Arch Environ Contam Toxicol (2009) 56:747–753 DOI 10.1007/s00244-008-9224-4

Purification and cDNA Cloning of a Cadmium-Binding Metallothionein from the Freshwater Crab Sinopotamon henanense Wen-Li Ma Æ Tao Yan Æ Yongji He Æ Lan Wang

Received: 11 March 2008 / Accepted: 11 August 2008 / Published online: 10 October 2008 Ó Springer Science+Business Media, LLC 2008

Abstract Metallothioneins (MTs) are cysteine-rich, metal-binding proteins that are useful biomarkers for monitoring pollution by heavy metals. In this report, a novel cadmium (Cd)-binding MT (CdMT) from Sinopotamon henanense was purified using acetone precipitation (50–80%), followed by gel-filtration chromatography and anion-exchange chromatography. Sodium dodecyl sulfate– polyacrylamide gel electrophoresis and time-of-flight mass spectrometry analysis showed that S. henanense CdMT existed as monomer and dimmer forms, with a monomer molecular weight of 6890 Da and a dimmer molecular weight of 13,766 Da. In addition, the full-length cDNA sequence of S. henanense CdMT was prepared from the gill RNA using reverse transcription–polymerase chain reaction and 30 and 50 rapid amplification of cDNA ends (RACE) methods. Sequence analyses indicated that the isolated cDNA (633 bp) contains an open reading frame of 177 bp that encodes a protein with 59 amino acids. The deduced amino acid sequence has 18 cysteine residues, implying that S. henanense CdMT binds six equivalents of bivalent metal ions (Cd) as opposed to the seven in its mammalian counterparts. The deduced molecular weight of MT without binding metals is 6218 Da. If six bound Cd atoms are counted, the deduced molecular weight of S. henanense CdMT would be 6892 Da, which is very similar to the molecular weight of the purified protein (6890 Da) determined by time-of-flight mass spectrometry analysis. These

W.-L. Ma
T. Yan
Y. He
L. Wang (&) School of Life Science and Technology, Shanxi University, Taiyuan 030006, People’s Republic of China e-mail: [email protected] W.-L. Ma e-mail: [email protected]

confirmed our results of MT purification. These present studies will be helpful to increase the database information of heavy-metal-induced MT in terms of crustaceans.

Metallothioneins (MTs), found in a large number of phylogenetically diverse organisms, are a class of low-molecular-weight, cytoplasmic, metal-binding proteins that are rich in cysteine residues (Kagi and Schaffer 1988). De novo synthesis of MT for binding and storage of heavy metals in target tissues is known to play an important role in acquired tolerance during metal accumulation (Roesijadi and Robinson 1994; Wu and Hwang 2003). The binding of toxic metals to MT represents a sequestration function that renders these metals unable to interact with other proteins, such as enzymes, and thereby offers a protection against metal toxicity at the cellular level (Chowdhury. et al 2005; Roesijadi 1992). A large number of MT-related studies have focused on the potential use of MTs as specific biomakers to monitor heavy-metal exposure (Chowdhury et al. 2005; Dallinger et al. 2000; De Lafontaine et al. 2000; Pedersen et al. 1997; Vasak and Hasler 2000). However, a complete understanding of these defense mechanisms and their relevance in acclimation process is not very clear. Vertebrate MTs have been investigated extensively and a search of amino acid and DNA databases reveals that there are a large number of published sequences. Compared with vertebrates, MTs in invertebrates have not been studied thoroughly. Especially in aquatic invertebrates, although the role of MT in the detoxification of heavy metal has been widely demonstrated, different MT genes (and isoforms) show differential expression due to heavy metal exposure (Banni et al. 2007; Dondero et al. 2005), but the studies on MT structure and gene sequence were

123

748

much more limited. In crustaceans, only nine primary structure of crab MTs have been published, including two MTs in the mud crab Scylla serrata (Lerch et al. 1982), one Cd-induced MT in the shore crab Carcinus maenas (Pedersen et al. 1994), three copper (Cu)-binding MTs (CuMTs) and two CdMTs in the blue crab Callinectes sapidus (Brouwer et al. 1995), and one CdMT in a freshwater and semiterrestrial species Potamon potamios (Pedersen et al. 1996). In the molecular genetic field, only nine crab MT nucleotide sequences can be found in Genebank (NCBI), including one shore crab Carcinus maenas MT gene (accession No. AF196974), three blue crab Callinectes sapidus cDNA (accession Nos. AF200418, AF200419, and AF200420), one mud crab Scylla serrata cDNA (accession No. AY057397), and one sand crab Portunus pelagicus cDNA (accession No. AY057395). Cadmium is an ubiquitous trace metal, biochemically classified as a nonessential element. It occurs naturally in the environment and is released as a result of human activities and natural processes (Alloway 1990). In recent years, Cd has become a problem of magnitude because it is a highly toxic pollutant in rivers, estuaries, and near-shore waters (Fingerman et al. 1996). In China, with the rapid development of industry, the fossil fuel burning, together with the waste incineration, industrial waste discharge, and mining, has contributed to widespread Cd contamination, which posed a continuing threat to the aquatic environment. According to the Food Safety Law of the People’s Republic of China, the maximum limited standard for Cd in crustaceans is 0.1 mg/kg (GB152Ol-94). However, much data revealed that Cd content in crabs had exceeded the standard, some even reached 100-fold of the standard (Jiang et al. 2007; Mao et al. 2007; Wang et al. 2004; Zhang and Wang 2004). Our colleagues had made a survey on Cd accumulation of Sinopotamon henanense in Qin River, the second longest river in Shanxi province. Result showed that the Cd level in hepatopancreas can reach 2.8 mg/kg, 28-fold of the standard. Crabs live in the sediments of the waters, face the heavy metals directly and might accumulate heavy metals at a higher level. Therefore, the crab can be a better animal bioindicator model for aquatic heavy metals pollution compared with vertebrates. S. henanense is a local special freshwater crab species of China. It is very common in the southeast of Shanxi province, an area that has endured the most serious environmental pollution due to the thriving coal mining, coking plant, iron, steel, and chemical industries. In our previous report, a positive correlation was shown between MT levels and Cd accumulation both in hepatopancreas and the gills of S. henanense exposed to acute waterborne Cd, indicating that S. henanense can be used as a bioindicator organism for monitoring Cd

123

Arch Environ Contam Toxicol (2009) 56:747–753

contamination (Ma et al. 2008). Therefore, it is important to gain a better understanding of MT in S. henanense. In this article, we aimed to isolate and purify MT induced by Cd in S. henanense and further aimed to clone the full-length cDNA of CdMT in S. henanense. These present studies will be helpful in increasing the database information of heavy-metal-induced MT in terms of crustaceans.

Material and Methods Metal Exposure Conditions Freshwater crabs, S. henanense, were purchased from a local dealer in Taiyuan Wulongkou fish market. These crabs were known to be collected from unpolluted areas of Yangcheng, located in the southeast Shanxi province. The crabs were raised in glass aquaria (45 cm 9 30 cm 9 30 cm) with 3–4-cm depth of dechlorinated tap water for 7–10 days prior to the experiments. According to our previous investigation on MT biosynthesis in different tissues of S. henanense exposed to different concentrations of waterborne cadmium, crabs were exposed to 5 mg/L waterborne Cd (as CdCl2
2 .5H2O) for 3 days to induce MT biosynthesis. After the exposure period, crabs were cryoanesthesized by putting them on ice for about 15 min; then the gill and hepatopancreas were carefully dissected out and stored at -80°C for further use. Purification of MT About 40 g of hepatopancreas tissue, obtained from about 30 crabs, were homogenized in 3 volumess of ice-cold 10 mM Tris-HCl, pH8.6, containing 1 mM dithiothreitol (DTT) and 0.1 mM phenylmethylsulfonyl fluoride (PMSF) as an antioxidant and antiproteolytic mixture. The homogenate was centrifuged for 40 min at 30,000 g at 4°C. The supernatant was placed in an ice-water bath, and acetone (-20°C) was slowly added to the supernatant while stirring. Acetone was added so that it successively comprised 50% and 80% (v/v) of the solution. Between each addition the mixture was centrifuged for 20 min at 27,000 g at 4°C. The 50–80% acetone pellet was collected and redissolved in 10 mL of ice-cold 10 mM Tris–HCl buffer (pH 8.6), containing 1 mM DTT and 0.1 mM PMSF. Five milliliters of dissolved 50–80% acetone pellet was loaded onto a Sephadex G-50 (2.6 9 100 cm) gelfiltration column equilibrated with 10 mM Tris–HCl buffer, pH 8.6, containing 1 mM DTT and 0.1 mM PMSF. The column was eluted with the same buffer at a flow rate of 0.5 mL/min after sample application. A254 and A280 were monitored continuously with ultraviolet spectrometry

Arch Environ Contam Toxicol (2009) 56:747–753

(UNICO PC). Cd and Cu levels were monitored continuously with atomic absorption spectrometry methods (SHIMDZU AA-6300, Japan). The peak corresponding to crab CdMT, which was also the main Cd peak, was collected and loaded onto a DEAE-Superose Fast Flow anionexchange column (2.6 9 20 cm) equilibrated with buffer A (10 mM Tris–HCl, pH8.6). Following a wash with buffer A, proteins were eluted with a liner gradient of buffer B (250 mM Tris–HCl buffer, pH 8.6) in buffer A at a flow rate of 1.0 mL/min. A254 and Cd levels were monitored continuously as described earlier. The purified CdMT sample was analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) (12%), ultraviolet spectrometry, and time-of-flight mass spectrometry (Ciphergen, USA). Total RNA Isolation and Synthesis of the First-Strand cDNA Excised gill tissue samples were frozen in liquid nitrogen and ground to a fine powder with a mortar and pestle. The total RNA was isolated from the powder by the addition of Trizol ReagentTM (Sigma). The RNA concentration was determined by the absorption at 260 and 280 nm. Firststrand cDNA (cDNA I) was synthesized using the isolated total RNA and oligo dT primer for reverse transcription. PCR Amplification of a Partial CdMT Coding Sequence According to the published amino acid sequences and cDNA sequences of MTs from other crabs (Pedersen et al. 1996; Savvau and Li 2000; Syring et al. 2000; Li et al. 2002; Li and Savva 2000), the degenerate forward primer L1 and reverse primer L2 (Table 1) were designed. The primers were used to amplify a partial CdMT sequence using cDNA I as the template. Briefly, 5 lL cDNA I was added to 25 lL sterilized water, 5 lL of 10X polymerase chain reaction (PCR) buffer, 1.5 lL of 25 mM MgCl2, 5 lL of 10 mM dNTP mix, 1 lL bovina albumin serum (BSA; 100 lg/mL), 2.5 lL of 10 lM forward primer L1, 2.5 lL of 10 lM reverse primer L2, and 2.5 lL Taq polymerase (5 U/lL). The total volume of the PCR reaction was 50 lL. PCR was carried out using the following protocol: pre-PCR: 95°C for 2 min (hot start); denature: 95°C for 1 min; anneal: 45°C for 1 min; extend: 72°C for 2 min, 40 cycles, then 10 min at 72°C, and hold at 4°C. The PCR products were electrophoresed on 1.5% agarose gels. Rapid Amplification of 30 and 50 cDNA Ends According to the obtained partial CdMT cDNA sequence, the specific 30 and 50 RACE primers L3 and L4 (Table 1)

749 Table 1 Oligonucleotide primers used for the amplification of the MT cDNA Primer

Length

Sequence (50 –30 )

L1

15

CCYGAYCCYTGCTGC

L2

21

GGGGCAGCARGAGCAAGGCTT

L3

27

CCTGATCCTTGCTGCACAGAAGGAACG

L4

26

GGGGCAGCAGGAGCAAGGCTTCGTGC

L5

22

GCACTCGGATTTGCATTTCTCG

Note: The length of each primer is given in nucleotides. R = A ? G; Y=C?T

were designed. First-strand cDNA (30 -RACE-Ready cDNA and 50 -RACE-Ready cDNA) were synthesized from 5 lg of total RNA according to the protocol of the SMARTTM RACE cDNA Amplification Kit (Clontech Inc.) using the 30 -CDS primer and 50 -CDS primer provided with the kit. 30 -cDNA ends and 50 -cDNA ends were then amplified using primers L3 and L4 as forward primers and the Universal Primer A Mix provided with the kit as the reverse primer. PCR was carried out using the following protocol: denature: 94°C for 30 s; extend: 72°C for 3 min, 5 cycles; denature: 94°C for 30 s; anneal: 68°C for 30 s; extend: 72°C for 3 min, 40 cycles; then hold at 4°C. The PCR products were electrophoresed on 1.5% agarose gels. The primary PCR reaction of 50 cDNA ends failed to give the distinct band, the nested specific 50 RACE primer L5 (Table 1) was designed and a nested PCR reaction was performed using the same protocol. The PCR products were electrophoresed on 1.5% agarose gels. Cloning and Sequencing of PCR-Amplified cDNA Several PCR products of S. henanense CdMT cDNA, such as the partial CdMT cDNA, 30 end and 50 end, were separated by electrophoresis on 1.5% low-melt agarose gels. Desired bands were excised under ultraviolet (UV) light and purified using the QIAquick Gel Extraction Kit (QIAGEN). Purified products were ligated in the pGEMÒT Easy Vector System (Promega) with T4 DNA ligase. The ligation mixture were transformed into Escherichia coli DH5a and plated on Luria-Bertani (LB)-Amp plates containing X-gal and isopropyl-b-D-thiogalactopyranoside (IPTG). Recombinant plasmid DNA was isolated according to Watson’s handbook of the Plasmid Mini Kit recommended by the manufacturer. Purified vectors were screened for the appropriate insert by digestion with EcoRI followed by agarose gel electrophoresis. Clones containing the appropriate insert were sent to the TaKaRa Biotechnology (Dalian) Co. Ltd. for nucleotide sequencing by an automatic DNA sequencer (ABI prism, USA). A fulllength clone of S. henanense CdMT cDNA was created by joining the partial MT cDNA 30 and 50 fragments.

123

750

Arch Environ Contam Toxicol (2009) 56:747–753

Molecular Phylogeny Analysis To determine the evolutionary relationships between the different MT isoforms, the deduced amino acid sequence of S. henanense CdMT was compared with MTs from mammalian, fish, mussel, lobster, and other crabs using BOXSHADE 3.21 server. The secondary structure of S. henanense CdMT was predicted with the DNAstar software. The phylogenetic tree was drawn using Clustalx 1.83.

Results and Discussions MT Purification Figure 1 shows the Sephadex G-50 column elution profile of the resuspended pellet obtained from the 50–80% acetone precipitation. Based on the absorbance of protein (OD254 [ OD280) and Cd level, it is apparent that fraction numbers 18–22 contain Cd-binding protein. Such an elution profile resembles that obtained by others using the Superose 12 and Sephadex G-75 columns for purification of MTs from other crabs and mollusks (Brouwer et al. 1995; Pedersen et al. 1996; Ponzano et al. 2001). The Cdcontaining fractions from the Sephadex G50 column (fraction numbers 18–22) were pooled and subjected to further purification on a DEAE-Superose Fast Flow column. The DEAE column elution profile (Fig. 2) showed one major Cd-containing peak (fraction numbers 15–22) with high absorbance at 254 nm. This peak was eluted at a Tris-HCl concentration of 150–180 mM. A UV absorbance spectrum (Fig. 3) of the pooled peak showed a characteristic absorbance in the 220–280-nm range, with a broad peak at 254 nm, typical of cadmium thiolate clusters. SDSPAGE (Fig. 4) and time-of-flight mass spectrometry analysis (Fig. 5) showed that the purified CdMT was highly

Fig. 2 DEAE-Superose Fast Flow column elution profile of MT fraction obtained from fraction numbers 18–22 of the Sephadex G-75 column

Fig. 3 Absorbance spectrum of the purified MT from S. henanense exposed to Cd

pure and existed as dimer and monomer forms, with a molecular weight of 13,766 Da and 6890 Da, respectively. These results showed that we have purified a single CdMT isoform from freshwater crab S. henanense. This is different from reports on other marine crabs; for example, two MT isoforms were obtained in the mud crab S. serrata (Lerch et al., 1982) and three CuMT isoforms and two CdMT isoforms were obtained in the blue crab C. sapidus (Brouwer et al. 1995). On the other hand, our result on the single isoform of CdMT is in agreement with the observations in the freshwater and semiterrestrial species P. potamios (Pedersen et al. 1996). Synthesis and Sequence of S. henanense CdMT cDNA

Fig. 1 Sephadex G-50 gel-filtration column elution profile of hepatopancreas homogenate supernatant following acetone precipitation

123

Three fragments (174 bp, 518 bp, and 230 bp) of S. henanense CdMT cDNA were amplified from the gill RNA. The PCR strategy is shown in Figure 6. From overlapping sequences of three fragments, the full-length S. henanense CdMT cDNA was constructed. The nucleotide sequence and its deduced amino acid sequence are shown in Figure 7. Sequence analyses indicated that the

Arch Environ Contam Toxicol (2009) 56:747–753

751

Fig. 6 The PCR walking strategy for amplification of S. henanense MT cDNA. Arrows indicate primers used

Fig. 4 SDS-PAGE analysis of purified MT from S. henanense exposed to Cd. Mr: protein molecular-weight markers; lanes 1, 2, 3, 4: CdMT fractions (18, 19, 20, 21 tubes) from the Sephadex G-50 gelfiltration column; lane 5: purified CdMT from the DEAE-Superose Fast Flow column; lane 6: purified CdMT after buffer exchange by ultrafiltration

as class I MTs (Pedersen et al. 1996). Most have eight or nine lysine residues to fulfill the electrostatic requirements; The N-terminus is an unblocked Pro-Xaa-Pro-Cys-Cys motif, where Xaa is either Asp or Gly. For comparison, the sequences from S. henanense CdMT and the only published freshwater crab MT from P. potamios CdMT differ only in eight positions, especially the C-terminal ends from positions 44–58 are identical, yielding 86.2% identity, which is higher than the identities between S. henanense CdMT and other marine crabs MTs (Fig. 8). Computer-Assisted Analysis

Fig. 5 Mass spectrometry spectrum of purified MT from S. henanense exposed to Cd

full-length cDNA contains an open reading frame (ORF) of 177 bp encoding for 59 amino acid residues. The start codon (ATG) is at nucleotide position ?1–3, and the stop codon (TGA) is at ?175–177. A potential polyadenylation signal (ATTAAA) is located at positions ?476–481. By being subjected to the BLAST search program (http:// www.ncbi.nlm.nih.gov/BLAST/), the nucleotide sequence we reported here for S. henanense CdMT has no homology with other MT genes. Furthermore, the deduced amino acid sequence of S. henanense CdMT was compared with amino acid sequences from mammalian, fish, mussel, lobster, and other crabs MTs, using BOXSHADE 3.21 server. Amino acid sequence comparison revealed that S. henanense CdMT shares 33.9% homology with mammalian Homo sapiens MT1A, 30.5% homology with common carp C. carpio. MT, 30.5% homology with mussel M. galloprovincialis MT, and 61.0% homology with lobster P. argus MT respectively (Fig. 8). Compared with the already existing primary structures of MTs from other crabs (Brouwer et al., 1995; Lerch et al. 1982; Otvos et al. 1982; Pedersen et al. 1994, 1996), the following features of crabs MTs seem to be common. They contain 57–59 amino acid residues, of which 18 are conserved cysteines arranged in 5 Cys-Xaa-Cys-, 2 Cys-Cys-. and 3 Cys-Xaa-Yaa-Cys- motifs, establishing the proteins

The secondary structure of S. henanense CdMT was predicted with the DNAstar software. The calculated pI and molecular weight (MW) are 7.28 and 6218 Da, respectively. S. henanense CdMT consists of two a-helixes, one b-sheet, and several tum regions. All of these might suggest that S. henanense CdMT protein is a water-soluble protein. The instability index (II) is computed to be 80.26, implying that CdMT is unstable. The deduced MW of MT without binding metals was 6218 Da. Adding six bound Cd atoms, the deduced MW of S. henanense CdMT will be 6892 Da, very similar to the MW of purified protein (6890 Da) determined by time-of-flight mass spectrometry; this further confirms our results of MT purification. Molecular Phylogeny Analysis To determine the evolutionary relationships among the different MT isoforms, the amino acid sequence of the S. henanense CdMT was used in a phylogenetic comparison with MTs from mammalian (Homo sapiens), fish (C. carpio), mussel (M. galloprovincialis), lobster (P. argus), and other crabs (C. maenas, C. sapidus, E. sinensis, S. serrata, P. pelagicus, and P. potamios). Phylogenetic tree was drawn using Clustalx 1.83. Results of phylogenetic analysis (Fig. 9) revealed diversification among mammalian, fish, mussel, lobster, and other crabs MTs. S. henanense CdMT clusters with MT from another freshwater species P. potamios but not the MTs from other marine crabs, indicating that nature habitats might play an important role in the evolution of crab MTs.

123

752

Arch Environ Contam Toxicol (2009) 56:747–753

Fig. 7 Full-length cDNA sequence and translated amino acid sequence of S. henanense MT. The translation start codon and stop codon are boxed. Negative numbers indicate upstream sequence relative to the translation start codon

Fig. 8 Comparison of the amino acid sequences for S. henanense MT and mammalian (H. sapiens), fish (C. carpio), mussel (M. galloprovincialis), lobster (P. argus), and other crabs (C. maenas, C. sapidus, E. sinensis, S. serrata, P. pelagicus, and P. potamios) MTs. Alignment was carried out with BOXSHADE 3.21 server. The identical and similar residues are shown in shaded letters

Fig. 9 Phylogenetic relationships between S. henanense MT and mammalian, fish, mussel, lobster and other crabs MTs. The phylogenetic tree was drawn using Clustalx 1.83

Conclusions In conclusion, although MTs have been the subject of many investigations, they have not been widely studied in invertebrates, especially at the level of gene. In the present

123

study, a novel Cd-binding MT was successfully purified from S. henanense. The purity and MW of CdMT were analyzed by SDS-PAGE and time-of-flight mass spectrometry. The purified CdMT exists as dimmer and monomer forms. In addition, the full-length cDNA sequence of S. henanense CdMT was prepared from the gill RNA. Sequence analyses further confirm that CdMT is composed of 59 amino acid residues. The deduced amino acid sequence has 18 cysteine residues, implying that S. henanense CdMT binds 6 equivalents of bivalent metal ions (Cd) as opposed to the 7 in its mammalian counterparts. The deduced MW of MT without binding metals is 6218 Da. If six bound Cd atoms are counted, the deduced MW of S. henanense CdMT would be 6892 Da, which very similar to the MW of the purified protein (6890 Da) determined by mass spectrometry analysis. This fully confirms our results of MT purification. In conclusion, CdMT from the freshwater crab S. henanense is a unique Cd-binding MT isoform. These finding will be helpful to

Arch Environ Contam Toxicol (2009) 56:747–753

increase the database information of heavy-metal-induced MT in terms of crustaceans. It is expected that future work on gene expression and further characterization of native and recombinant forms of CdMT will provide more insights into the molecular mechanism of S. henanense CdMT in the fields of metal storage and detoxification, protection from the oxidative stress, and diagnostic assays to monitor toxic metal pollutions. Acknowledgments This study was supported by the Natural Sciences Foundation of China (grant Nos. 30470254 and 30640051) and the Natural Sciences Foundation of Shanxi Province (grant No. 20041082).

References Alloway BJ (1990) Cadmium. Heavy metals in soils. Wiley, New York, pp 100–124 Banni M, Dondero F, Jebali J, Guerbej H, Boussetta H, Viarengo A (2007) Assessment of heavy metal contamination using real-time PCR analysis of mussel metallothionein mt10 and mt20 expression: a validation along the Tunisian coast. Biomarkers 12:369– 83. doi:10.1080/13547500701217061 Brouwer M, Enghild J, Hoexum-Brouwer T (1995) Primary structure and tissue-specific expression of blue crab (Callinectes sapidus) metallothionein isoforms. Biochem J 311:617–622 Chowdhury MJ, Baldisserotto B, Wood CM (2005) Tissue-specific cadmium and metallothionein levels in rainbow trout chronically acclimated to waterborne or dietary cadmium. Arch Environ Contam Toxicol 48:381–390. doi:10.1007/s00244-004-0068-2 Dallinger R, Berger B, Gruber C, Hunziker P, Sturzenbaum S (2000) Metallothioneins in terrestrial invertebrates: structural aspects, biological significance and implications for their use as biomarkers. Cell Mol Biol 46:331–346 De Lafontaine Y, Gagne F, Blaise C, Costan G, Gagnon P, Chan HM (2000) Biomakers in zebra mussels (Dreissena polymorpha) for the assessment and monitoring of water quality of the St. Lawrence River (Canada). Aquat Toxicol 50:51–71. doi: 10.1016/S0166-445X(99)00094-6 Dondero F, Piacentini L, Banni M, Rebelo M (2005) Quantitative PCR analysis of two molluscan metallothionein genes unveils differential expression and regulation. Gene 345:259–270. doi: 10.1016/j.gene.2004.11.031 Fingerman M, Devi M, Reddy PS, Katyayani R (1996) Impact of heavy metal exposure on the nervous system and endocrinemediated processes in Crustaceans. Zool Stud 35:1–8 Jiang SH, PSh Wang, Wu YB (2007) Survey of status of contamination of food with cadmium in Shantou City in 2004–2006. China Trop Med 7:1012–1014 Kagi JHR, Schaffer A (1988) Biochemistry of metallothionein. Biochemistry 27:8509–8515. doi:10.1021/bi00423a001 Lerch K, Ammer D, Olafson RW (1982) Crab metallothionein. Primary structures of metallothioneins 1 and 2. J Biol Chem 257:2420–2426 Li B, Fu X, Liu QC, Chen YY (2002) Cloning and comparison of four metallothionein cDNAs in crabs from different habitats. Chin J Appl Environ Biol 8:627–631

753 Li B, Savva D (2000) Cloning of metallotionein cDNAs and its gene in shore crab (Carcinus maenas). Acta Biochem Biophys Sin 32:640–644 Ma WL, Wang L, He YJ, Yan T (2008) Tissue-specific cadmium and metallothionein levels in freshwater crab Sinopotamon henanense during acute exposure to waterborne cadmium. Environ Toxicol 23(3):393–400. doi:10.1002/tox.20339 Mao XW, Li YY, Lin XH (2007) Investigation on pollutant of aquatic products in Guangzhou City. Chin J Health Lab Technol 17:2288–2290 Otvos JD, Olafson RW, Armitage IM (1982) Structure of an invertebrate metallothionein from Scylla serrata. J Biol Chem 257:2427–2431 ChCh Pat, Carmen KM, Felice WY (2004) Common carp metallothionein–1 gene: cDNA cloning, gene structure and expression studies. Biochim Biophys Acta 1676:162–171 Pedersen SN, Lundebye AK, Depledge MH (1997) Field application of metallothionein and stress protein biomakers in the shore crab (Carcinus maenas) exposed to trace metals. Aquat Toxicol 37:183–200. doi:10.1016/S0166-445X(96)00816-8 Pedersen KL, Pedersen SN, Hojrup P (1994) Purification and characterization of a cadmium-induced metallothionein from the shore crab Carcinus maenas. Biochem J 297:609–614 Pedersen SN, Pedersen KL, Hojrup PH, Michael HD (1996) Primary structures of decapod crustacean metallothioneins with special emphasis on freshwater and semi-terrestrial species. Biochem J 319:999–1003 Ponzano E, Dondero F, Bouquegneau JM (2001) Purification and biochemical characterization of a cadmium metallothionein from the digestive gland of the Antarctic scallop Adamussium colbecki (Smith, 1902). Polar Biol 24(3):147–153. doi:10.1007/ s003000000186 Roesijadi G (1992) Metallothionein in metal regulation and toxicity in aquatic animals. Aquat Toxicol 22:81–114. doi:10.1016/0166445X(92)90026-J Roesijadi G, Robinson WE (1994) Metal regulation in aquatic animals: mechanisms of uptake, accumulation, and release. Aquatic toxicology: molecular. biochemical and cellular perspective. Lewis Publishers, Boca Raton, FL, pp 387–419 Savvau D, Li B (2000) Characterisation of two metallothionein cDNAs from the shore crab for use as biomarkers of heavy metal pollution. Ecotoxicology 8:485–493. doi:10.1023/A:1008920 206323 Syring RA, Brouwer TH, Brouwer M (2000) Cloning and sequencing of cDNAs encoding for a novel copper-specific metallothionein and two cadmium-inducible metallothioneins from the blue crab Callinectes sapidus. Comp. Biochem Physiol C 125:325–332 Vasa´k M, Hasler DW (2000) Metallothioneins: new functional and structural insights. Curr Opin Chem Biol 4:177–183. doi: 10.1016/S1367-5931(00)00082-X ZhT Wang, Wang MQ, Han HW (2004) Survey on the cadmium levels in fish, crustaceans and bivalve mollusks in China of 2002. J Hygiene Res 33:473–474 Wu SM, Hwang PP (2003) Copper or cadmium pretreatment increases the protection against cadmium toxicity in tilapia larvae (Oreochromis mossambicus). Zool Stud 42:179–185 YZh Zhang, Wang GJ (2004) Evaluation of heavy metals in aquatic product in the market of major cities in Zhejiang province. Trace Elem Sci 11:58–61

123