Parasitol Res (2008) 102:853–860 DOI 10.1007/s00436-007-0833-z

ORIGINAL PAPER

Pathophysiological variability of different genotypes of human Blastocystis hominis Egyptian isolates in experimentally infected rats Eman M. Hussein & Abdalla M. Hussein & Mohamed M. Eida & Maha M. Atwa

Received: 25 November 2007 / Accepted: 28 November 2007 / Published online: 11 January 2008 # Springer-Verlag 2007

Abstract The genotyping of Blastocystis hominis clinical isolates obtained from 28 gastrointestinal symptomatic patients and 16 asymptomatic individuals were identified by polymerase chain reaction using sequenced-tagged site (STS) primers. Then, pathophysiological variability between different B. hominis genotypes was evaluated in experimentally infected rats. Only four B. hominis subtypes (1, 2, 3, and 4) were detected (18.2%, 9.1%, 54.5%, and 18.2%, respectively) in human isolates. In symptomatic isolates, subtypes 1, 3, and 4 were detected in 8 (28.6%), 16 (57.1%), and 4 (14.3%) patients, respectively. In asymptomatic isolates, subtypes 2, 3, and 4 were identified in 4 (25%), 8 (50%), and 4 (25%), respectively. Subtype 3 was the commonest in humans. Different degrees of pathological changes were found among infected rats by symptomatic subtypes compared with asymptomatic subtypes. The moderate and severe degrees of pathological changes were

E. M. Hussein (*) Department of Parasitology, Faculty of Medicine Suez Canal University, P.O. Box 41111, Ismailia, Egypt e-mail: [email protected] A. M. Hussein Department of Bio-physics, Faculty of Science El-Azhar University (Males Branch), Cairo, Egypt M. M. Eida Department of Tropical Medicine, Faculty of Medicine Suez Canal University, P.O. Box 41152, Ismailia, Egypt M. M. Atwa Department of Pathology, Faculty of Medicine Suez Canal University, P.O. Box 41152, Ismailia, Egypt

found only in symptomatic subtypes infected rats while mild degree was found only in asymptomatic subtypes infected rats. Only subtype 1 induced mortality rate with 25% among infected rats. On evaluation of the intestinal cell permeability in the Ussing chamber, a prominent increase in short circuit current (ΔIsc) was found in symptomatic subtype 1 compared to symptomatic subtypes 3 and 4 infected rats. Minimal effects were found in the asymptomatic and control groups. The results proved that subtype 1 was clinically and statistically highly relevant to the pathogenicity of B. hominis while subtype 2 was irrelevant. Also, the results suggest the presence of pathogenic and nonpathogenic strains among subtypes 3 and 4.

Introduction The intestinal parasite Blastocystis hominis is the most common parasite found in fecal examinations of humans (Windser et al. 2002), which occurs from 0.8% to 61.8% with a high rate in adults than in children (Horiki et al. 1997). The role of B. hominis in human intestinal disease is controversial. Several clinical and epidemiological studies implicate B. hominis as a pathogen (Ashford and Atkinson 1992; Sadek et al. 1997: Rossingnol et al. 2005; Tan and Suresh 2006; Kaya et al. 2007) while others dismiss it as a commensal parasite (Shlim et al. 1995; Cirioni et al. 1999; Chen et al. 2003; Leder et al. 2005). Limited information was known about the host and parasitic factors which cause symptomatic or asymptomatic infection (Tan 2004). However, Puthia et al. (2005) and Sio et al. (2006) proved that B. hominis is able to produce a cystine protease that breaks up IgA antibody, which allows B. hominis survival and colonization in the human gut. Also, disturbances on the intestinal barrier functions may be contributed to the diarrhea

DO00833; No of Pages

854

sometimes observed in Blastocystis patients (Zuckerman et al. 1994; Puthia et al. 2006). The role of blastocystosis in irritable bowel syndrome (IBS) was first identified by Hussain et al. (1997). Then, Yakoop et al. (2004) demonstrated that fecal carriage B. hominis was more frequent in patients with IBS (46%) than the control group (7%). Symptoms that were attributed to infection with B. hominis are nonspecific, IBS-like, and include diarrhea, abdominal pain/discomfort, and nausea (Rossingnol et al. 2005). One proposed mechanism of B. hominis in IBS is through persistent antigen exposure as in persistent carriage or infection (Stark et al. 2007). Although, Blastocystis isolates from humans and animals were reported to exhibit genetic polymorphism, several molecular techniques such as fingerprinting (sequencing) analysis of small subunit RNA genes (SSU rDNA), randomly amplified polymorphic DNA analysis (RAPD), and polymerase chain reaction (PCR) amplification with sequenced-tagged site (STS) primers revealed that most isolates were either identical or closely related to each other (Abe et al. 2003; Arisue et al. 2003; Yoshikawa et al. 2004a). Most of the B. hominis isolates from humans were believed to be potentially zoonotic (Iguch et al. 2007). In spite of this extensive genetic variability present in B. hominis from humans and animals (Clark 1997; Abe et al. 2003; Noёl et al. 2005), a definite correlation between the genotypes and pathogenicity has not yet been confirmed. Because there is no animal model available to study B. hominis infection, the pathogenic potential of B. hominis can not be demonstrated experimentally (Tan et al. 2002). Some authors used the experimentally infected mice in studying B. hominis infection (Moe et al. 1997; Abou-El Naga and Negm 2001; Yao et al. 2005). However, the susceptibility of mice to B. hominis infection was not only variable but also agedepending. Mice were refractory to the infection after 3 weeks (Moe et al. 1997). Recently, Iguch et al. (2007) proved that rat was a suitable experimental animal model for studying the zoonotic potential of human B. hominis infection. So, this study aimed to identify the genotypes of B. hominis clinical isolates obtained from asymptomatic individuals and gastrointestinal symptomatic patients by PCR using sequenced-tagged site (STS) primers and evaluate the pathophysiological changes between different genotypes induced in experimentally infected rats by identifying the intestinal histopathological status, mortality rate, and the intestinal cell permeability with the Ussing chamber.

Materials and methods Eighty-five gastrointestinal symptomatic patients attending the gastrointestinal and tropical clinics in Suez Canal

Parasitol Res (2008) 102:853–860

University Hospital complaining of acute/chronic diarrhea with or without abdominal pain were selected. Also, 105 cross-matched asymptomatic individuals attending other clinics were selected. This study was conducted from January to July 2007, and all of the laboratory techniques were performed in the Departments of Parasitology and Pathology, Faculty of Medicine, Suez Canal University. Stool samples were collected from all symptomatic patients and asymptomatic persons. The samples were immediately examined for intestinal parasites by a wet smear stained with Lugol’s iodine and followed by formalin ethyl acetate concentration technique. To overcome the rather insensitive nature of direct smear and concentration methods in the detection of B. hominis, in vitro cultivation was performed for each stool sample in 3 ml of Jones’ medium without rice starch and supplemented with 10% horse serum (Jones 1946; Leelayoova et al. 2002). The culture was incubated at 37°C for 96 h and then examined by light microscopy with ×10 and ×40 objectives. All the stool samples were stained by modified acid-fast trichrome to exclude Cryptosporidium-, Cyclospora-, Isospora-, and Microsporidium-infected patients (Garcia 2001) and tested for common bacterial pathogens using the conventional methods. Sixteen fecal samples from asymptomatic individuals and 28 fecal samples from symptomatic patients having B. hominis and negative for others organisms were selected. DNA extraction B. hominis in Jones’ culture was isolated by centrifugation with 400×g for 10 min. The supernatant was discarded, and the pellet was resuspended in phosphate-buffered saline (PBS, pH 7.4). This suspension was overlaid on to a Ficoll-Paque column and centrifuged at 2,000×g for 10 min. B. hominis separated into a band approximately 1 cm from the surface. This layer was collected and resuspended in 8 ml of PBS and centrifuged at 500×g for 5 min, which was repeated six times. The resultant pellet was resuspended in 1 ml of PBS and centrifuged at 500×g for 5 min. The resultant pellet was stored at −20°C until required (Parkar et al. 2007). DNA extraction was performed using QIAamp DNA stool Mini Kit (Qiagen, Germany) according to the manufacturer's protocol. B. hominis genotyping by PCR It was performed using seven STS primers according to the method of Yoshikawa et al. (2004a). Subtype 1 was detected by SB83 using forward primer GAAGGACTCTCTGACGATGA and reverse primer GTCCAAATGAAAGGCAGC with product size 351 base pair (bp) (GenBank accession no. AF166086). Subtype 2 was detected by SB155 using forward primer ATCAGCCTACAATCT CCTC and reverse primer ATCGC CACTTCTCCAAT with product size 650 bp (GenBank

Parasitol Res (2008) 102:853–860

855

accession no. AF166087). Subtype 3 was detected by SB227 using forward primer TAGGATTTGGTGTTTGGA GA and reverse primer TTAGAAGTGAAGGAGATGGAAG with product size 526 bp (GenBank accession no. AF166088). Subtype 4 was detected by SB332 using forward primer GCATCCAGACTACT ATCAACATT and reverse primer CCATTTTCAGACAACCACTTA with product size 338 bp (GenBank accession no. AF166091). Subtype 5 was detected by SB340 using forward primer TGTTCTTGT GTCTTCTCAGCTC and reverse primer TTCTTTCA CACTCCCG TCAT with product size 704 bp (GenBank accession no. AY048752). Subtype 6 was detected by SB336 using forward primer GTGGGT AGAGGAAGGAAAACA and reverse primer AGAACAAGTCGAT GAAGTGAGAT with product size 317 bp (GenBank accession no. AY048751). Subtype 7 was detected by SB337 using forward primer GTCTTTCCCTGTCTATTCTGCA and reverse primer AATTCGGT CTGCTTCTTCTG with product Fig. 1 a Example from B. hominis genotypes of symptomatic patients and asymptomatic individuals using PCR. M is the ladder DNA at 100 bp. Subtype 1 (351 bp) in lanes 3 and 6. Subtype 2 (650 bp) in lane 4. Subtype 3 (526 bp) in lanes 1, 2, 5, 7, and 9. Subtype 4 (338 bp) in lane 8. b Another group of B. hominis genotypes, M is the ladder DNA (100 bp). Subtype 2 (650 bp) in lane 12. Subtype 3 (526 bp) in lanes 11, 13, 14, and 15. Subtype 4 (338 bp) in lane 10. c Another group of B. hominis genotypes, M is the ladder DNA (100 bp). Subtype 1 (351 bp) in lanes 17, 19, and 22. Subtype 3 (526 bp) in lanes 18, 20, and 21. Subtype 4 (338 bp) in lane 16

a

size 487 bp (GenBank accession no. AY048750). The amplifications round was performed in a total volume of 50 μl containing 20 μl of template DNA; 10 mM Tris–HCl (pH 9.0); 50 mM KCl; 0.1 Triton X-100; 2 mM MgCl2; 200 μM each of dNTP, dCTP, dGTP, and dTTP; 0.2 μM of each primer; and 1.25 U of Taq DNA. It began with an initial activation of the HotStar Taq DNA polymerase at 95°C for 15 min. The PCR conditions consisted of one cycle denaturating at 94°C for 3 min, 30 cycles including annealing at 59°C for 3 s, extending at 72°C for 60 s, denaturating at 94°C for 30 s, and an additional cycle with 5 min chain elongation at 72°C. The PCR products were electrophorized in 1.5% agarose gel. The band was visualized after being stained with ethidium bromide. Experimental infections Four-week-old Wistar male rats were orally inoculated with 4×107 B. hominis organisms in 4-day-old axenic cultures according to the method of

M

650 bp → 526 bp → 351 bp → 338 bp →

b

650 bp → 526 bp → 338 bp →

c

526 bp → 351 bp → 338 bp →

1

2 3 4 5

6 7 8 9

856

Parasitol Res (2008) 102:853–860

Table 1 Prevalence of B. hominis genotyping among human isolates Total B. hominis isolates Subtype 1 No. % 44

8

Subtype Subtype 2 3

Subtype 4

No. %

No. %

18.2 4

No. %

9.1 24

54.5 8

18.2

Yoshikawa et al. (2004b) under ether anesthesia. Two groups of rats were used according to the infected subtype (asymptomatic and symptomatic). Each group was subdivided into subgroups. Each subgroup included six rats per clinical isolate while the control group included six rats. Then, all infected rats were screened for the presence of B. hominis infection for 2 weeks post infection (P.I.) inoculation. Fecal samples were cultured every 2 days in the Jones medium supplemented with 10% horse serum (Jones 1946; Leelayoova et al. 2002). The culture was negative if the organism were not present on seventh day. Then, all of the infected rats were anesthetized and killed 6 weeks P.I. diagnosis. The killed rats were divided into three rats per isolate for histopathology examination and three rats per isolate for intestinal permeability evaluation. The liver, ileum, cecum, proximal colon, and distal colon of the rats were preserved in 10% formalin for H & E staining to study the histopathological changes, which were ranked (scores) according to Appleyard and Wallace (1995), and possible invasion to other tissues. Ussing chamber technique Intestinal cell permeability was determined with the Ussing chamber technique by assessing the changes in short circuit currents (ΔIsc) in stripped intestinal tissues from three infected rats per isolate and control rats (Ussing and Zerhan 1950; Bajka et al. 2003). The cecum and proximal colon were used. The colon region was removed followed by the cecum. Only the experimental segments of mucosa and submucosa were obtained and the underlying muscularis and serosa were removed before mounting into the Ussing chamber. PBS was added to the serosal side. The solution was maintained at 37°C by means of water-jacketed reservoirs connected to a constant temperature circulating pump. From this tissue, three sections were cut and mounted as flat sheets between Lucite half-chambers with an aperture of 1.13 cm2. All tissues were bathed with

normal Ringer's (composition in mmol/l) Na+140, Cl− 119.8, K+ 5.2, HCO3 25, Ca2+ 1.2, Mg2+ 1.2, HPO24 2:4, H2 PO4 0:4, 268 mosmol/kg H2O, pH 7.5, and 95% O2/5% CO2 at 37°C. Luminal and serosal solutions were connected to calomel and Ag–AgCl electrodes with Ringer's agar bridges for measurements of potential difference (PD) and automatic short circuiting of the tissue. The spontaneous PD across the tissue was maintained at 40 mV by an automated voltage clamp. The first 30 min were used to adjust the PD equilibrium and then the chambers were drained by new fluid. Subsequently, the maximum changes in ΔIsc that occurred within 15 min from PD equilibrium were recorded using digitalized data studio software. Statistical analysis Values represent the means±SEM. Oneway analysis of variance (ANOVA) was applied for multiple comparisons. Likelihood-ratio chi-square test was used to compare the frequency of genotypes of B. hominis isolates from symptomatic and asymptomatic infected individuals.

Results The genotypes of B. hominis obtained from 28 gastrointestinal symptomatic patients and 16 asymptomatic individuals using PCR with STS primers proved that only 4 B. hominis subtypes were identified among all the human clinical isolates (Fig. 1a,b, and c). Subtypes 1, 2, 3, and 4 were detected among 18.2%, 9.1%, 54.5%, and 18.2%, respectively. Subtype 3 was the commonest type (Table 1). Subtypes 1, 3, and 4 were detected among 8 (28.6%), 16 (57.1%), and 4 (14.3%) of symptomatic isolates, respectively. On the other hand, subtypes 2, 3, and 4 were identified in 4 (25%), 8 (50%), and 4 (25%) of asymptomatic isolates, respectively (Table 2). The likelihood-ratio chi-square test showed statistically significant relation between subtypes and the presence/absence of symptoms. Different degrees of pathological changes were detected among infected rats by symptomatic subtypes compared with asymptomatic subtypes (Table 3). The likelihood-ratio chi-square test showed statistically significant relation between subtypes and pathological degrees. The moderate and severe degrees of pathological changes were found

Table 2 B. hominis genotypes in symptomatic and asymptomatic groups, χ2 =12.31, likelihood-ratio, 16.04, P<0.006 B. hominis isolates

Symptomatic Asymptomatic

Subtype 1

Subtype 2

Subtype 3

Subtype 4

Total

No.

%

No.

%

No.

%

No.

%

No.

%

8 0

28.6 0

0 4

0 25

16 8

57.1 50

4 4

14.3 25

28 16

100 100

Parasitol Res (2008) 102:853–860

857

Table 3 B. hominis genotypes and pathological degree in symptomatic and asymptomatic infected rats, χ2 =62.33, likelihood ratio=73.75, P<0.000 Degree

Subtype 1

Subtype 2

Subtype 3 symptomatic

Subtype 3 asymptomatic

Subtype 4 symptomatic

Subtype 4 asymptomatic

Mild Moderate Severe

0 0 8

4 0 0

0 8 8

8 0 0

0 4 0

4 0 0

only in symptomatic subtypes infected rats while mild degree was found only in asymptomatic subtypes infected rats (Fig. 2a–c and d). Only subtype 1 induced fur loss, weight loss, and mortality (25%) among infected rats. Also, a precancerous change (polyps) on colon mucosa was identified with this subtype. On evaluation of the intestinal cell permeability, the maximum mean level of ΔIsc in symptomatic subtypes 1, 3, and 4 were 372.2±40.07, 140.6± 20.03, and 140.9±20.09 μA, respectively, within 15 min from the experiment stabilization while unremarkable changes were recorded from the beginning of the experiment till the end (after 15 min) among asymptomatic and control rats (Table 4). This difference was statistically highly significant. ΔIsc among symptomatic infected rats with subtypes 1, 3, and 4 were compared with the control from the beginning of the experiments to the end (Fig. 3a–c and d).

Discussion The main controversy about the B. hominis parasite is its role in human disease (Stark et al. 2007). The extensive Fig. 2 a Intense inflammatory reaction and sloughing mucosa by H & E stain ×400. b Edema by H & E stain ×400. c Precancerous polyp by H & E stain ×400. d Eosinophils by H & E stain ×400

genetic diversity that has been demonstrated among B. hominis isolates from humans and animals (Clark 1997; Noёl et al. 2003; Yoshikawa et al. 2003, 2004a) postulated that certain distinct genotypes may exhibit pathogenicity. In the studies of Noёl et al. (2005) and Parkar et al. (2007), sequence divergence among Blastocystis isolates of humans and animals reflected the existence of potentially ≥12 different genotypes, but only 7 of these were found in humans. In the present study, only four genotypes of B. hominis were identified among all the human clinical isolates. Subtypes 1, 2, 3, and 4 were detected among 8 (18.2%), 4 (9.1%), 24 (54.5%), and 8 (18.2%), respectively. The present study data were similar to that reported from six geographically distinct communities (Japan, Bangladesh, Pakistan, Germany, China, and Australia) by Yoshikawa et al. (2004a), Yan et al. (2006), and Parkar et al. (2007). In the study of Yoshikawa et al. (2004a), both of subtypes 1 and 4 were 17.6% for each one while subtype 3 was the commonest (60.8%). Noёl et al. (2005) found that both of subtypes 1 and 4 were 12.7% for each one. However, Yan et al. (2006) found that B. hominis type 1 was the second major subtype with 37.1% (13/35) after subtype 3 (40%).

858

Parasitol Res (2008) 102:853–860

Table 4 Maximum mean±SD of ΔIsc (μAm) in B. hominis genotypes experimentally infected rats compared to control within 15 min from PD equilibrium, difference highly significant (F=2006.04), P<0. 0001 B. hominis isolates

Subtype 1

Subtype 2

Subtype 3

Subtype 4

Symptomatic 372.2±40.07 – 140.6±20.03 140.8±20.09 Asymptomatic – 10.1±1.4 12.6±1.03 12.1±1.07 Control 10.01±1.01 10.01±1.01 10.01±1.01 10.01±1.01

Subtype 2 was 5.7% (2/35), mixed subtypes (1/3) were 14.3% of cases (5/35), and only one case (2.9%) had unknown subtype. On the other hand, subtype 4 was not detected at all. However, Yoshikawa et al. (2004a) and Parkar et al. (2007) demonstrated that subtypes 1 and 4 were mainly zoonotic, so its lowest percentage in the present study may be due to the fact that most of the studied populations were living in urban areas and the minority was in direct contact with animals. Also, the smallest sample size of symptomatic patients (16) in the study of Yan et al. (2006) led to the incorrect detection of the prevalence of subtypes 2 and 4 in particular. In the present study, subtypes 1, 3, and 4 were detected among 8 (28.6%), 16 (57.1%), and 4 (14.3%) of the symptomatic isolates, respectively. Meanwhile, subtypes 2, 3, and 4 were identified in 4 (25%), 8 (50%), and 4 (25%) of the asymptomatic isolates, respectively. Subtypes 1 and 2 were not found in asymptomatic and symptomatic isolates, respectively. In agreement with these data, when Lanuza et al. (1999) used sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to classify the protein profile of B. hominis diarrheic patients, three related patterns were identified (I–III). Patterns I and II were found in patients with chronic diarrhea while pattern II was found in patients with acute diarrhea. Also, Keneda et al. (2001) found a possible relationship between ribodeme type using PCR and pathogenicity of B. hominis. Ribodemes I, III, and VI may be responsible for the presence of gastrointestinal symptoms among blastocystosis patients. Yan et al. (2006) used PCR with STS primers and found that subtype 2 was only detected among asymptomatic patients and subtype 1 (9/16) was the commonest among symptomatic patients, suggesting their relation to the pathogenicity of B. hominis. In contrast, studies which have examined genotypes correlating with the pathogenic potential of B. hominis using restriction fragment length polymorphism (RFLP), analysis of SSU rDNA, and PCR with STS primers proved no distinct difference in genotypes between symptomatic and asymptomatic groups (Böhm-Gloning et al. 1997; Yoshikawa et al. 2004a). Also, Gericke et al. (1997) found that there was no correlation between isoenzyme patterns of B. hominis with different isolates collected from symptomatic, healthy persons, and deceased patients. Differences

in pathogenesis of B. hominis subtypes may be due to substrains with certain unknown virulence factors (Keneda et al. 2001; Noёl et al. 2005). In the present study, different degrees of histopathological changes were found among all infected rats. All of subtype 1 and the majority of subtype 3 symptomatic isolates induced a severe degree of pathological changes while all of the asymptomatic isolate subtypes (2, 3, and 4) induced a mild degree of pathological changes. These results were coordinated with the results of Moe et al. (1997), Abou-El Naga and Negm (2001), and Yao et al. (2005) who reported that severe edema, hyperemia, and congestion were found on the intestinal tissue, particularly the cecum and colon of mice infected with symptomatic isolates. According to Yan et al. (2006), subtype 1 is pathogenic and subtype 2 is nonpathogenic; so this

Fig. 3 a–d ΔIsc changes among symptomatic isolates subtype 1, 3, and 4 infected rats and control, respectively

Parasitol Res (2008) 102:853–860

explained the presence of a severe degree of histopathological changes among all infected rats with subtype 1 and mild degree of histopathological changes in rats infected with subtype 2. On the same line, using the phylogenic analysis by Parkar et al. (2007) revealed that a strong relationship was found between B. hominis isolates emphasizing its pathogenic and nonpathogenic effects such as subtypes 2 and 4 and subtypes 1 and 3, respectively. Some authors studied the role of the immune status of the host on the reproduction of B. hominis in the gastrointestinal tract and they found that the parasite breeds rapidly and causes significant pathological changes in the mucosa of immunocompromised host than immunocompetent host (Yao et al. 2005; Stark et al. 2007). In contrast, Leder et al. (2005) denied any correlation between clinical symptoms and B. hominis. Also, Horiki et al. (1999) stated that B. hominis was not related to the occurrence of colon cancer in humans. Mounting the cecum and proximal colon tissues in the Ussing chamber to assess intestinal cell permeability revealed that the maximum means±SD level of ΔIsc was found in symptomatic subtype 1 compared with subtypes 3 and 4 while unremarkable changes were recorded among asymptomatic and control rats. These results agreed with the studies in human infected by B. hominis using endoscopy, which had demonstrated edema and inflammation in the colon and, to some extent, in the small bowel (Gallagher and Venglarick 1985; Guglielmetti et al. 1989; Al-Tawil et al. 1994). This inflammation induced by Blastocystis has the ability to alter tight junctions between the intestinal epithelial cells and the intestinal content, which led to the disturbances on the barrier function and permeability with reduced excreted radioactive marker (Zuckerman et al. 1994; Dagci et al. 2002). Besides, the increase in number of inflammatory cells particularly mast cells and eosinophils among rats infected by symptomatic subtypes in the present study agreed with those who showed that the increase in the number of inflammatory cells was considered as a cofactor in increasing intestinal permeability and motility (Dunlop et al. 2006). In conclusion, subtype 1 was clinically and statistically highly relevant to the pathogenicity of B. hominis while subtype 2 was irrelevant. Also, the results suggest the presence of pathogenic and nonpathogenic strains among subtypes 3 and 4.

References Abe N, Wu Z, Yoshikawa H (2003) Molecular characterization of Blastocystis isolates from birds By PCR with diagnostic primers and restriction fragment length polymorphism analysis of the small subunit ribosomal RNA gene. Parasitol Res 89:393–396

859 Abou-El Naga I, Negm A (2001) Morphology, histochemistry and infectivity of Blastocystis hominis cysts. J Egypt Soc Parasitol 31 (2):627–635 Al-Tawil Y, Gilger M, Gorpalakrishna G, Longston C, Bommer K (1994) Invasive Blastocystis hominis infection in a child. Arch Pediatr Adolesc Med 148:882–885 Appleyard C, Wallace J (1995) Reactivation of hapten induced colitis and its prevention by anti-inflammatory drugs. Am J Physiol 269 (32):G119–G125 Arisue N, Hasimoto T, Yoshikawa H (2003) Sequence heterogeneity of the small subunit ribosomal RNA genes among Blastocystis isolates. Parasitology 126:1–9 Ashford R, Atkinson E (1992) Epidemiology of Blastocystis hominis infection in Papua New Guinea: age-prevalence and association with other parasites. Ann Trop Med Parasitol 86:129–136 Bajka H, Gillespie M, Steeb B, Reed C, Howarth S (2003) Applicability of Ussing chamber technique to permeability determination in functionally distinct region of the gastrointestinal tract in the rat. Scand J Gastroenterol 38(7):732–743 Böhm-Gloning B, Knobloch J, Walderich B (1997) Five subgroups of Blastocystis hominis isolates from symptomatic and asymptomatic patients revealed restriction site analysis of PCRamplified 16S-like rDNA. TM IH Trop Med Int Health 2:771– 778 Chen T, Chan C, Chen H, Fung C, Chan W, Liu C (2003) Clinical characteristics and endoscopic findings associated with Blastocystis hominis in healthy adults. Am J Trop Med Hyg 69:213– 216 Cirioni O, Giacometti A, Drenaggi D, Ancarani F, Scalise G (1999) Prevalence and clinical relevance of Blastocystis hominis in diverse patient cohorts. Eur J Epidemiol 15:398–3930 Clark C (1997) Extensive genetic diversity in Blastocystis hominis. Mol Biochem Parasitol 87:79–83 Dagci H, Ustum S, Taner M, Ersoz G, Karacasu F, Buda S (2002) Protozoon infections and intestinal permeability. Acta Trop 81: 116–121 Dunlop S, Hebden J, Campbell E, Naesdal J, Olbe L, Perkins C, Spiller R (2006) Abnormal intestinal permeability in subgroups of diarrheic-predominant irritable bowel syndromes. Am J Gastroenterol 101:1288–1294 Gallagher P, Venglarick J (1985) Blastocystis hominis enteritis. Pediatr Infect Dis 4:556–557 Garcia L (2001) Diagnostic parasitology. ASM, Washington, DC Gericke A, Burchard G, Knobloch J, Walderich B (1997) Isoenzyme patterns of Blastocystis hominis patients isolates derived from symptomatic and healthy carriers. TM IH Trop Med Int Health 2 (3):245–253 Gugliemetti P, Cellesi C, Figura N, Rossolini A (1989) Family outbreaks of Blastocystis hominis associated gastroenteritis. Lancet ii:1394 Horiki N, Maruyana M, Fujita Y, Yonekura T, Minato S, Keneda Y (1997) Epidemiologic survey of Blastocystis hominis infection in Japan. Am J Trop Med Hyg 56(4):370–374 Horiki N, Kaneda Y, Maruyama M, Fujita Y, Tachibana H (1999) Intestinal blockage by carcinoma and Blastocystis ho-minis infection. Am J Trop Med Hyg 60(3):400–402 Hussain R, Jafri W, Zuberi S, Baqai R, Abrar N, Ahmed A, Zaman V (1997) Significantly increased IgG2 subclass anti-body levels to in patients with irritable bowel syndrome. Am J Trop Med Hyg 56(3):301–306 Iguch A, Ebisu A, Nagata S, Saitou Y, Yoshikawa H, Iwatani S, Kimata I (2007) Infectivity of different genotypes of human Blastocystis hominis isolates in chicken and rats. Parasitol Int 56:107–112 Jones W (1946) The experimental infection in rats with Entameba histolytica. Ann Trop Med Parasitol 40:130–138

860 Kaya S, Cetin E, Aridogan B, Arikan S, Demirci M (2007) Pathogenicity of Blastocystis hominis, a clinical reevaluation. Turk Parazitol Derg 31(3):184–187 Keneda Y, Horiki N, Cheng X, Fujita Y, Maruyama M, Tachibana H (2001) Ribodeme of Blastocystis hominis isolated in Japan. Am J Trop Med Hyg 65(4):393–396 Lanuza M, Carbajal J, Villar J, Mir J, Borras R (1999) Soluble protein and antigenic heterogeneity in axenic Blastocystis hominis isolates. Parasitol Res 85:93–97 Leder K, Hellard M, Sinclair M, Fairley C, Wolfe R (2005) No correlation between clinical symptoms and Blastocystis hominis in immunocompetent individuals. J Gastroenterol Hepatol 20: 1390–1394 Leelayoova S, Taamasri P, Rangsin R, Naaglor T, Thathaisong U, Mungthin M (2002) In vitro cultivation a sensitive method for detecting Blastocystis hominis. Ann Trop Med Parasitol 96:803– 807 Moe K, Singh M, Ho L, Tan S, Chen X, Ng G, Yap E (1997) Experimental Blastocystis hominis infection in laboratory mice. Parasitol Res 83:319–325 Noёl C, Peyronnent C, Gerbod D, Edgcomb V, Delgado-Viscogliosi P, Sogin L, Carpon M, Viscogliosis E, Zenner L (2003) Phylogenetic analysis of Blastocystis isolates from different hosts based on the comparison of small-sbunit rRNA gene sequences. Mol Biochem Parasitol 126:119–123 Noёl C, Dufernez F, Gerbod D, Edgcomb V, Delgado-Viscogliosi P, Ho L, Singh M, Wintjens R, Sogin L, Carpon M, Pierce R, Zenner L, Viscogliosis E (2005) Molecular phylogenies of Blastocystis hominis isolates from different hosts: implications of genetic diversity, identification of species, and zoonosis. J Clin Microbiol 43(1):348–355 Parkar U, Traub J, Kumar S, Mungthin M, Vitali S, Leelayoova S, Morris K, Thompson A (2007) Direct characterization of Blastocystis from faeces by PCR and evidence of zoonotic potential. Parasitology 134:359–367 Puthia M, Vaithilingam A, Lu J, Tan K (2005) Degradation of human secretory immunoglobulin A by Blastocystis. Parasitol Res 97: 286–289 Puthia M, Sio S, Tan K (2006) Blastocystis ratii induces contact independent apoptosis, F-actin rearrangement, and barrier function disruption in IEC-6 cells. Infect Immun 74(7):4114– 4123 Rossingnol J, Kabil S, Said M, Samir H, Younis A (2005) Effect of nitazoxanide in persistent diarrhea and enteritis associated with Blastocystis hominis. Clin Gastroenterol Hepatol 3:987–991 Sadek Y, el-Fakahany A, Lashin A, el-Salam F (1997) Intestinal parasites among food-handlers in Qualyobia Governorate, with

Parasitol Res (2008) 102:853–860 reference to the pathogenic parasite Blastocystis hominis. J Egypt Soc Parasitol 27(2):471–478 Shlim M, Suresk K, Ho L, Ng G, Yap E (1995) Is Blastocystis hominis a cause of diarrhea in travelers? A prospective controlled study in Nepal. Clin Infect Dis 21:97–101 Sio S, Puthia M, Lee A, Lu J, Tan K (2006) Protease activity of Blastocystis hominis. Parasitol Res 99:126–130 Stark D, Van Hal S, Marriett D, Ellis J, Harkness J (2007) Irritable bowel syndrome: a review on the role of intestinal protozoa and importance of their detection and diagnosis. Int J Parasitol 37: 11–20 Tan K (2004) Blastocystis in humans and animals: new insights using modern methodologies. Vet Parasitol 126:121–144 Tan T, Suresh K (2006) Predominance of amoeboid forms of Blastocystis hominis in isolates from symptomatic patients. Parasitol Res 98:189–193 Tan K, Singh M, Yap E (2002) Recent advances in Blastocystis hominis research: hot spots in terra incognita. Int J Parasitol 21:723–726 Ussing H, Zerhan K (1950) Active transport of sodium as the sources current in the short circuit current isolated frog skin. Acta Physiol Scand 23:110–127 Windser J, Macfarlance G, Hughes-Thapa S, Jones A, Whiteside T (2002) Incidence of Blastocystis hominis in fecal samples submitted for routine microbiological analysis. Br J Biomed Sci 59:154–157 Yakoop J, Jafri W, Jafir N, Khan R, Islam M, AsimBeg M, Zaman V (2004) Irritable bowel syndrome: in search of an etiology: role of Blastocystis hominis. Am J Trop Med Hyg 70(4):383–385 Yan Y, Su S, Lai R, Liao H, Ye J, Li X, Luo X, Chen G (2006) Genetic variability of Blastocystis hominis isolates in China. Parasitol Res 99:597–560 Yao F, Qiao J, Zhao Y, Zhang X, Yang J, Li X (2005) Experimental infection of mice with Blastocystis hominis. Zhongguo Jishengchongxue Yu Jishengchongbing Zazhi 23(6):444–448 Yoshikawa H, Wu Z, Nagano I, Takahashi Y (2003) Molecular comparative studies among Blastocystis isolates obtained from human and animals. J Parasitol 89:585–594 Yoshikawa H, Wu Z, Kimata M, Iseki I, Ali M, Hossain B, Zaman R, Haque R, Takahashi Y (2004a) Polymerase chain reaction-based genotype classification among human Blastocystis hominis population isolated from different countries. Parasitol Res 92: 22–29 Yoshikawa H, Yoshida K, Nakajima A, Yamanri K, Iwatani S, Kimata M (2004b) Feco-oral transmission of the cyst form of Blastocystis hominis in rats. Parasitol Res 94:361–366 Zuckerman M, Watts M, Ho H, Meriano F (1994) Blastocystis hominis infection and intestinal injury. Am J Med Sci 30(8):96–101