Mol Gen Genet (1995) 247:282-294

@ Springer-Verlag 1995

Cheng-Shine Hwang • Pappachan E. Kolattukudy

Isolation and characterization of genes expressed uniquely during appressorium formation by Colletotrichum gloeosporioides conidia induced by the host surface wax

Received: 17 July 1994 / Accepted: 7 November 1994

Abstract Appressorium formation in germinating Colletotrichum gIoeosporioides is induced by the surface wax of the host, the avocado fruit. To elucidate the mechanism by which differentiation of appressorium formation is induced, the fungal genes specifically activated by this host signal were sought. From a cDNA library of the transcripts present in appressorium-forming conidia, the clones representing nongerminating conidia were removed by hybridization with cDNAs synthesized from the nongerminating conidia. From this subtracted library, clones that hybridized with cDNA for transcripts from appressorium-forming conidia and not with cDNA for transcripts from germinating conidia were selected. Three such clones were isolated and sequenced. The genes for these three transcripts were also cloned and sequenced. Northern blot analysis showed that transcripts that hybridized with these three clones were expressed in the conidium only during the process of appressorium formation induced by avocado surface wax, and that these transcripts were not detectable when appressorium formation was prevented even in the presence of avocado wax. Nucleotide sequences of the clones revealed that one clone, cap3, contained an open reading frame (ORF) that would code for a 26-amino acid, cysteine-rich peptide with significant homology to Neurospora crassa copper metallothionein. Another clone, cap5, contained an ORF that would code for a 27-amino acid cysteine-rich peptide with less homology to metallothioneins. Cu 2+ and C d 2+ also induced the expression of these genes at lower levels. The histochemical analysis of transformants containing the cap5 promoter fused to the [3-glucuronidase (GUS) gene showed that the cap5 gene promoter caused GUS expression exclusively during appressorium formation and most of the gus activity Communicatedby C. van den Hondel C-S. Hwang • R E. Kolattukudy(~) Ohio State NeurobiotechnologyCenter and Ohio State BiochemistryProgram, Ohio State University, 1060 Carmack Road, Columbus, OH 43210, USA

was in the appressorium. The cap22 clone contained an ORF coding for a 227-amino acid polypeptide of 22 kDa, which did not show significant homology to any known proteins. Recombinant CAP22 protein was produced using a pET-19b expression system in Escherichia coli, purified, and used to prepare rabbit antibodies. Western blot analysis of proteins from the appressorium-forming conidia revealed a major cross-reacting protein at 43 kDa and a minor band at 68 kDa, indicating that the potential glycosylation sites found in the primary translation product were probably glycosylated. Results of immunogold localization showed that CAP22 protein was located on the wall of the appressorium. Key words Colletotrichum gloeosporioides Appressorium formation • Avocado fruit • Infection structures • Wax-induced genes

Introduction Appressorium formation is essential for penetration of many plant pathogenic fungi into their hosts (Emmett and Parbery 1975; Staples and Hoch 1987; Staples and Macko 1980). Morphological and physiological aspects of this process have been studied extensively (Heath 1977; Heath and Heath 1978; Lapp and Skoropad 1978; Parbery 1963; Staples et al. 1975, 1976; Sutton 1962; Van Burgh 1950). The host plant is known to play a significant role in the germination and differentiation of the fungal conidium (Hoch and Staples 1991). However, the nature of the host signals and the molecular events they trigger in the conidium are poorly understood. In some cases, the physical features of the surface are thought to be important in regulating the differentiation of germ tube into appressorium (Dickinson 1977; Dickson 1979; Hoch et al. 1987b). For example, the germ tube of the bean rust fungus, Uromyces appendicuIatus, undergoes appressorium formation when it encounters stomata (Johnson 1934; Staples et al. 1985). Some of the molecular events triggered by this physical signal have been

283 studied ( B h a i r i et al. 1989; Lee and D e a n 1993; X u e i et al. 1992a, b). A l t h o u g h there are m a n y r e p o r t s that c h e m i c a l signals f r o m the host i n d u c e a p p r e s s o r i u m form a t i o n , few proven e x a m p l e s of s p e c i f i c c h e m i c a l signals have b e e n d o c u m e n t e d ( E d w a r d s and B o w l i n g 1986; Hoch et al. 1987a; Hoch and Staples 1984). Recently, it was f o u n d that the surface wax of avocado fruit i n d u c e s a p p r e s s o r i u m f o r m a t i o n in Colletotrichum gloeosporioides ( P o d i l a et al. 1993). The very l o n g c h a i n fatty alcohols in the avocado wax and synthetic very l o n g - c h a i n alcohols were f o u n d to i n d u c e appressor i u m f o r m a t i o n i n this f u n g u s . However, the m o l e c u l a r events t r i g g e r e d in the f u n g u s b y the host signal r e m a i n to be d e t e r m i n e d . In this p a p e r we r e p o r t the discovery, isolation and s e q u e n c i n g of three t r a n s c r i p t s , and their genes, w h i c h are e x p r e s s e d u n i q u e l y d u r i n g a p p r e s s o r i u m f o r m a t i o n i n d u c e d by the host signal in C. gloeosporioides. P r o d u c t i o n of r e c o m b i n a n t p r o t e i n c o r r e s p o n d i n g to one of these genes and i m m u n o c y t o c h e m i c a l loc a l i z a t i o n of this p r o t e i n in the a p p r e s s o r i a l wall are reported. E x p r e s s i o n of [3-glucuronidase ( G U S ) a c t i v i t y u n d e r the c o n t r o l of the C A P 5 p r o m o t e r in the appressor i u m is also d e m o n s t r a t e d .

Materials and methods Isolation of avocado wax extract and avocado fruit homogenate The surface wax extract of avocado fruit was isolated by dipping intact fruit in chloroform for 30 s. The chloroform solution was extracted twice with acidified water to remove water-soluble components and the solvent evaporated off in a rotary evaporator. The mesocarp of avocado fruit was homogenized for 1-2 rain and the homogenate stored at -80°C.

appressorium formation was visible although the appressoria were not fully melanized. Lactophenol cotton blue solution was added and the cover glass was placed on a grid divided into 1 mm squares, under × 100 magnification. Five random squares were screened for germination and appressoria formation and the values were averaged. For RNA isolation each petri dish (10×150 ram) containing 40-45 ml wax suspension and 5×106 conidia was incubated at 25°C for various periods of time. After 3-4 h the appressoriumforming conidia were harvested. To obtain germination without appressorium formation (germinating conidia) the same condition was used as for appressorium formation, except that 1% yeast extract was added instead of wax extract. Similar incubation in sterile distilled water resulted in no germination (nongerminating). After various time intervals, conidia were examined under light microscope. For isolation of RNA the nongerminating, germinating and appressorium-forming conidia prepared as described were used.

Isolation of total RNA Conidia from different treatment regimes were harvested by gently scraping them off the petri dishes with a rubber policeman, and recovered by centrifugation at 12000×g for 15 min. The conidia were suspended in guanidinium isothiocyanate solution (5 M guanidinium isothiocyanate, 50 mM TRIS-HC1, pH 7.5, 10 mM Na2EDTA, pH 8.0 and 5% 2-mercaptoethanol) and disrupted for 60-90 s with glass beads in the vortex mixer. Total RNA was isolated as described (Ausubel et al. 1992a). Since the germinating, appressorium-forming conidia strongly adhered to the petri dishes, the rubber policeman had to be used and the damage to the tissue associated with this process resulted in low recovery of RNA. Furthermore, overcrowding of conidia did not give good rates of germination and appressorium formation, thus requiring a low density of conidium distribution in the petri dishes. Therefore, in a typical experiment, a batch of 200 petri dishes (10× 150 mm), each containing 5× 106 conidia, was incubated with wax suspension.

Construction of a subtracted cDNA library Organism isolation and culture

C. gloeosporioides, isolated from avocado, was provided by Dr. Dov Prusky (Volcani Centre, Israel). Cultures were maintained at 25°C on potato dextrose agar supplemented with 1% (w/v) avocado fruit homogenate (avocado-PDA). Conidia were obtained by gently scraping 5- to 7-day-old cultures growing in petri dishes into sterilized water, the conidium suspension was filtered through two layers of Miracloth to remove mycelia and the conidia were recovered by centrifugation at 5000×g for 5 rain. The conidia were resuspended in sterilized water and collected by centrifugation. The concentration of conidia in the suspension was adjusted to 5 x 107 conidia/ml. Induction of germination and appressorium formation Conidia were harvested from 5- to 7-day-old cultures. Wax suspension was obtained by sonicating avocado wax in sterile water (1 mg/ml) for 3-5 min with a Sonifier Model 250 (Branson Corporation). The final concentration of wax suspension was adjusted to 0.005% (w/v). To determine the duration of exposure to wax that is required to induce appressorium formation, 5 ixl conidium suspension containing 3000 conidia was mixed with 100 btl wax suspension and placed on a cover glass over an area of 1 cm in diameter delimited by Parafilm, and incubated at 25°C as described before (Podila et al. 1993); the wax suspension was withdrawn after various times, and replaced with water and the incubation continued. The total incubation time was 5 h; at this time

The poly(A) + mRNAs were isolated from total RNA as described (Maniatis et al. 1982). Double-stranded cDNA was synthesized from the poly(A) ÷ mRNA of nongerminating conidia and appressorium-forming conidia by using an cDNA synthesis kit (Invitrogen). After the second-strand cDNA synthesis, the double-stranded cDNA was phenol/chloroform extracted, ethanol precipitated and dissolved in water. The cDNA synthesized from the non-germinating poly(A) ÷ mRNA was digested with RsaI and AluI to give small blunt-ended fragments. The cDNA synthesized from the appressorium-forming poly(A) + mRNA was ligated with EcoRI/ NotI adapters, phosphorylated and electrophoresed on agarose gel in order to remove excess adapters. Subtraction was done by the previously described procedure (Ausubel et al. 1992b). The cDNA of appressorium-forming conidia was mixed with a 30-fold excess of fragmented cDNA from the nongerminating conidia in a solution containing 50% (v/v) formamide, 10 mM NaPO 4, pH 7.0, 1 mM EDTA, pH 8.0, 0.1% SDS, 0.2 mg/ml yeast tRNA and 5×SSC (I×SSC is 0.15 M NaC1, 15 mM sodium citrate). The mixture was boiled for 5 min and incubated for 24 h at 37°C. After the hybridization step, the mixture was phenol/chloroform extracted and ethanol precipitated. The recovered DNA was dissolved in water followed by ligation to EcoRI-cleaved and depbosphorylated Xgtl 1 vector. cDNA probe synthesis and differential screening The poly(A) + mRNA isolated from nongerminating, germinating and appressorium-forming conidia were used as templates to syn-

284 thesize first-strand cDNA as described by the enzyme manufacturer (BRL). The unincorporated [c~-32P]dATP was removed via a Nensorb-20 column (NEN Research Products). The subtracted Xgtl 1 cDNA library was incubated with Escherichia coli Y1090 and plated on plates of LB/ampicillin (Amp) agar at a titre of 1000 pfu/plate. Triplicate nitrocellulose filters were lifted from one plate and hybridized with the cDNA probes synthesized from the nongerminating, germinating and appressorium forming poly(A) ÷ mRNAs. From each plate, the phage plaques were picked from the area which showed hybridization with the cDNA probe from the appressorium-forming conidia but not with the other two cDNA probes. These phage plaques were suspended in 1 ml SM buffer (0.1 M NaC1, 8 mM MgSO4, 50 mM TRIS-HC1, pH 7.5, and 0.01% gelatin) containing a drop of chloroform. After appropriate dilution with SM buffer, the phage suspension was incubated with E. coli Y1090 and plated on L B / A m p plates for secondary screening. After secondary screening, individual plaques which showed hybridization only with the cDNA from the appressorium forming conidia were selected. The cDNA inserts were excised with EcoRI, subcloned into M13mpl8 vector and sequenced.

no)propanesulfonic acid], 5 mM sodium acetate, 1 mM EDTA, pH 7.0, incubated for 15 min at 65°C, and rapidly cooled on ice. Denatured samples were subjected to electrophoresis on 1% agarose gel containing 2.2 M formaldehyde and blotted onto Nytran membranes. The conditions for prehybridization, hybridization, and washing were the same as described for Southern blots except for the final washing at 65°C for 40 min. Treatment of mycelia with Cu ~+ and Cd z+ and avocado wax A mineral medium (200 ml) containing 1% yeast extract in a 1-1 flask was inoculated overnight with 107 conidia with shaking (200 rpm) and 0.3 mM CuSO4 o r CdSO 4 was added and incubation continued for about 6 h. The mycelia were harvested by filtration and RNA was isolated as described above. For wax treatment of mycelia, 106 conidia were added to 20 ml of 1% yeast extract in 10× 150 mm petri dishes and incubated at 25°C for 48 h. The yeast extract was withdrawn and the mycelial mat washed three times with sterile water, and 40 ml of 0.005% avocado wax suspension in water or in fresh 1% yeast extract were added. After 8 or 24 h of further incubation at 25°C the mycelial mat was washed and RNA isolated for Northern blot analysis.

Construction and screening of a genomic DNA library Genomic DNA was isolated from mycelia after the conidia of C. gloeosporioides were grown in mineral medium (Hankin and Kolattukudy 1968) containing 1% yeast extract and 1% glucose with shaking (200 rpm) for 36 h. The genomic DNA was digested by Sau3A and subjected to electrophoresis on 0.7% agarose gel. The gel segment representing DNA fragments within the size of 9 22 kb was electroeluted, phenol, phenol/chloroform and chloroform extracted and precipitated with ethanol using standard procedures (Maniatis et al. 1982). The recovered DNA fragments were directly ligated into the partial fill-in XGeml 1 vectors. The library was amplified in E. coli LE392.The insert fragments of cDNA clones used as probes were labeled with [o~-32p]dATP by using the random primed labeling kit (Boehringer Mannheim).

DNA sequencing Single-stranded DNA subcloned into M 1 3 m p l 8 was used for sequencing. Synthetic primers were used to fill gaps in the sequence and for confirmation. Nucleotide sequences were determined by the Sanger dideoxy chain-termination method using [c~-35S]thiodATP (Sanger et al. 1977). Both strands were always sequenced.

Construction and use of expression plasmid pET-19b(22) in E. coli The polymerase chain reaction (PCR) was used to amplify the cap22 putative open reading frame (ORF) from cap22 cDNA with 5' primer containing a NdeI restriction site and 20 nucleotides after ATG, and 3' primer containing a BamHI restriction site and 20 nucleotides before TAA. The fragment was ligated into pET19b digested with NdeI and BamHI to give the expression plasmid pET-19b(22), which was used to transform E. coli pLysS cells. For expression of recombinant CAP22 protein, E. coli pLysS cells containing pET-19b(22) were grown at 37°C on LB medium containing 25 txg/ml chloramphenicol and 50 Bxg/ml ampicillin. When the cultures reached an A6oo of 0.4-0.5, 0.5 mM isopropylthiogalactoside (IPTG) was added and incubation continued at 37°C for a further 3 h to induce the synthesis of CAP22 protein. The recombinant CAP22 protein was purified using a Ni-affinity column according to the procedures described by the manufacturer (Qiagen). The eluant from the columns was collected and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE). The gel with the protein band at 22 kDa representing the induced protein was excised. One portion of gel was directly crushed and another portion of gel was subjected to electroelution. The eluant was mixed with the crushed pieces for injection into rabbits.

Southern blot analysis The genomic DNA was digested to completion with restriction enzymes, subjected to electrophoresis on 1% agarose gel and transferred to Nytran membranes. Prehybridization was at 42°C for 4-6 h in 50% formamide, 5 × S S P E (900 mM NaC1, 5 mM EDTA, 50 mM NaH2PO4, pH 7.4), 5×Denhardt's solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0. I% bovine serum albumin (BSA)], 0.1% sodium dodecyl sulfate (SDS) and 100 b~g/ml sheared salmon sperm DNA. The blots were hybridized for 1620 h at 42°C in the same solution with 2 × 10v cpm of a cDNA probe which was 32p-labeled to 108-109 cpm/txg by random primed labeling. After hybridization, the membranes were washed twice for a total of 20 min at room temperature in 2× SSPE containing 0.1% SDS. An additional wash was carried out with 0.2×SSPE, 0.1% SDS at 65°C for 90 min. The membranes were exposed to X-ray film at -80°C in the presence of an intensifying screen. Northern blot analysis Total RNA isolated from the fungus was dissolved in 50% formamide, 16% formaldehyde, 20 mM MOPS [3-(N-morpholi-

Production of antiserum against CAP22 recombinant protein and Western blot analysis The purified CAP22 recombinant protein was injected subcutaneously with Freund's adjuvant into New Zealand White rabbits. Booster injections were administered every 2 weeks. The rabbits were bled by heart puncture 10 days after the fourth booster and the serum was decanted after clot formation. For Western blot analysis, the conidia from cultures grown under different conditions were collected from the petri dishes, broken by vortexing with glass beads for 5 min in 10 mM TRIS-buffer, pH 7.0, containing 1% [3-mercaptoethanol and 0.5% SDS, and centrifuged at 13 000×g for 5 min. After collecting the supernatant, the cell debris was thoroughly mixed with the same buffer and centrifuged. The combined supernatant was concentrated with a Centricon-10 apparatus. An aliquot was subjected to SDS-PAGE, blotted onto nitrocellulose membranes and detected by reaction with antiCAP22 protein antiserum using ~aSI-labeled protein A.

285 Sample preparation and immunolocalization

Histochemical analysis for Gus activity

The conidia were incubated with wax suspension in the petri dishes as described above. After 7 h of incubation, wax suspension was removed and the petri dishes containing appressorium-forming conidia were rinsed three times with distilled water. The appressorium-forming conidia were fixed for 2.5 h in the petri dishes with 2% glutaraldehyde (v/v) in 50 mM sodium phosphate buffer, pH 7.2, followed by rinsing five times with phosphate buffer. The conidia from the petri dishes were collected into a small vial, rinsed with the buffer, dehydrated in a graded series of ethanol (30-85%) and infiltrated with LR White resin. Infiltration was carried out for 48 h at room temperature with several changes of resin and polymerization was performed for 24 h at 55°C. Blocks were cut with diamond knives on a Reichert Ultracut Ultramicrotome. The sections were placed on copper grids coated with Formvar, Coated grids with sections were treated with 5% NaIO4 for 30 min and 0.1 M HC1 for 10 min. After rinsing five times with distilled water, the grids were immersed for 20 min in 50 mM TRIS-buffered saline, pH 7.4, containing 0.1% Tween-20 and 1% BSA. Grids were placed in 1:50 diluted antiserum prepared against the recombinant CAP22 for 1 h, rinsed in TRIS-buffered saline containing 0.5% Tween 20 and 1% BSA, and placed in goat anti-rabbit antiserum (1:10 dilution) conjugated with 20-nm-diameter colloidal gold for 30 min before being washed in distilled water. Sections were stained with saturated aqueous uranyl acetate before being viewed with a Philips 300 electron microscope at 60 kV. Specificity of labelling was tested using pre-immune serum diluted at 1:50 in place of the anti-CAP22 antiserum.

The induction of appressorium formation was done as described above. The wax suspension was decanted and the petri dishes were rinsed twice with distilled water. To each petri dish, the substrate solution (0.1% Triton X-100, 50 mM TRIS-HC1, pH 7.5, and 1 mg/ml 5-bromo-4-chloro-3-indolylglucuronide) was added and incubated at 37°C for 10-12 h. The stained samples were briefly rinsed with distilled water and 70% ethanol before photography.

Construction of pCAP5-GUS expression vector The 2 kb PvuII fragment containing the 5' flanking region and 11 amino acids of CAP5 was excised from the cap5 gene, ligated with BamHI linker, cut by BamHI, and subsequently ligated into pGUS at the BamHI site, so that the 11 amino acids were in-frame with the gus protein (Mohan et al. 1993). The hygromycin gene with the Cochliobolus heterostrophus promoter was cut from pBluescript KS.431Exp with BamHI, blunted and ligated with XbaI linker (Bajar et al. 1991). The hygromycin gene ligated with XbaI linker was cut by XbaI and ligated into the XbaI site of pGUS containing the PvuII fragment. The final construct was designated pCAP5-GUS. The plasmid DNA was isolated and purified by density gradient centrifugation through CsC1.

Results D u r a t i o n o f c o n i d i a l e x p o s u r e to host wax r e q u i r e d to i n d u c e a p p r e s s o r i u m f o r m a t i o n W h e n the C. gloeosporioides c o n i d i a were i n c u b a t e d with the avocado wax s u s p e n s i o n the c o n i d i a started to g e r m i n a t e and f o r m g e r m t u b e s w i t h i n 2.5 to 3 h. A f t e r 3 - 4 h of i n c u b a t i o n the tips of the g e r m t u b e s b e g a n to swell and s u b s e q u e n t l y d i f f e r e n t i a t e d into a p p r e s s o r i a ; d e v e l o p m e n t o f m a t u r e a p p r e s s o r i a with dark t h i c k walls was c o m p l e t e d by 12 h. To d e t e r m i n e the d u r a t i o n of e x p o s u r e to host wax r e q u i r e d to t r i g g e r the m o l e c u l a r events that c o m m i t t e d the g e r m i n a t i n g c o n i d i a to appress o r i u m f o r m a t i o n , c o n i d i a were i n c u b a t e d with the wax for various t i m e s and the wax s u s p e n s i o n was s u b s e q u e n t l y r e p l a c e d b y water and i n c u b a t i o n was c o n t i n u e d . A 2-h e x p o s u r e to wax c a u s e d s o m e i n d u c t i o n o f g e r m i n a t i o n and 3 . 0 - 3 . 5 h e x p o s u r e c a u s e d g e r m i n a t i o n of m o r e than h a l f of the c o n i d i a w i t h a p p r e s s o r i u m f o r m a tion i n h a l f of the g e r m i n a t e d c o n i d i a (Fig. 1). A 4-h e x p o s u r e lead to a p p r e s s o r i u m f o r m a t i o n i n m o s t of the g e r m i n a t e d c o n i d i a . T h u s a 3 to 4 h e x p o s u r e of c o n i d i a

100 [ ] Germination 80

Transformation of protoplasts with the pCAP5-GUS expression vector

C. gloeosporioides protoplasts were prepared as described before (Bajar et al. 1991). Protoplasts (10 7) in 100 txl STC buffer were gently mixed with 10 p,g of plasmid DNA and incubated at room temperature for 30 min. Then 1.2 ml polyethyleneglycol (PEG) solution (60% PEG, 10 mM CaC12 and 10 mM TRIS-HC1, pH 7.5) was added and the mixture incubated at room temperature for 30 rain. After centrifugation at 1000×g, the supernatant was decanted and the pelleted protoplasts were resuspended in 5 ml STC buffer and centrifuged again. The protoplasts were resuspended in STC buffer at various dilutions and plated onto medium containing 1.2 M sorbitol, 1% yeast extract, 1% glucose, and 2% agar. Overlays of 1% agarose containing hygromycin at 300 txg/ml were added 24 h later. After 7-10 days of growth, the fastest-growing colonies were transferred to the same medium containing hygromycin at 200 txg/ml. After 7 days of growth, each growing transformant was transferred to the same medium containing 200 [xg hygromycin/ml. The fastest growing colonies were transferred to plates of avocado-PDA without hygromycin and the conidia were collected for histochemical analysis of gus activity during appressorium transformation.

App. Formation

60 ,4,,a

40

l

I

0.5

1.0

!

1.5

I

2.0

I

2.5

I

3.0

I

3.5

I

4.0

5.0

Time (h) Fig. 1 Duration of exposure of Colletotrichum gloeosporioides conidia to avocado surface wax required for induction of germination and appressorium formation. The conidia were incubated in avocado wax suspension for various times, the wax suspension was withdrawn and replaced with water, and the incubation continued for a total of 5 h before measuring germination and appressoria formation as indicated in the text

286

Fig. 2A-C Northern blot analysis of total RNA isolated from C. gloeosporioidesfor cap3, cap5, and cap22 transcripts. Total RNA samples isolated from the conidia treated as indicated were electrophoresed, blotted onto Nytran membranes, and hybridized with the 3zP-labeled cDNA for cap3 (A), cap5 (B), and cap22 (C). Amounts of total RNA used are shown (in ~g)

1.35kb

1,35kb 1,25kb 0.6kb

0.24kb

O,24kb

B 10 30 10 10 30 20 1030 (~tg)

to avocado wax was sufficient for the commitment of the germ tube to proceed to appressorium formation. Therefore, it was concluded that the transcripts produced during the 3 to 4 h exposure to the host wax are likely to include those that are specifically involved in appressorium formation.

Construction of subtracted cDNA library and differential screening A subtracted cDNA library was constructed in order to enrich for cDNAs associated with appressorium formation. Poly(A) ÷ mRNAs isolated from nongerminating conidia (incubated in water) and conidia incubated for 3.5 h with avocado wax were used as templates to make double-stranded cDNA. To make the subtracted cDNA library, the cDNAs for nongerminating conidia were used to subtract out the homologous population of DNA from the cDNA representing the appressorium-forming cultures. The subtracted cDNA library would contain transcripts involved in germination as well as appressorium formation; therefore, to identify those clones that represent transcripts expressed uniquely during the process of appressorium formation, the library had to be differentially screened with cDNA representing nongerminating and germinating conidia as well as that representing appressorium-forming conidia. To obtain cDNA representing germinating conidia, we sought conditions that would allow germination without appressorium formation. C. gloeosporioides conidia did not germinate in water or mineral salt solution even when supplemented with glucose or sucrose. However, conidia started to germinate in 1% yeast extract and form short germ tubes at 7-8 h of incubation. After further incubation, the germ tube elongated and eventually formed mycelia but never formed an appressorium. Therefore, cDNA was prepared using mRNA isolated after 7-8 h exposure of the conidia to yeast extract. Recombinants (4× 104) from the subtracted cDNA library were differentially screened with the cDNA probes for nongerminating, germinating and appressoriumforming cultures, respectively. Eighty-two individual clones that hybridized only to the cDNA probes for the appressorium-forming conidia but not to cDNA probes

C 10 30 10 10 30 20 1030 (~tg)

10 30 10 10 3O 2O 1 0 3 0 ( g g )

for nongerminating and germinating conidia were obtained. Phage DNA isolated from each clone was digested by EcoRI and the product was subjected to electrophoresis on agarose gel. By hybridization of the excised fragments with individual inserts several independent cDNA clones were identified; three of them were designated cap3, capS, and cap22 respectively. Only one insert was contained in each clone and the sizes of inserts were: 0.35 kb (cap3), 0.6 kb (capS), and 1.0 kb

(cap22). Northern blot analysis Northern blot analysis was used to test whether the cDNA clones obtained by the subtractive approach represent transcripts expressed uniquely during appressorium formation. Total RNA isolated from nongerminating, germinating, and appressorium-forming conidia were hybridized with the 3ap-labeled insert fragment of each clone. In each case a strong hybridization band was found only with the total RNA isolated from the appressoriumforming conidia. (Fig. 2A-C). In each case only one band was observed, at 0.4 kb for cap3, 0.6 kb for capS, and 1.25 kb for cap22. Comparison of the size of transcripts by Northern hybridization showed that cap3, cap5, and cap22 cDNA each represented nearly fulllength transcripts. To test whether these transcripts might be induced by wax but not be associated with appressorium formation, we tested whether the transcripts were produced in the presence of wax in yeast extract that does not allow appressorium formation. Total RNA from conidia incubated for 7 h in yeast extract containing avocado wax suspension showed no hybridization with the three probes showing that exposure to wax under non-appressorium-forming conditions did not cause expression of these genes at significant levels (Fig. 2A-C). To test whether the transcripts representing the three cDNAs could be induced by avocado wax under nutrient-depleted, non-appressorium-forming conditions, conidia were first allowed to germinate in yeast extract and subsequently the mycelia were treated with avocado wax in the presence or absence of yeast extract. Northern blot analysis showed that some cap5 transcripts were produced by the mycelia under these conditions, whereas,

287

Fig. 3A-C Southern blot analysis of genomic DNA isolated from C. gloeosporioides. DNA samples (10 Ixg/lane) were digested with the indicated restriction enzymes and hybridized with 32p-labeled cDNA for cap3 (A), cap5 (B), and cap22 (C). Size markers are indicated by arrows

21kb

5.14kb 4,271
,~

21kb

,~

5.14kb 4.27kb ,~

21kb

5.14kb 4.27kb 3.53kb

3.53kb

2.02kb

2.02kb

~-

2.02kb

1.58kb

1.58kb

,~

1.58kb

1.33kb

1.33kb

,~

1.33kb

0.98kb 0.83kb

~-~

0.83kb

0.98kb 0.83kb

O.56kb

0.56kb

0.98kb

~-~

A

cap3 and cap22 were not induced at detectable levels, suggesting that these transcripts are uniquely associated with appressorium formation.

Southern blot analysis The restriction map of each cDNA clone showed that there is one BglI site each within the cap3 and cap22 inserts and one SacI site within the cap5 insert, but there are no BamHI, EcoRI and HindlII sites. The genomic DNA isolated from C. gloeosporioides was digested with BamHI, EcoRI, HindlII, SacI, or BglI, and Southern blots of the digests were hybridized with the respective cDNA clone. The results showed only one band in BamHI, EcoRI, or HindIII digests, two bands in BglI digests after hybridization with cap3 and cap22, and two bands in SacI digests after hybridization with cap5 (Fig. 3A-C). These results suggest that the genome of C. gIoeosporioides contains one copy of each gene.

Screening of genomic DNA library To isolate the genes for the three cDNAs that are probably expressed uniquely during appressorium formation, a genomic library of C. gloeosporioides was constructed in the )~Geml l vector and screened with the insert of the cDNA clones. Screening of about 6× 105 recombinants yielded clones that hybridized with the three cDNA probes. Because the insert fragment of each clone was fairly large, the DNA of each clone was digested by various restriction enzymes and hybridized with the cDNA probes. One 1.5 kb XhoI-XbaI fragment from one genomic clone of cap3 included nearly the entire cDNA and 1.1 kb of 5' upstream region. One genomic clone of cap5 and another of cap22 were cut with EcoRI and in each

,~

,~

0.56kb

B

13

case the entire cDNA was contained in 3.5 kb fragments. All fragments were isolated and subcloned into M13rap 18 for sequencing.

Analysis of the nucleotide sequence of cap3 and cap5 cDNA and genes The nucleotide sequences of the cap3 cDNA clone and the cap3 gene with the deduced amino acid sequence of the putative ORF are shown in Fig. 4. The ORF starting with the first ATG codon would encode a polypeptide of 26 amino acids with a molecular mass of 2516 Da. This peptide would contain 7 cysteine residues. The cDNA sequence of CAP3 was found in the genomic sequence with a 68-bp intron, which interrupted the coding region of the cysteine-rich putative protein. A TATA box was found at position - 1 5 9 and a CAAT box was found at -204, with translation initiation site at + 1. The nucleotide sequences of the cap5 cDNA clone and the cap5 gene with the deduced amino acid sequence of the putative ORF are shown in Fig. 5. The ORF starting with the first ATG codon would encode a 27-amino acid polypeptide with a molecular mass of 2546 Da. This peptide would contain 8 cysteine residues. The cDNA sequence of cap5 was found in the genomic sequence but with two introns of 137 and 62 bp, which interrupted the coding region of this putative cysteine-rich protein. A putative TATA element was found at position - 1 3 2 and a CAAT box wag found at -183, with the translation initiation site at + 1. Comparison of the CAP3 and CAP5 proteins with the Genbank database showed homology to metallothionein sequences, as shown in Table 1. Metallothionein of Neurospora crassa (Munger et al. 1985) showed the highest degree of identity with the CAP3 protein; 10 out of 26 amino acids were identical and both have an identical

288 Fig. 4 Nucleotide and deduced amino acid sequences of cap3 gene. The putative TATA box and CAAT box are indicated by single and double underlining, respectively. The lowercase letters represent the intron region

CTAGCGCTTCCCTCGGAGAACATGTGGCAGGTCCTGTTTGGCAGGAGCCG TCTTTCTCAAGGAGGGGAAGGGGCTAGAGCGCAAGATTGGCTCTTTCCTC TCTTTCAGATGGCAATTTAGCAGTGTAAGCAGTAGCAAAGTCGGTATCTC TCTTAGATAATCAGTGGCATTACTTAAACCACCCAGATCGCGGCCACTTC TCGCCTCTTCTTCTTCCATCCATCAACCTCACACACACTCAAGCAAACCA AAGACTACGGTCAACATCAAACAAACACACAACTTCCAAGTCAACTTCAA AGACTTTCACACAATCAAC A T G TCT GGC TGC G G A TGC GCT TCC Met Ser Gly Cys Gly Cys A l a Set A C C GGT A C C Thr Gly Thr GGC Gly

TGC CAC Cys His

TGC Cys

GGC A A G GAC Gly Lys A s p

TGC A C C TGC GCC Cys Thr Cys A l a

TGC C C C g t a a g t t t t c a t t g c a t c a t c g c g g c a a g g a t g g t g a g g t Cys P r o

ggtttcgctaacacggccgttcacttagCAC AAA His Lys

TAA ACGACGTCAAG STOP

ACTCCATTGCTCTGATCGTCATGGGTTTTCATCATTGGCGGACGGGAAATG GCACGTTGCGGATGGGTGTTTAGCATGGTCAAGGGCTACGTTTTCTCTTCG CTGATGGCAGGAAACTTCTTCGACTCCTCGAGGTAGTTGTCAAGTGGAGAT TCGAATCGACTTTATATCCATAATGCCTGCTTAC

Fig. 5 Nucleotide and deduced amino acid sequences of cap5 gene. The putative TATA box and CAAT box are shown by single and double underlining, respectively. The lowercase letters represent the intron region

GACCAAGCCATGGGAGTGCCACCCCTGATGCGGTATCACACAACCCGCCATGTCAGCATC GCCGCACTGGCTGGCTGGTAGGTTACTCCAAACGGCCCCGCGGCATTCGCGTATTCTCCT CCGACAATCCTTGAGGACTGCCCGCCCCTCCACTCCTCCGGCCACGCCCGTCCGACCCTT TCCACGTAATGGCGAATGATACCGCGCCTCCTCGCGAGATAGCACATCTGATGCTCAATG TTCTTAGCTGACTGTGCGTGGGGGACGTATCTTGAAGACGGGTATATAATCCCCAAGGAC TTCTCGGCTTGGAAATGTTGTTTCCTTCTCTTCATCGACTCAACAAGCTCTCAGACCTCA CTTCCAAACAACAAACTACCAACTTTTAAGCTTTTCGCTTTAAACCCAACCAACTTTCAC A A T G GCC CCC T G g t a a g t a a c a g t c g a c t t c c t t g a a g a c g a g a a t c c g a g g a t t g Met Ala Pro Cys

-270 -220 -170 -120 -70 -20 +24 8 +63 21 +112 24 +160 26 +211 +262 +313 +347

-362 -302 -242 -182 -122 -62 -2 +55 4

tgagcttcttccaacaacgtgcgcattccgatgatttctagtttgcagggagagcttcaa +115 ggagctgtcagatagctaaccagatccacacagC TCT TGC AAG TCT TGC GGC A C C + I 7 0 Ser Cys Lys Ser Cys Gly Thr ii AGC TGC GCC GGC TCC TGC ACC TCT TGC TCT TGC GGC TCT TGC TCCg Set Cys Ala Gly Ser Cys Thr Ser Cys Ser Cys Gly Ser Cys Set

+216 26

taaggaacctccctcgcaccagcattacgttctcagcggcaaactaactacgaacacaca gCAC TAA A T T C A G C A T G A G C C C T C C G C G A C G C C G C A T C T G A C A A C C C T C A T G A A G A G G His STOP

+276 +334 27

CTCGCTCGACCCTACATCAAAAAACATTCCAATCGAGCTGCGTGCCCCCCGCCGAAACGG ACCGAAGTCGTTTTATCTCATGGGAATGAGGGAACTGAAGGATTTACTGGTTTTATGAAA GCGGGGACTCAAATGCTGGATCTACGGTTTTGAACCGGGACATCTACCGCCAACAGGAGC TCGCTTGTGTGGAGACCGGCCATGCAAATGCAACTCGGGCAAGTCCATCGGTAGTTGCTC GGTTTAGACTGTCTTGAAGGGATGAATACGTTTTTTTTTTCTCTCGTATGATAGTTTGGT AGTTATTTGGATTTGAATACGAGTGTTTTTGATT

+394 +454 +514 +574 +634 +668

number of cysteine residues. Six out of seven cysteine residues in both are arranged as Cys-X-Cys clusters, representing the metal binding motif. On the other hand, the sequence of cap5 protein showed less homology to metallothioneins. Another ORF from the cap3 gene starting with the second ATG could encode a 30-amino acid polypeptide that does not show any homology to any known protein. Other ORFs from the cap5 gene starting with the second and third ATG do not show any homology to known proteins. To test whether the transcripts representing the cysteine-rich protein can be induced by heavy metal ions, conidia were allowed to germinate and form mycelia in nutrient medium and subsequently were treated with

0.3 mM C u S O 4 o r CdSO 4. Northern blot analysis showed that the presence of Cd 2÷ and Cu 2+ ions induced only very low levels of cap3 transcripts (Fig. 6A), but larger amounts of cap5 transcripts were produced in the presence of these metal ions (Fig. 6B).

Sequence of cDNA and gene for

cap22

Both the cDNA and gene for cap22 were completely sequenced (Fig. 7). The cDNA clone was composed of 1002 bp, which is close to the size of the transcript indicated by Northern blot analysis. One ORF starting from the first ATG codon would encode a 227-amino acid

289 Table 1 Comparison of CAP3 and CAP5 proteins with metallo-

thioneins MT-1 (Mouse)

(Neurospora crassa)

e-

1 27 MDPNCSCSTGGSCTCTSSCACKNCKCT...

1

MT

II

II

Ill

26

MGDCGCSGASSCNCGSGCSCSNCGSK

zl

III

I [

[ I

I

1

MT

(Xenopus)

m

12s

MSGCGCASTGTCHCGKDCTCAGCPHK

CAP3 protein CAP5 protein

e-

27 MAPCSCKSCGTSCAGSCTSCSCGSCSH

32111

I

I

II

148

...KSCCSCCPAECSKCSQG...

polypeptide with a molecular mass of 22 892 Da. The amino acid sequence of this protein did not show significant homology with the sequence of other known proteins in the Genbank protein databank. This protein sequence contained two potential glycosylation sites [Asn X Ser(Thr) X], and hydropathy plots showed that the protein had four distinct hydrophilic domains and three distinct hydrophobic domains (data not shown). Other possible ORFs initiating at other ATG codons would encode only small polypeptides, with less than 80 amino acid residues. Thus, we tentatively conclude that the transcript is probably translated to yield a 23 kDa protein, as indicated in Fig. 7. The genomic sequence also showed a 681 bp ORF identical to that found in the cDNA but with one interruption by a 59 bp intron. The 5' flanking region of the cap22 gene had a TATA box at position -183 and a cyclic AMP response element consensus sequence at position -487, but did not contain a recognizable CAAT box. Expression of the protein representing cap22 transcript To determine whether the cap22 ORF is translated into proteins during appressorium formation we used an immunological approach. The PCR fragment containing the cap22 ORF was ligated into the expression plasmid under the control of the T7 promoter. The expression of CAP22 protein in E. coli (pLyS) containing this plasmid (pET-19b (22)) after IPTG induction was analyzed by SDS-PAGE. The CAP22 protein was expressed as indicated by a strong protein band at 26 kDa in the induced but not in the uninduced culture (Fig. 8). The slower than expected migration is most probably due to the histidine residues attached to the recombinant protein. The recombinant CAP22 protein purified with a Ni 2+ affinity column showed a single major band on SDS-PAGE. Polyclonal antibody against the recombinant CAP22 protein was prepared in rabbits.

0.4 k b

A

B 20 20

20

10

(ggRNA)

10 10

10

10

(ug RNA)

Fig. 6A,B Northern blot analyses of induction of cap3 and cap5 transcripts by metals ions in C. gIoeosporioides. The indicated amounts of total RNA were electrophoresed, blotted onto Nytran membranes, and hybridized with 32p-labeled cap3 cDNA (A) and cap5 cDNA (B). Mycelia were incubated with 0.3 M CuSO 4 or CdSO 4 for 6 h before isolation of RNA

component in the Western blots. Extracts from appressorium-forming conidia showed a strongly cross-reacting band at 43 kDa (Fig. 9A), which was larger than the size expected from the primary translation product of the ORF. It is probable that the mature protein is post-translationally modified in the appressorium-forming conidia. The time-course of expression of CAP22 protein in the appressorium-forming conidia showed that the protein could not be detected during the first 2 h of incubation, but a fairly large amount of the protein was detected after 4 h and the protein was detected even after 28 h (Fig. 9B). Some variable amounts of immunologically cross-reacting materials found at higher molecular weights, especially at 68 kDa, possibly represent more highly glycosylated form(s).

Immunogold localization of CAP22 protein Conidia which were in the process of forming appressoria as a result of the 7-h exposure to host wax, were processed and sectioned for immunogold labeling as described in the Materials and methods. Electron microscopic examination of the section treated with anti-CAP22 antiserum showed gold particles localized almost exclusively in association with the wall of the appressorium (Fig. 10A). With the preimmune antiserum no significant amounts of gold particles were found (Fig. 10B).

Western blot analysis of CAP22 protein produced in C. gloeosporioides during appressorium formation

Histochemical localization of GUS in CAP5-GUS transformants

Extracts of ungerminated conidia and germinated conidia did not show any immunologically cross reacting

Since it might be difficult to obtain antibodies against the small Cys-rich proteins, we used an indirect ap-

290 Fig. 7 Nucleotide and deduced amino acid sequences of cap22 gene. The putative TATA box and CAAT box are indicated by single and double underlining, respectively. The lowercase letters represent the intron region. N-glycosylation sites are indicated by asterisks

GCAGATGCTCTTGGGCCGTCCTGTGCTGCACTGCCCCCTGCGCTAGAACA CTGCAAAAGGTACTTCTCTGCTTCAGAAACGAGGCACTATTCTCCTCTTT GGCTGAATGCTTCGGGTTACCGATAGCGTCAATGACTTCTCGGTCTGAGG CTTGGACAGCTCGGGGCCTCTGCCATCGAGCTTGGCAATGCCCACCAACA CAGCCCTGCTTGGGACCGGAGAATCTCTGTCTCCCTCTGTGTGCGTGTGT CTGATTCCTTCCCCATCAGTGCCACTCTTCGTCTTGTCATGGCACAAGCT GCCGGCTGTTTCGACGCCTAGGGGCCTCCGTGTGATGCCGAAGCGGATCT CCGGCCCTGCAGTATGAGAAGAGGAGGAGCAGCAGGAGCACCGTTCACGC AAAGCATGAACTGGTTGACACCCAGAACATAAATATCCTATCACGATCCC GTCTCTACCCATCTTTCCTCTCACCTCATCACGCTTCACTTCGCCTTCGA CAGCTAGTCTCTCGCCCTTTACAACTCTTAGCAGCCTCGGCTCTTTTAAC GCTCGCTCAGCATCTCCAACTTGTCAACCTTCTTCTCTCAACAACAACAA GCCCCCCAACCTTCAAA A T G C A G G C C A A G A T C GTC G C C C T C Met G l n A l a Lys Ile V a l A l a L e u TCC GCC Ser Ala AAC Ash

A T T GCC Ile A l a

ACC AAC Thr A s n

CGC CCC Arg Pro

GCG GTT GTC AAC GCT GAC Ala Val Val Asn Ala Asp

CTC Leu

+63 21

A A T G C C A T C TGC A s n A l a Ile Cys

+102 34

C T T G G C A A C A T C TGC A C T G T C A A C L e u G l y A s n Ile Cys T h r V a l A s n

+141 47

GGC ATC CCC G l y Ile P r o

ATC CGC GAC Ile A r g A s p

TCC G A C Ser A s p

TGC Cys

CTC CGC Leu Arg

TTC ATC CCC Phe Ile P r o

GGC CAG ACC AAC AAC AAC AGC GAC G l y G l n T h r A s n A s h A s n Set A s p

CAG GAT Gln Asp

GAG GIu

C T T GAC GCC Leu A s p A l a

TCT Ser

GAT GTC AAG AAC A s p V a l Lys A s n

TTC Phe

-568 -518 -468 -418 -368 -318 -268 -218 -168 -118 -68 -18 +24 8

CAG Gln

TGT G T C Cys V a l

C T G GCT Leu A l a

GCT Ala

CAG Gln

CTT Leu

+180 60

TGC A C C A A C Cys Thr A s n

AGC Ser

+219 73

C A G TGC G l n Cys

TCT Ser

+258 86

CAG CAG CGC AGC Gln Gln Arg Ser

+297 99

TCC Set

w.w

TGC ATG AGC Cys M e t Ser CTT GAG Leu Glu

CAG AAG G l n Lys

GTT Val

CCC AGC GAC Pro Ser Asp

GGTgtgagcatctaacagtaccccaacagcttatacactcata Gly

ctgattctctccaccacagATC AAC Ile A s n GGC Gly

TTC Phe

CAG GCC Gln Ala

TCC G C C A A C Set Ala Ash GCC Ala

AGC Ser

ACT Thr

TCC Ser

TAC GCC Tyr Ala

ACC ATC ATC GTC T h r Ile Ile V a l

TCT C A G Ser @ i n

TCC A T C A T G A G C Ser Ile M e t Ser TCC Ser

TCC G C C Ser A l a

CTG GCC ACC CGC CTG ACT L e u A l a T h r A r g Leu Thr

+467 136

GCT Ala

TCC G A G C G C Ser Glu Arg

CAG Gln

GCT Ala

C G C A C C A C C A C C TTC C T T A C C A r g T h r T h r T h r P h e Leu Thr

GGC Gly

TTC Phe

CCT Pro

GGT G C C Gly Ala

+506 149

TCC G A C Set Asp

+545 162

GGT Gly

GGC Gly

+584 175

GGT GGC Gly Gly

+623 188

GGC GTC GTT Gly Val Val

+662 201

TCC C G C A C C S e r A r g Thr TCC A A C Ser A s n

TCC A C C A T C G G C Ser T h r Ile G l y

TCC C C C A A C G C C G C T GCT Ser Pro Asn Ala Ala Ala

CGC GAG Arg Glu

ACT GGC Thr G l y

GCC Ala

CCC Pro

GGC Gly

AGC AAC Ser Asn

AGC GTC Set Val

CTC G G C G C T G C T Leu G l y A l a A l a

GCC Ala

GTT Val

GCT Ala

GGC Gly

TTC GCC Phe A l a

CTC GGT Leu G l y

GCC Ala

GCT Ala

ACC Thr

+389 ii0 +428 123

ACT CCC T h r Pro

TCC A T C G C C A C C Ser Ile A l a T h r

C A G TGC G l n Cys TCC Ser

CTG ACC ACC ACC ATC GGC GGC Leu T h r Thr T h r Ile G l y G l y

CCT ACC Pro Thr

+346 102

GGC Gly

CTT Leu

+701 214

TTC A T G Phe Met

CTC Leu

+740 227

TAA ACGCCTTGCCTGGCTGGGTCTTTGCCTACAAAGCGGTATACAACACA STOP

+790

CATATGCATGAATGGATGACTTGTTAAGATAGTGCGCTGCGATCGATACAC CGGGTAAAAGTGGAGGCATAATGGTACGTTTGATTTAGTCTTATGATGATG TTACGGTTGTGCTTTGGAGTATTTTGAGGAAAGCGTCGCCCCTTTGGTAGT TGGATCTGGCCCGTGTGGAAACATATCTGTACTGTTTAGGGAAGATTACTA TTGGATAGACGCCTTAATCAAACTGGTTTTGACTT

+841 +892 +943 +994 +1029

291 Ni

4-

97kDa------~ 68kDa----~ 43kDa------~

29kDa----~

protein 18kDa-----~

14kDa-----~~

[

14kDa

Fig, 8 SDS-polyacrylamide gel electrophoresis (PAGE) analysis of total protein from 0.5 mM isopropylthiogalctoside induced (+) and uninduced (-) cultures of Escherichia coli pLysS harboring pET-19b (22). Ni, Protein purified on a Ni-affinity column

eo

0

2 4 6 8 28(hrs)

Fig. 9A Western blot of CAP22 protein in C. gloeosporioides nongerminating conidia (Spore), germinating conidia (Germination) and appressorium forming conidia (App. formation). B Western blot of crude extracts from appressorium-forming conidia exposed to avocado wax for different periods of time. In both A and B, anti CAP22 antibodies and [~zSI]protein A were used for detection proach and determined whether the p r o m o t e r of cap5 could direct the expression of a reporter gene uniquely during appressorium formation. The 2 kb 5 ' - f l a n k i n g region of the cap5 gene including 1 1 codons from the ORF was fused to the bacterial GUS ORF and a promoter from C. heterostrophus was used to drive the expression of h y g r o m y c i n resistance gene used for selection. Transformation of C. gIoeosporioides with this plasmid construct, p C A P 5 - G U S , yielded hygromycin-resistant transformants. Southern blot analysis of the genomic DNA from four of these transformants showed a GUS gene integrated into the genome (Fig. 1 1A). All of these transformants showed expression GUS activity only in

Fig. 10A,B Immunogold localization of CAP22 protein in the appressorium of C. gloeosporioides. The appressorium-forming conidia were processed as described in the text, incubated with antiserum (A) or pre-immune serum (B), labeled with colloidal gold and examined by electron microscopy. Bar, 1 ~m the a p p r e s s o r i u m - f o r m i n g conidia after being stained with a chromogenic substrate. The blue color was much stronger in the a p p r e s s o r i u m than in the conidium or the g e r m tube (Fig. l l B ) . Observations of hundreds of spores showed that GUS activity was found only in app r e s s o r i u m forming spores. Since the GUS product tended to diffuse, the color was found in the spore and g e r m tube. With the detergent present in the staining medium, prolonged staining showed blue color leaching into the

292

Discussion Q

Formation of the appressorium is essential for penetration of C. gloeosporioides into its host, the avocado fruit. q~ Germination of C. gloeosporioides conidia and differentiation to form appressoria are triggered by chemical signals from the host surface wax. However, the molecular mechanism by which the host signal triggers appressorium formation remains unclear. Elucidation of the nature of genes uniquely expressed when appressorium formation is induced by the host signal could facilitate understanding of the molecular basis of this phase of the plant-fungus interaction. In an effort to concentrate on the genes involved in the early phase of appressorium 21kb-----~ formation, we first determined the duration of exposure to the host signal required to achieve commitment to differentiate into the appressorium. By electing to concentrate on transcripts present at this time, when commitment was virtually complete, we may have excluded the 5kb-------~ genes involved in the commitment process itself. Thus 4.2kb-----P the genes discovered by the present approach are proba3.5kb----~ bly involved in the process of appressorium formation. Since the host wax induces both conidium germination and differentiation into the appressorium, we used a B slightly indirect experimental design to seek genes uniquely involved in the appressorium formation. Firstly, the cDNA for the nongerminated conidia were subtract2.0kb-----~ ed from the cDNA representing both germination and 1.9kb-----~ appressorium formation. The subtracted cDNA library was first screened with the cDNA probes representing 1.5kb----~ transcripts from nongerminated and appressorium forming conidia. This differential screening revealed a large 1.3kb----~ number of clones that hybridized only with the cDNA probe from the appressorium-forming conidia. This pool obviously represented transcripts involved in germination as well as in appressorium formation. To recognize those involved in germination, cDNA probes were pre0.9kb----~ pared for transcripts present in the conidia germinating in yeast extract and used for differential screening. Only A a small number of clones hybridized uniquely with cDFig. l l A Southern blot analysis of genomic DNA isolated from C. NA probes from appressorium-forming conidia but not gloeosporioides transformed with pCAP-GUS. Right lane, Genomic DNA (10 txg) from one hygromycin-resistant pCAP5-GUS with the probes for nongerminating and germinating transformant. Left lane, Genomic DNA (10 p~g) isolated from the conidia. wild type. Both samples were digested by EcoRI, electrophoresed, To test whether the clones obtained by the subtractive blotted onto Nytran membrane and hybridized with the full-length [3-glucuronidase (GUS) gene as a probe. B Histochemical local- cloning and differential screening truly represented tranization of GUS in the pCAP5-GUS transformant. Conidia of the scripts uniquely associated with appressorium formapCAP5-GUS transformant were incubated in wax suspension for tion, Northern blot analyses were performed; the results 5 h and the appressorium-forming conidium were stained as de- clearly showed that these transcripts were expressed onscribed in the text ly in the presence of host wax. The possibility should be considered that these clones represent transcripts that medium containing the appressorium-forming spores. are induced by host wax but are not related to appressoriHowever, in the non-appressorium-forming germinated um formation. However, this appears to be unlikely bespores, no GUS staining was found in either the conidia cause wax did not induce these transcripts in vegetative or the germ tube. Thus, the cap5 promoter causes expres- mycelia not forming appressoria. The nature of the transcripts uniquely expressed when appressorium formasion of GUS mainly in the appressoria. tion is induced by host wax was elucidated by determining the complete nucleotide sequence of the cDNA. The probability that these represent genuine transcripts of

293 genes, and not artifacts, was shown by the isolation and sequencing of the genes that encode these transcripts. However, the functions of these gene products remain obscure. The cap3 and cap5 genes encode cysteine-rich proteins with some homology to metallothioneins, and thus these genes could be related to metallothioneins of C. gloeosporioides. Many researches have shown that a metallothionein gene is expressed in cells in medium containing large amounts of heavy metal ions, such as Cu 2÷ and Cd 2+ (Munger et al. 1985; Thiele 1988). The host wax isolated from the avocado fruit had been thoroughly extracted with acidified water; therefore, it is highly unlikely that the wax preparation contains any heavy metals and at the low levels of host wax used no more than trace amounts of metals could have been present in the experiments. With the addition of high levels of exogenous C d 2+ o r Cu 2+ to the medium, C. gloeosporioides produced only extremely low levels of cap3 transcripts although significant amounts of cap5 transcripts could be found. On the other hand, appressorium formation was accompanied by much higher levels of expression of both cap3 and cap5. Therefore, we conclude that expression of cap3 and cap5 is associated with appressorium formation. The function of CAP3 and CAP5 proteins could be removal of excess heavy metals (Thiele et al. 1986; K~igi and Sch~iffer 1988) that might be present on plant surfaces in the field, thus protecting the delicate germ tubes differentiating into appressoria. The CAP3 and CAP5 proteins also could regulate the heavy metal ion pools inside the cell. Several enzymes involved in melanin synthesis - an important process for appressorium formation, such as tyrosinase (Malstrom and Ryden 1968) and laccase (Carley et al. 1967), are copper-containing enzymes. The CAP3 and CAP5 proteins could act as efficient heavy metal ion donors to the apo-forms of these enzymes. On the other hand, metallothionein is also known to be induced in other organisms by other factors, such as stress conditions, glucocorticoids, etc. (Bremner 1987). Several reports have indicated that conidia usually form appressoria under adverse environmental conditions (Skoropad 1967; Parbery 1963), such as starvation, and only formed vegetative mycelium under the nutrientrich conditions (Van Burgh 1950). This correlation of stress, appressorium formation and cap3 and cap5 gene expression could have a functional basis. It is becoming increasingly clear that many of the gene products first characterized as being stress induced are normal gene products with specialized cellular functions (Harti et al. 1994; Beclar and Craig 1994). It is possible that products of the metallothionein gene family are also used in normal developmental processes, such as appressorium formation, although their precise role is not understood. If the ORF we identified in the cap22 transcript is actually translated, the primary translation product would be a 23 kDa protein that shows no homology to other known protein sequences. The antibodies prepared

against this protein produced in a bacterial expression system detected a 43 kDa protein in the fungal conidium. Since the protein sequence showed the presence of two potential glycosylation sites it is probable that the 43 kDa protein represents a glycosylated form of CAP22 protein. A time-course of the appearance of the immunologically cross-reacting material showed some cross-reacting material at around 68 kDa in addition to the major band at 43 kDa, possibly representing more highly glycosylated forms. However, the appearance of the cross reactivity of the higher molecular weight materials was not consistent and might represent some nonspecific cross reactivity. Another band at 29 kDa was also found and this might represent an unglycosylated or underglycosylated form. These cross-reacting materials may also only be incidentally related immunologically to CAP22 protein; the unique appearance of these proteins in appressorium-forming conidium makes it highly likely that the immunologically cross-reacting materials actually represent CAP22 proteins. However, the nature of the post-translational modifications responsible for the increased molecular weight of the CAP22 gene product remain to be elucidated. Since the level of these proteins appeared to remain high and possibly increases even after appressorium formation is complete, expression of this gene, which commences with appressorium formation may persist even after this process is complete. CAP22 protein may be heavily glycosylated and secreted into the wall to serve structural functions and/or for adhesion of the appressorium to the host surface, a speculative functional role that is supported by the immunogold localization of the protein in the fungal walls. However, the function of the genes expressed uniquely in associationwith appressoriumformationremains tobeelucidated. Recently, several groups have studied the expression of genes involved in the formation of infection structures (Bhairi et al. 1989; Kubo et al. 1991; Xuei et al. 1992a, b; Lee and Dean 1993). Several genes were cloned and sequenced (Bhairi et al. 1989; Xuei et al. 1992a). In comparison with these genes specific to the infection structures, the cap22 gene does not show any significant homology in either nucleotide sequence or deduced amino acid sequence. The expression of the other infection structure-specific genes was induced by physical signals, whereas the expression of the cap22 gene was induced by the chemical signal of avocado wax. It is possible that genes triggered by physical signals from the host are different from those triggered by the chemical signals. However, when the nature of more genes involved in appressorium formation in different organisms becomes known, it is likely that some common homologous genes will be found to be involved in this differentiation process that is essential for infection by many fungi. Such genes could serve as targets for strategies to protect plants from fungal infections. Acknowledgements We thank Dr. Hongshi Yu for his technical advice on immunogoldlabeling and electron microscopy,Dr. Jaeho Pyee for the preparation of the avocado wax extract and fruit

294 homogenates, and Dr. Gopi Krishna Podila and Ms. Linda M. Rogers for their general technical advice and support. This work was supported by grant IBN-9318544 from the National Science Foundation. Note added in proof: The nucleotide sequence data for the cap3, cap5 and cap22 genes have GenBank accession nos. U18756, U18757 and U18758, respectively.

References Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1992a) Current protocols in molecular biology, vol 1. John Wiley Interscience, New York, pp 4.2.34.2.4 Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1992b) Current protocols in molecular biology, vol. 1. John Wiley Interscience, New York, pp 5.8.65.8.13 Bajar A, Podila GK, Kolattukudy, PE (1991) Identification of a fungal cutinase promoter that is inducible by a plant signal via a phosphorylated trans-acting factor. Proc Natl Acad Sci USA 88:8208-8212 Beclar J, Craig EA (1994) Heat shock proteins as molecular chaperones. Eur J Biochem 219:11-23 Bhairi SM, Staples RC, Frene R Yoder OC (1989) Characterization of an infection structure-specific gene from the rust fungus Uromyces appendiculatus. Gene 81:237-243 Bremner I (t987) Nutritional and physiological significance of metallothionein. Exp Suppl 52:81-107 Carley HE, Watson RD, Huber DM (1967) Inhibition of pigmentation in Aspergillosis niger by dimethylsulfoxide. Can J Bot 45:1451-1453 Dickinson S (1977) Studies in the physiology of obligate parasitism X. Induction of response to a thigmotropic stimulus. Phytopathology 89:97-115 Dickinson S (1979) Growth of Erysiphe germinis on artificial membranes. Physiol Plant Pathol 15: 219-221 Edwards MC, Bowlings DJF (1986) The growth of rust germ tubes towards stomata in relation to pH gradients. Physiol Mol Plant Pathol 29:181-196 Emmett RW, Parbery DG (1975) Appressoria. Annu Rev Phytopathol 13:147-167 Hankin L, Kolattukudy PE (1968) Metabolism of a plant wax paraffin (n-Nanocosane) by a soil bacterium (Micrococcus cerificans). J Gen Microbiol 51 : 457-463 Harti FU, Hlodan R, Langer T (1994) Molecular chaperones in protein folding: the act of avoiding sticky situations. Trends Biochem Sci 19:20-25 Heath MC (1977) A comparative study of non-host interactions with rust fungi. Physiol Plant Pathol 10:73-88 Heath MC, Heath OB (1978) Structural studies of the development of infection structures of cowpea rust Uromyces phaseoli var. vignae. I. Nucleoli and nuclei. Can J Bot 56:648-661 Hoch HC, Staples RC (1984) Evidence that cyclic AMP initiates nuclear division and infection structure formation in the bean rust fungus, Uromyces phaseoli. Exp Mycol 8:37-46 Hoch HC, Staples RC (1991) The fungal spore and disease initiation in plants and animals. Plenum Press, New York, pp 25-46 Hoch HC, Staples RC, Bourett TM (1987a) Chemically induced appressoria in Uromyces appendiculatus are formed aerially, apart from the substrate. Mycologia 79:418-424 Hoch HC, Staples RC, Whitehead B, Comeau J, Wolfe ED (1987b) Signaling for growth orientation and cell differentiation by surface topography in Uromyces. Science 234:1659-1662 Johnson T (1934) A tropic response in germ tubes of urediospores of Puccinia graminis tritici. Phytopathology 24:80-82

K~igi JH, Sch~tffer A (1988) Biochemistry of metallothionein. Biochemistry 27:8509-8515 Kubo Y, Nakamura H, Kobayashi K, Okuno T, Furusawa I (1991) A cloning of a melanin biosynthetic gene essential for appressorial penetration of CoIletotrichum lagenarium. Mol PlantMicrobe Interact 4:440-445 Lapp MS, Skoropad WP (1978) Location of appressoria of Colletotrichum graminicola on natural and artificial barley leaf surfaces. Trans Br Mycol Soc 70:225-228 Lee YH, Dean RA (1993) Stage-specific gene expression during appressorium formation of Magnaporthe grisea. Exp Mycol 17:215-222 Malmstrom BG, Ryden L (1968) The copper-containing oxidases. In: Singer TP (ed) Biological oxidations. Intersciences, New York, pp 415-438 Maniatis T, Fritsch ET, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York Mohan R, Bajar AM, Kolattukudy PE (1993) Induction of a tomato anionic peroxidase gene (tapl) by wounding in transgenic tobacco and activation of tapl/GUS and tap2/GUS chimeric gene fusions in transgenic tobacco by wounding and pathogen attack. Plant Mol Biol 21:341-354 Munger K, Germann VA, Lerch K (1985) Isolation and structural organization of the Neurospora crassa copper metallothionein gene. EMBO J 4:2665-2668 Parbery DG (1963) Studies on graminicolous species of phyllachora FcK1. I. Ascospores - their liberation and germination. Aust J Bot 11:117-130 Podila GK, Rogers LM, Kolattukudy PE (1993) Chemical signals from avocado surface wax trigger germination and appressorium formation in C. gloeosporioides. Plant Physiol 103: 267272 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 Skoropad WP (1967) Effect of temperature on the ability of Colletotrichum graminicola to form appressoria and penetrate barley leaves. Can J Plant Sci 47:431-434 Staples RC, Macko V (1980) Formation of infection structures as a recognition response in fungi. Exp Mycol 4:2-16 Staples RC, Hoch HC (1987) Infection structure - form and function. Exp Mycol 11:163-169 Staples RC, App AA, Ricci P (1975) DNA synthesis and nuclear division during formation of infection structures by bean rust uredospores germlings. Arch Microbiol 104:123-127 Staples RC, Laccetti L, Yaniv Z (1976) Appressorium formation and nuclear division in Colletotrichum truncatum. Arch Microbiol 109:75-84 Staples RC, Hoch HC, Epstein L (1985) The development of infection structure by the rust and other fungi. Microbiol Sci 2: 193198 Sutton BC (1962) Colletotrichum oleratum (Pets. ex. FrO Grove and C. trichellum (Ft. ex. Fr.) Duke. Trans Br Mycol Soc 45:222-232 Thiete DJ (1988) ACE 1 regulates expression of the Saccharomyces cerevisiae metallothionein gene. Mol Cell Biol 8:2745-2752 Thiele DJ, Walling MJ, Hamer DH (1986) Mammalian metallothionein is functional in yeast. Science 231:854-856 Van Burgh P (1950) Some factors affecting appressorium formation and penetrability of Colletotrichum phomoides. Phytopathology 40:29-35 Xuei X, Bhairi S, Staples RC, Yoder OC (1992a) Characterization of INF56, a gene expressed during infection structure development of Uromyces appendiculatus. Gene 110:49-55 Xuei X, Bhairi S, Staples RC, Yoder OC (1992b) Differentiationspecific genes of rust fungi have limited distribution amoung fungi. Exp Mycol 16:320-323