chrysosperma, P. macrospore and F. aesculi. And also in this study, for the first time, B. pyrrocinia JK-SH007 as a new nonpathogenic strain of poplar stem was reported. JK-SH007 showed the ability to control poplar canker that caused by C. chrysosperma, P. macrospore and F. aesculi, respectively and inhibited phytopathogenic fungi. In biocontrol experiments carried out under greenhouse conditions, this bacterium decreased the incidence of poplar canker caused by Cytospora chrysosperma, Phomopsis macrospora and Fusicoccum aesculi. The inhibitory effect of JK-SH007 indicated the importance of some bacteria species as possible natural source of fungicidal material. In conclusion, the results showed JK-SH007 could promote the growth of poplar, which would enhance the potential use of JK-SH007 as an effective biocontrol agent. Acknowledgments This study was supported by a grant from the Program for Science and Technology Development of Jiangsu Province (project BE2008393) and the Forestry Public Project of China (201004061 and 201004003-2).

References Allan ND, Kooi C, Sokol PA, Beveridge TJ (2003) Putative virulence factors are released in association with membrane vesicles from Burkholderia cepacia. Can J Microbiol 49:613–624

2213 Araujo WL, Saridakis HO, Barroso PAV, Aguilar-Vildoso CI, Azevedo JL (2001) Variability and interactions between endophytic bacteria and fungi isolated from leaf tissues of citrus rootstocks. Can J Microbiol 47:229–236 Bacon CW, Hinton DM (2002) Endophytic and biological control potential of Bacillus mojavensis and related species. Biol Control 23:274–284 Bal AS, Chanway CP (2000) Isolation and identification of endophytic bacteria from lodgepole pine and western red cedar. Auburn University Web Site, Available: http://www.ag.auburn. edu/argentina/pdfmanuscripts/bal.pdf Balandreau J, Viallard V, Cournoyer B, Coenye T, Laevens S, Vandamme P (2001) Burkholderia cepacia Genomovar III is a common plant-associated bacterium. Appl Environ Microb 67:982–985 Bernier SP, Silo-Suh L, Woods DE, Ohman DE, Sokol PA (2003) Comparative analysis of plant and animal models for characterization of Burkholderia cepacia virulence. Infect Immun 71:5306–5313 Bevivino A, Sarrocco S, Dalmastri C, Tabacchioni S, Cantale C, Chiarini L (1998) Characterization of a free-living maizerhizosphere population of Burkholderia cepacia: effect of seed treatment on disease suppression and growth promotion of maize. FEMS Microbiol Ecol 27:225–237 Bevivino A, Dalmastri C, Tabaechioni S, Chiarina L (2000) Efficacy of Burkholderia cepacia MCI 7 on disease suppression and growth promotion of maize. Biol Fert Soils 31:225–231 Brooks D, Gonzalez CF, Appel DN, Filer TH (1994) Evaluation of endophytic bacteria as potential biocontrol agents for oak wilt. Biol Con 4:373–381 Budi SW, Tuinen DV, Arnould C, Dumas-Gaudot E, GianinazziPearson V, Gianinazzi S (2000) Hydrolytic enzyme activity of Paenibacillus sp. strain B2 and effects of the antagonistic bacterium on cell integrity of two soil-borne pathogenic fungi. App Soil Ecol 15:191–199 Buren AV, Andre C, Ishmaru CA (1993) Biological control of the bacterial ring rot pathogen by endophytic bacteria isolated from potato. Phytopathology 83:1406 Burkhead KD, Schisler DA, Slininger PJ (1994) Pyrrolnitrin production by biological control agent Pseudomonas cepacia B37w in culture and colonized wounds of potatoes. Appl Environ Microbiol 60:2031–2039 Burkholder W (1950) Sour skin, a bacterial rot of onion bulbs. Phytopathology 40:115–117 Caraher E, Reynolds G, Murphy P, McClean S, Callaghan M (2008) Comparison of antibiotic susceptibility of Burkholderia cepacia complex organisms when grown planktonically or as biofilm in vitro. Eur J Clin Microbiol 26(3):213–216 Cardona ST, Wopperer J, Eberl L, Valvano MA (2005) Diverse pathogenicity of Burkholderia cepacia complex strains in the Caenorhabditis elegans host model. FEMS Microbiol Lett 205:97–104 Chang WT, Chen YC, Jao CL (2007) Antifungal activity and enhancement of plant growth by Bacillus cereus grown on shellfish chitin wastes. Bioresour Technol 98:1224–1230 Chiarini L, Bevivino A, Dalmastri C, Tabacchioni S, Visca P (2006) Burkholderia cepacia complex species: health hazards and biotechnological potential. Trends Microbiol 14:277–286 Coenye T, Lipuma JJ, Henry D, Hoste B, Vandemeulebroecke K, Gillis M, Speert DP, Vandamme P (2001a) Burkholderia cepacia genomovar VI, a new member of the Burkholderia cepacia complex isolated from cystic fibrosis patients. Int J Syst Evol Micr 51:271–279 Coenye T, Mahenthiralingam E, Henry D, LiPuma JJ, Laevens S, Gillis M, Speert DP, Vandamme P (2001b) Burkholderia ambifaria sp. nov., a novel member of the Burkholderia cepacia

123

2214 complex including biocontrol and cystic fibrosis related isolates. Int J Syst Evol Micr 51:1481–1490 Coenye T, Vandamme P, Govan JR, Lipuma JJ (2001c) Taxonomy and identification of the Burkholderia cepacia complex. J Clin M icrobiol 39:3427–3436 Dalmastri C, Pirone L, Tabacchioni S, Bevivino A, Chiarini L (2006) Efficacy of species-specific recA PCR tests in the identification of Burkholderia cepacia complex environmental isolates. Microbiology 246:39–45 Davison J (1988) Plant beneficial bacteria. Bio Technol 6:282–286 Dunne C, Crowley JJ, Moe¨nne-Loccoz Y, Dowling DN, Bruijn S, O’Gara F (1997) Biological control of Pythium ultimum by Stenotrophomonas maltophilia W18 is mediated by an extracellular proteolytic activity. Microbiology 143:3921–3931 Essghaier B, Fardeau ML, Cayol JL, Haijaoui MR, Boudabous A, Jijakli H, Zouaoui NS (2009) Biological control of grey mould in strawberry fruits by halophilic bacteria. J Appl Microbiol 106:833–846 Fridlender M, Inbar J, Chet I (1993) Biological control of soilborne plant pathogens by a b-1, 3 glucanase-producing Pseudomonas cepacia. Soil Biol Biochem 25:1121–1221 Gerhardson B (2002) Biological substitutes for pesticides. Trends Biotechnol 20:338–343 Govan JR, Hughes JE, Vandamme P (1996) Burkholderia cepacia: medical, taxonomic and ecological issues. J Med Microbiol 45:395–407 Govindarajan M, Balandreau J, Kwon SW, Weon HY, Lakshminarasimhan C (2008) Effects of the inoculation of Burkholderia vietnamensis and related endophytic diazotrophic bacteria on grain yield of rice. Microb Eco 55:21–37 Hallmann J, Kloepper JW, Rodriguez-Kabana R, Sikora RA (1995) Endophytic rhizobacteria as antagonists of Meloidogyne incognita on cucumber. Phytopathology 85:1136 Hebbar KP, Atkinson D, Tucker W, Dart PJ (1992) Suppression Fusarium moniliforme by maize root-associated Pseudomonas cepacia. Soil Biol Biochem 24:1009–1020 Hebbar KP, Martel MH, Heulin T (1998) Suppression of pre- and post emergence damping off in corn by Burkholderia cepacia. Eur J Plant Pathol 104:29–36 Heydari A, Misaghi IJ (1998) Biocontrol activity of Burkholderia cepacia against Rhizoctonia solani in herbicide-treated soils. Plant Soil 202:109–116 Hinton DM, Bacon CW (1995) Enterobacter cloacae is an endophytic symbiont of corn. Mycopathologia 129:117–125 Ho¨flich G, Wiehe W, Ku¨hn G (1994) Plant growth stimulation by inoculation with symbiotic and associative rhizosphere microorganisms. Cell Mol Life Sci 50:897–905 Hollis JP (1951) Bacteria in healthy potato tissue. Phytopathology 41:350–366 Holmes A, Govan J, Goldstein R (1998) The agricultural use of Burkholderia (Pseudomonas) cepacia: a threat to human health? Emerg Infect Dis 4:221–227 Holt JG, Kreig NR, Sneath PHA, Staley JT, Williams ST (1994) Bergey’s manual of determinative bacteriology. Williams and Wilkins, Baltimore Huang LJ, Su XH (2003) The Advance of Canker Disease-Resistance Breeding in Poplar. World Forestry Res 16:49–53 (in Chinese) Hwang J, Chilton WS, Benson DM (2002) Pyrrolnitrin production by Burkholderia cepacia and biocontrol of Rhizoctonia stem rot of poinsettia. Biol Control 25:56–63 Kim PI, Chung KC (2004) Production of an antifungal protein for control of Colletotrichum lagenarium by Bacillus amyloliquefaciens MET0908. FEMS Microbiol Lett 234:177–183 Kloepper JW, Scher FM, Laliberte M, Tipping B (1986) Emergencepromoting rhizobacteria: description, implications for agriculture.

123

World J Microbiol Biotechnol (2011) 27:2203–2215 In: Swinburne TR (ed) Iron, siderophores, and plant disease. Plenum Press, New York, pp 155–164 Lambert B, Joos H (1989) Fundamental aspects of rhizobacterial plant growth promotion research. Trends Biotechnol 7:215–219 Li W, Roberts DP, Dery PD, Meyer SLF, Lohrke S, Lumsden RD, Hebbar KP (2002) Broad spectrum anti-biotic activity and disease suppression by the potential biocontrol agent Burkholderia ambifaria BC-F. Crop Prot 21:129–135 Mahenthiralingam E, Vandamme P (2005) Taxonomy and pathogenesis of the Burkholderia cepacia complex. Chron Respir Dis 2:209–217 Mahenthiralingam E, Simpson DA, Speert DP (1997) Identification and characterization of a novel DNA marker associated with epidemic strains of Burkholderia cepacia recovered from patients with cystic fibrosis. J Clin Microbiol 35:808–816 Mahenthiralingam E, Bischof J, Byrne SK, Radomski C, Davies JE, Av-Gay Y, Vandamme P (2000) DNA-based diagnostic approaches for the identification of Burkholderia cepacia complex, Burkholderia vietnamiensis, Burkholdria multivorans, Burkholderia stabilis, and Burkholderia cepacia genomovars I and III. J Clin Microbio 38:3165–3173 Mahenthiralingam E, Urban TA, Goldberg JB (2005) The multifarious, multireplicon Burkholderia cepacia complex. Nat Rev Microbiol 3:144–156 McKevitt AI, Bajaksouzian S, Klinger JD, Woods DE (1989) Purification and characterization of an extracellular protease from Pseudomonas cepacia. Infect Immun 57:771–778 Minaxi, Saxena J (2010) Characterization of Pseudomonas aeruginosa RM-3 as a Potential Biocontrol Agent. Mycopathologia 170:181–193 Mukhopadhyay NK, Garrison NK, Hinton DM, Bacon CW, Khush GS, Pan MJ, Rademan S, Kuner K, Hastings JW (1997) Ultrastructural studies on the colonisation of banana tissue and Fusarium oxysporum f. sp. cubense race 4 by the endophytic bacterium Burkholeria cepacia. J Phytopathol 145:479–486 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 Ogawa K, Yoshida N, Kariya K, Ohnishi C, Ikeda R (2002) Purification and characterization of a novel chitinase from Burkholderia cepacia strain KH2 isolated from the bed log of Lentinus edodes, Shiitake mushroom. J Gen Appl Microbiol 48:25–33 Ordentlich A, Elad Y, Chet I (1988) The role of chitinase of Serratia marcescens in biocontrol of Sclerotium rolfsii. Phytopathology 78:84–92 Parka M, Kima C, Yanga J, Leea H, Shina W, Kimb S, Sa T (2005) Isolation and characterization of diazotrophic growth promoting bacteria from rhizosphere of agricultural crops of Korea. Microbiol Res 160:127–133 Parke JL (1990) Population dynamics of Pseudomonas cepacia in the pea spermosphere in relation to biocontrol of Pythium. Phytopathology 80:1307–1311 Parke JL, Gurian-Sherman D (2001) Diversity of the Burkholderia cepacia complex and implications for risk assessment of biological control strains. Annu Rev Phytopathol 39:225–258 Parker WL, Rathnum ML, Seiner V, Trejo WH, Principe PA, Sykes RB (1984) Cepacin A and Cepacin B, two new antibiotics produced by Pseudomonas cepacia. J Antibiot 37:431–440 Payne GW, Vandamme P, Morgan SH, LiPuma JJ, Coenye T, Weightman AJ, Jones TH, Mahenthiralingam E (2005) Development of a recA gene-based identification approach for the entire Burkholderia genus. Appl Environ Microbiol 71:3917–3927 Perin L, Mart0 ınez-Aguilar L, Castro-Gonz0 alez P, Estrada-de LSP, Cabellos-Avelar T, Guedes HV, Reis VM, Caballero-Mellado J (2006) Diazotrophic Burkholderia species associated with field-

World J Microbiol Biotechnol (2011) 27:2203–2215 grown maize and sugarcane. Appl Environ Microbiol 72: 3103–3110 Puente ME, Li CY, Bashan Y (2009) Rock-degrading endophytic bacteria in cacti. Environ Exp Bot 66:389–401 Quan CS, Zheng W, Liu Q, Ohta Y, Fan SD (2006) Isolation and characterization of a novel Burkholderia cepacia with strong antifungal activity against Rhizoctonia solani. Biocontrol 72(6): 1276–1284 Raaijmakers JM, Vlami M, de Souza JT (2002) Antibiotic production by bacterial biocontrol agents. Anton Leeuw Int J G 81:537–547 Richardson J, Stead DE, Coutts RHA (2001) Incidence of the cblA major subunit pilin gene among Burkholderia species. FEMS Microbiol Lett 196:61–66 Romero D, Pe´rez-Garcı´a A, Rivera ME, Cazorla FM, Vicente A (2004) Isolation and evaluation of antagonistic bacteria towards the cucurbit powdery mildew fungus Podosphaera fusca. Appl Microbiol Biotechnol 64:263–269 Sajjan US, Sun L, Goldstein R, Forstner JF (1995a) Cable (Cbl) Type II Pili of Cystic Fibrosis-Associated Burkholderia (Pseudomonas) cepacia: Nucleotide Sequence of the cblA Major Subunit Pilin Gene and Novel Morphology of the Assembled Appendage Fibers. J Bacteriol 177:1030–1038 Sajjan US, Sun L, Goldstein R, Forstner JF (1995b) Occurrence of multiple genomovars of Burkholderia cepacia in cystic fibrosis patients and proposal of Burkholderia multivorans sp. nov. Int J Syst Bact 47:1188–1200 Sambrook J, Fritsch ED, Maniatis T (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, New York, pp 155–164 Segonds C, Heulin T, Marty N, Chabanon G (1999) Differentiation of Burkholderia species by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene and application to cystic fibrosis isolates. J Clin Microbiol 37:2201–2208 Shoda M (2000) Bacterial control of plant diseases. J Biosci Bioeng 89:515–521 Sijam K, Dikin A (2005) Biochemical and physiologica characterization of Burkholderia cepacia as biologica control agent. Int J Agri Biol 7:385–388 Singh RK, Mishra RPM, Jaiswal HK, Kumar V, Pandey SP, Rao SB, Annapurna K (2006) Isolation and identification of natural endophytic rhizobia from rice (Oryza sativa L.) through rDNA PCR-RFLP and sequence analysis. Curr Microbiol 52:117–122 Sokol PA, Lewis CT, Dennis JJ (1992) Isolation of a novel siderophore from Pseudomonas cepacia. J Med Microbiol 36:184–189 Speert DP (2001) Understanding Burkholderia cepacia: epidemiology, genomovars, and virulence. Infect Med 18:49–56 Steve PB, Laura SS, Donald EW, Dennis EO, Pamela AS (2003) Comparative analysis of plant and animal models for characterization of Burkholderia cepacia virulence. Infec Immun 71: 5306–5313 Stone JK, Bacon CW, White JJF (2000) An overview of endophytic microbes: Endophytism defined. Dekker, New York, pp 3–30 Tahtamouni MEW, Hameed KM, Saadoun IM (2006) Biological control of Sclerotinia sclerotiorum using indigenous chitolytic actinomycetes in Jordan. Plant Pathol J 22:107–114

2215 Teather RM, Wood PJ (1982) Use of Congo red-polysacchatide interaction in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Appl Environ Microb 43: 777–780 Tervet IW, Hollis JP (1948) Bacteria in the storage organs of healthy plants. Phytopathology 38:960–967 Thomas MS (2008) Iron acquisition mechanisms of the Burkholderia cepacia complex. Biometals 21:105–106 Vandamme P, Holmes B, Vancanneyt M, Coenye T, Hoste B, Coopman R, Revets H, Lauwers S, Gillis M, Kersters K, Govan JR (1997) Occurrence of multiple genomovars of Burkholderia cepacia in cystic fibrosis patients and proposal of Burkholderia multivorans sp. nov. Int J Syst Bact 47:1188–1200 Vandamme P, Henry D, Coenye T, Nzula S, Vancanneyt M, LiPuma JJ, Speert DP, Govan JR, Mahenthiralingam E (2002) Burkholderia anthina sp. nov. and Burkholderia pyrrocinia, two additional Burkholderia cepacia complex bacteria, may confound results of new molecular diagnostic tools. FEMS Immunol Med Mic 33:143–149 Vandamme P, Holmes B, Coenye T, Goris J, Mahenthiralingamc E, LiPuma JJ, Govan JR (2003) Burkholderia cenocepacia sp. nov.—a new twist to an old story. Res Microbiol 154:91–96 Vermis K, Coenye T, LiPuma JJ, Mahenthiralingam E, Nelis HJ, Vandamme P (2004) Proposal to accommodate Burkholderia capecia genomovar VI as Burkholderia dolosa sp. Nov., Int J Syst Evol Micr 54:689–691 Wang Y, Wu XQ (2008) Study on several kinds of poplar canker disease and the pathogenicity of the pathogens in north of Jiangsu. J Nanjing Forestry Univ (Natural Sciences Edition) 32:47–50 (in Chinese) Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1992) 16S ribosomal DNA amplification for phylogenetic study. J Bact 173:697–703 Welbaum G, Sturz AV, Dong Z, Nowak J (2004) Fertilizing soil microorganisms to improve productivity of agroecosystems. Crit Rev Plant Sci 23:175–193 Yabuuchi E, Kosako Y, Oyaizu H, Yano I, Hotta H, Hashimoto Y, Ezaki T, Arakawa M (1992) Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia. Microbiol Immunol 36:1251–1275 Yang W, Shen RX, Liu HX (1999) On the Sustainable Management of the Poplar Canker (Dothiorella gregaria Sacc.). J Beijing Forestry Univ 21(14):13–17 (in Chinese) Zeng DP, Chao LJ, Sun FZ, Zhao TC (1999) The ice nucleation active bacteria on poplar trees and their effects in the courses of causing freezing injury and inducing fungous canker. Scientific Silvae Sinicae 35(3):53–57 (in Chinese) Zhang LX, Xie GL (2007) Diversity and distribution of Burkholderia cepacia complex in the rhizosphere of rice and maize. FEMS Microbiol Lett 266:231–235

123