International Journal of Angiology 12:103–110 (2003) DOI: 10.1007/s00547-003-0957-7

Relationship of Matrix Metalloproteinases 2 and 9 in the Wall of Abdominal Aortic Aneurysms Kengo Nishimura, M.D.,1 Masahiko Ikebuchi, M.D.,1 Nobuyuki Tamai, M.D.,1 Munehiro Saiki, M.D.,1 Tohru Hiroe, M.D.,1 Maromi Tachibana, M.D.,1 Yasushi Kanaoka, M.D.,1 Shigetsugu Ohgi, M.D., F.I.C.A.,1 1 Etsuko Ueta, M.D.,2 Toshiyuki Yamamoto, M.D.,2 Eiji Nanba, M.D.2 1

Second Department of Surgery, Faculty of Medicine, Tottori University, and 2Gene Research Center, Tottori University, Yonago, Japan

Abstract. This study examines the pathogenesis of abdominal aortic aneurysms (AAAs) with respect to pathological characteristics and expressions of matrix metalloproteinases (MMP)-2, MMP-9 and tissue inhibitor of metalloproteinases (TIMP)-1, in Tottori University Hospital, Japan. Thirty-four consecutive patients were operated on for (AAAs). During surgery, the anterior wall of the aneurysmal aorta was resected from the site of maximal diameter throughout the wall. AAA specimens consisted of the aneurysmal aortas, while control specimens consisted of the undulated aortas of autopsy cases. The expression of MMP-2, MMP-9 and TIMP-1 was evaluated by immunohistochemistry, Western blotting and competitive polymerase chain reaction (C-PCR). Immunohistochemistry showed MMP-2-positive cells and TIMP-1 positive cells mainly in the intima, and MMP-9-positive cells in the intima and adventitia. Western blotting revealed the expression of MMPs and TIMP-l variably in all the cases examined. C-PCR showed significantly higher elevation of MMP-2 mRNA in the small-diameter AAAs (30–45 mm), plus higher MMP-9 mRNA expression in both the small-diameter and the mediumlarge-diameter AAAs (45 < mm), than in controls. The ratio of MMP-2 to TIMP-1 mRNA levels in the small-diameter AAAs, and the ratio of MMP-9 to TIMP-1 mRNA levels in both the small-diameter and medium-large-diameter AAAs were significantly higher than in controls. The mRNA levels were significantly correlated between MMP-2 and MMP-9, between MMP-2 and TIMP-1, and between MMP-9 and TIMP1 in the AAAs. This study demonstrates that increases in mRNA imbalanced expression of MMPs/TIMP, as

Correspondence to: Shigetsugu Ohgi, M.D., F.I.C.A., Second Department of Surgery, Faculty of Medicine, Tottori University, 36-1 Nishichyo, Yonago 683-8504, Japan

well as increases of MMP-2 and MMP-9 expression, may play crucial roles in the development and growth of AAAs, and TIMP-1 may play an important rule of preventing the aortic expansion.

Introduction The pathologic feature of aortic aneurysm is considered to be the remodeling of the aortic wall, involving fragmentation and decrease of elastic fibers in the tunica media [2,8]. Matrix metalloproteinases (MMPs) have been implicated in collagen and elastin degeneration within the aortic wall, especially elastin, which results in abdominal aortic aneurysm (AAA) [2,4–7,10–14,16–18]. MMP-2 and MMP-9 are two of the elastolytic MMPs implicated in AAA [15]. On the other hand, activity of the MMPs is inhibited by binding to a member of the family of proteins known as tissue inhibitor of metalloproteinases (TIMP) [6]. TIMP-1 blocks MMP activity and prevents elastin depletion, aneurysm formation and rupture [1,3]. It is important to examine the entire wall as a functioning organ using molecular-biological techniques, to compare the pathological changes of the individual layers, including the intima, tunica media and adventitia. AAAs might result from impairment of the mechanism of regulatory feedback by MMPs and TIMPs. A comparative analysis of anatomic changes and tissue metabolism in the small-diameter AAAs without obvious structural destruction may provide a clue to the pathogenesis [14]. The purpose of this study was to examine the characteristics of elastin in human aortic wall during the process of expansion of aortic diameter with respect to the expression of MMP-2, MMP-9 and TIMP-1.

104

K. Nishimura et al.: Relationship of MMP-2 and MMP-9 in AAAs

Table 1. Patient characteristics Variable

AAA

Small AAA

Medium–large AAA

Control

P value

Total patient number Male/female Age (range) Diameter (mm) History of smoking COPD Hypertension Diabetes mellitus Hyperlipidemia IHD ASO Cerebrovascular disease Malignant tumor

34 33/1 73.2 (7.4) (55–87) 53.7 (11.1) (30–80) 27 (79.4%) 12 (35.3%) 21 (61.8%) 6 (17.7%) 9 (26.5%) 15 (44.1%) 7 (20.6%) 5 (14.7%) 5 (14.7%)

8 7/1 68.9 (6.6) (55–77) 41.3 (5.0) (30–45) 7 (87.5%) 1 (12.5%) 6 (75.0%) 2 (25.0%) 4 (50.0%) 1 (12.5%) 2 (25.0%) 2 (25.0%) 3 (37.5%)

26 26/0 74.5 (7.3) (62–87) 57.6 (9.1) (46–80) 20 (76.9%) 11 (42.3%) 15 (57.7%) 4 (15.4%) 5 (19.2%) 14 (53.8%) 5 (19.2%) 3 (11.5%) 2 (7.7%)

11 7/4 66.1 (14.1) (47–92) 20.42 (2.4) (17–25) 7 (63.6%) 1 (9.1%) 2 (18.2%) 5 (45.5%) 2 (18.2%) 0 (0%) 1 (9.1%) 3 (273%) 8 (72.7%)

NS <0.01 NS NS NS NS NS <0.05 NS NS <0.01

11 Mean ± SD, AAA = abdominal aortic aneurysm, small AAA = 30–45 mm, large AAA = >45 mm, COPD = chronic obstructive pulmonary disease, IHD = ischemic heart disease, ASO = arteriosclerosis obliterans.

Materials and Methods Materials After approval by the Ethics Committee of Tottori University Faculty of Medicine, surgical specimens of the aortic wall were collected from the patients with AAA after obtaining informed consent. The all patients had undergone elective excision with graft replacement between November 1998 and March 2000. During surgery, the anterior wall of aneurysmal aorta was resected from the site of maximal diameter throughout the wall. AAA specimens consisted of the aneurysmal aortas, while control specimens consisted of the undilated aortas of autopsy cases within 3 hours since death. Immediately after resection, part of each specimen was fixed in 10% neutral buffered formalin for 48 hours, and the rest was frozen in liquid nitrogen and stored at )80
C. Table 1 lists clinicopathological profiles of the AAA patients and the controls.

Measurement of Aortic Diameter and Staging of AAA During surgery, the maximal diameter of the aorta distal to the renal artery was measured directly, using the divider. In this study, an aorta with a diameter more than 30 mm was defined as an AAA. An aorta with a diameter between 30 mm and 45 mm was defined as a smalldiameter AAA, and that with a diameter over 45 mm as a mediumlarge-diameter AAA.

Histopathologic Analysis Three-micron-thick sections were cut from paraffin-embedded human AAA walls. The sections were stained with hematoxylin-eosin staining and elastica van Gieson (EVG). For the localization of MMP-2, MMP-9 and TIMP-1, the standard streptavidin-biotin-peroxidase complex method (SAB method) was used for immunohistochemical staining. As the first antibody, purified mouse monoclonal anti-human MMP-2 antibody (diluted 1:200), purified mouse monoclonal antihuman MMP-9 antibody (diluted 1:400), purified mouse monoclonal anti-human TIMP-1 antibody (diluted 1:200) (Fuji Chemical Inc., Takaoka, Japan), and purified mouse monoclonal anti-human HAM56 antibody (DAKO, Carpentaria, CA) were used. The antihuman HAM56 antibody is used to stain macrophage. As the second antibody and enzyme reagents, a Histofine SAB-PO(R) kit (Nichirei, Tokyo, Japan) was used. Endogenous peroxidase activity was blocked with methanol containing 0.3% hydrogen peroxide at room temperature for 30 minutes. For the retrieval of the antigens, all slides were placed in 10 mM citrate buffer (pH 6.0) and heated at 94
C for 15 minutes in a microwave oven. Nonspecific staining was prevented by treatment with phosphate-buffered saline (FBS) containing 2% fetal calf serum. The sections were treated with diaminobezidine (DAB) for

color development, and counterstained with 3% methyl green. The degree of tissue staining was judged under a light microscope at 4 · 3.3 magnification for EVG staining and at 20 · 5 magnification for immunohistochemical staining, and then the expression was analyzed.

Western blotting Frozen specimens of human AAA walls or autopsied abdominal aortic walls were homogenized in a homogenizer, and the homogenate was dissolved in lysis buffer containing 0.1% NP-40. The solution was centrifuged in an ultracentrifuge at 15,000 rpm for 10 minutes, and the supernatant was used as a test sample. The concentration of protein 2 was measured using a Protein Assay Kit (Bio-Rad, Hercules, CA). Test samples of the same protein content (375 lg) were electrophoresed on a 5% sodium dodecyl-sulfate-polyacrylamide (SDS-PAGE) gel at a constant voltage of 150 V, and the proteins were transferred onto a nitrocellulose membrane at 80 V for 150 minutes. Markers (Bio-Rad Labs Richmond, CA) were dissolved in a Coomassie brilliant blue solution and used for electrophoresis. After blocking nonspecific reaction with 10% skim milk in PBS, the membrane was reacted at 4
C overnight with one of the following first antibodies: purified mouse monoclonal anti-human MMP-2 antibody (diluted 1:50), purified mouse monoclonal anti-human MMP-9 (diluted 1:50), and purified mouse monoclonal anti-human TIMP-1 (diluted 1:50) (Fuji Chemical Inc). Subsequently, the membrane was reacted with purified goat polyclonal peroxidase-conjugated anti-mouse IgG antibody (diluted 1:1,000) as the second antibody at room temperature for 1 hour. The membrane was washed with PBS, and treated with enhanced chemiluminescence (ECL) Western blotting solution. The ECL of protein bands was detected by exposing of X-ray film to the membrane, and the expression of MMP-2, MMP-9, TIMP-1 proteins was evaluated.

Competitive polymerase chain reaction (C-PCR) Total RNA was isolated with guanidium isothiocyanate followed by ultracentrifugation in CaCl. Total RNA was further treated with RNase-free DNase I (Nippon gene, Tokyo, Japan). Reverse transcription of 1.5 lg total RNA was performed to synthesize the cDNA 3 using 500 lg/ml Random Hexamer (Promega, Madison, WI), 2 ll of 200 units/ll reverse transcriptase (RT) (Gibco BRL Products, Life 4 Technologies, Rockville). Control reactions omitting the RT (RT negative) were set up for each RNA sample. The primers of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), MMP-2, MMP-9 and TIMP-1 were designed based on Tamarina’s report [16] using the Genetyx-Mac Macintosh software (Software Development Co Ltd, Tokyo, Japan) (Table 2). We designed the external standard DNA (ESDNA) for each studied gene that lacked from 10 base pairs (bp) to 20 bp so that the ESDNA differed in size from the specimen cDNA (SCDNA) obtained by the previous method

K. Nishimura et al.: Relationship of MMP-2 and MMP-9 in AAAs

105

Table 2. Primers used for competitive PCR Gene

PCR

Length (bp)

Primer

SP

398

ESP

379

SP

172

ESP

162

SP

279

ESP

267

SP

216

ESP

205

50 30 50 30 50 30 50 30 50 30 50 30 50 30 50 30

MMP-2

MMP-9

TIMP-1

GAPDH

= CAGGCTCTTCTCCTTTCACAAC = AAGCCACGGCTTGGTTTTCCTC = ACTCCAGACCCCTGGCTTTT = CCAGGGGTCTGGAGTTGTCCCACTGCCCTGTGCCA = TGGGCTACGTGACCTATGACAT = GCCCAGCCCACCTCCACTCCTC = AAGGAGCCAGTTTGCCGGAT = GCAAACTGGCTCCTTGGTCCCAGTGGGGATTTACA = GGGGCTTCACCAAGACCTACAC = AAGAAAGATGGGAGTGGGAACA = TCTGAAAAGGGCTTCCAGTC = GAAGCCCTTTTCAGACTGGTCCGTCCACAAGCAAT =TGCCTCCTGCACCACCAACTGC = ATGACCTTGCCCACAGCCTT = TGGAAGGACTCATGACCACA = TCATGAGTCCTTCCATTGTCATGGATGACCTTGGC

bp = base pair, SP = specimen primer, ESP = external standard primer, MMP = matrix metalloproteinase, PCR = polymerase polymerase chain reaction, TIMP = tissue inhibitor of metalloproteinase, GAPDH = glyceraldehyde-3-phosphate dehydrogenase.

Fig. 1. (A). Polymerase chain reaction (PCR) products were detected with a ALF red DNA Sequencer, as the reverse primer was fluorescently labeled with Cy5. The peaks were detected and analyzed with Allele Links software. (B). The SCDNA template in each starting cDNA sample was equimolar to the ESDNA when that ESDNA area/SCDNA area was equal to 1.

[9]. The identity of the SCDNA and ESDNA was verified by DNA sequence analysis using ABI310 (Applied Biosystems, Tokyo, Japan). The PCR reaction mixture (12 ll final volume) contained 0.64 ll of each cDNA, 0.5 units Taq polymerase (Gene Amp Taq Gold, Perkin 5 Elmer, Branchburg, NJ), 12 pmol of forward primer, 6 pmol of reverse primer conjugated with Cy5 (Amersham Pharmacia Biotech, Buckinghamshire, England) and 6 pmol of reverse primer. For each sample, 4 or 5 equal aliquots were prepared with dilution series of the ESDNA, and the PCR mixture was spiked into these aliquots. Amplification was performed in the thermal cycler (Labosystems Japan Co, Tokyo, Japan) for 35 cycles (denaturation at 95
C for 1 minute, annealing for 1 minute ([at 55
C for GAPDH, MMP-9 and TIMP-1; 60
C for MMP2], and extension at 72
C for 1 minute). After competitive PCR was completed, the products corresponding to the SCDNA and the ESDNA were electrophoresed on a 6% polyacrylamide and 6 M urea gel on the sequencer (Amersham Pharmacia

Biotech). The peaks were detected and analyzed with the Allele Links software (Amersham Pharmacia Biotech). The specific SCDNA template in each starting cDNA sample was equimolar to ESDNA when that ESDNA area/SCDNA area was equal to 1 (Figure 1). The RNA amount is presented as a percentage of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Statistical analysis 6 Using StatView J-5.0 PPC (SAS Institute Inc, NJ) software, the difference between two groups was tested by the Mann-Whitney U test. Differences among multiple groups were tested by the Kruskal-Wallis test, and the groups with significant difference were tested by the Tukey test (nonparametric test). The correlation between two groups was

106

K. Nishimura et al.: Relationship of MMP-2 and MMP-9 in AAAs

Fig. 2. Tissue sections taken from the abdominal aorta of autopsy case (a), the maximal diameter of a small-diameter abdominal aortic aneurysm (AAA) (b) and the maximal diameter of a medium-large-diameter AAA (c) were stained with Elastica van Gieson (EVG). The degree of the EVG was judged under a light microscope at a 4 · 3.3 magnification.

tested with Spearman’s correlation coefficient by rank. A value of P < 0.05 was considered significant.

Results Staging of AAA The 34 patients with AAA (30 mm) consisted of 33 men and one woman. The mean age was 73.2 (SD 7.4) years, and the mean diameter of aneurysms was 53.7 (11.1) mm. Eight patients had small-diameter AAA (30–45 mm), had a mean age of 68.9 (6.6) years and showed mean diameter of 41.3 (5.0) mm. Twenty six patients had medium-largediameter AAA (>45 mm) and their mean age was 74.5 (7.3) years and mean diameter was 57.6 (9.1) mm. The control group of 11 cases consisted of 7 men and 4 women. The mean age was 66.1 (14.1) years and the mean aortic diameter was 20.4 (2.4) mm. There were no significant differences among the 3 groups (smalldiameter AAA, medium-large-diameter AAA, and control) in clinicopathological profiles, except for aortic diameter, history of ischemic heart disease and malignant disease (Table 1). Histopathologic findings Medial elastic fibers in both small-diameter AAAs and medium-large-diameter AAAs were markedly fragmented or lost. The walls of medium-large-diameter AAAs showed marked thickening of the adventitia compared with the walls of small-diameter AAAs. In contrast, medial elastic fibers were preserved in the aortic walls of autopsy cases (Figure 2) [14]. Immunohistochemistry revealed that intracytoplasmic cells positive for MMP-2, MMP-9 and TIMP-1 were noted in macrophages and lymphocytes as well as vascular smooth muscle cells. MMP-2-positive cells were present in the intimal plaques and thickened intimas in the AAA walls (Figure 3a, b). TIMP-1-positive cells were noted in the intimal plaques (Figure 3c, d). MMP-9-positive cells

were present in the outer layer of the tunica media, adventitia and intimal plaques in the AAA walls (Figure 3e, f). HAM56-positive cells were seen in similar locations to MMP-9-positive cells in the AAA walls (Figure 3g, h). A few cells positive for MMP-2, MMP-9 and TIMP-1 were also demonstrated in autopsy aortic walls. Western blotting Protein could be obtained from a total of nine cases, three each from the three groups. MMP-2, MMP-9 and TIMP-1 were variably expressed as shown in Figure 4. Of these, obviously higher expression of MMP-2 was noted in the three small AAAs. Higher expression of TIMP-1 was noted in two of the small AAAs. On the other hand, MMP-9 showed lower expression in all the small AAAs, two of the medium-large AAAs and one of the control specimens examined. Competitive PCR Figure 5 shows the expression ratios of MMP-2, MMP9 and TIMP-1 to internal control GAPDH. Table 3 summarizes the mean expression ratios of MMP-2, MMP-9 and TIMP-1 in the three groups. MMP-2 expression ratio was highest in the small AAAs, the value being significantly higher than that of the 11 controls (P < 0.05). MMP-9 expression ratio was higher in the small AAAs and medium-large AAAs than in the controls (both P < 0.05). On the other hand, there was no significant difference among the three groups on the TIMP-1 expression ratio, although the expression ratio tended to be higher in the small AAAs. Overall, highest expression was noted in MMP-2, followed by TIMP-1 and MMP-9, in the order given. The medium-large AAAs were divided into two subgroups; medium-type with < 65 mm and large-type with  65 mm diameter. The mean expression ratio of MMP9 was 0.112 (SD 0.268) in the 22 medium-type AAAs and 0.007 (0.007) in the four large-type AAAs, the value

K. Nishimura et al.: Relationship of MMP-2 and MMP-9 in AAAs

107

Fig. 3. AAA tissue shows a positive immunoreaction for MMP-2 (a, b), TIMP-1 (c, d), MMP-9 (e, f) and HAM56 (g, h). The degree of the immunohistochemical staining was judged under a light microscope at a 4 · 5 magnification (a, c, e, g) and at a 20 · 5 magnification (b, d, f, h).

being higher in the former than in the latter without significant difference. The mean expression ratios of MMP-2 and TIMP-1 were 0.148 (0.368) and 0.236 (0.402) in the medium-type and 0.281 (0.419) and 0.096 (0.167) in the large-type, respectively. There was no statistical difference. The ratio of MMP-2 to TIMP-1 mRNA levels was significantly higher in the small-diameter AAAs than in controls (P < 0.05). This ratio of MMP-9 to TIMP-1 mRNA levels was significantly higher in both the smalldiameter and medium-large-diameter AAAs than in controls (both P < 0.05) (Table 3). Table 4 shows the results of Spearman’s coefficient by rank to examine the relationship of the expression

among MMP-2, MMP-9 and TIMP-1. The expression levels of MMP-9 and MMP-2 significantly correlated in the all AAAs (P < 0.05), but not in the small AAAs, medium-large AAAs and controls. Moreover, the expression levels of MMP-2 and TIMP-1 significantly correlated in a similar fashion (P < 0.05). The expression levels of MMP-9 and TIMP-1 significantly correlated in a similar fashion (P < 0.01). Discussion MMP-2 and MMP-9 were increased at both the mRNA and the protein level in aneurysms, and that there was a

108

K. Nishimura et al.: Relationship of MMP-2 and MMP-9 in AAAs

Fig. 4. Western blot analysis for the expression of MMP-2, MMP-9 and TIMP-1 in small-diameter AAAs (lane 1-3), medium-large-diameter AAAs (lane 4-6), and control specimens (lane 7-9): n = 3 per group.

Fig. 5. Scatter diagrams show the expression of MMP-2, MMP-9 and TIMP-1 mRNA in small AAAs (n = 8), medium-large AAAs (n = 26) and control specimens (n = 1). The RNA amount is presented as a percentage of GAPDH.

positive correlation between mRNA and protein production, which was confirmed in the present study [6]. Recently gene therapy is paid attention to for many diseases as a new treatment, which may indicate the correlation between gene and protein. Therefore, we consider that the synthesis of mRNA carrying genetic information on MMPs and TIMPs reflects the production of the proteins. As demonstrated by our results, statistically significant elevation of the MMP-2 mRNA, as well as protein levels, was seen in small AAAs compared to controls, suggesting the involvement of MMP-2 in the growth of AAAs. Similar results were reported by Freestone et al., who observed particularly elevated production of MMP-2 protein in small AAA (4.0–5.5 cm) [7]. Our studies also indicated that MMP-2 may play an important role in the development and growth, i.e., early stages of aneurysmal disease. The expression of MMP-9 was significantly higher in both small and medium-large AAAs than controls. When the medium-large AAAs were divided into two subgroups by size, the expression of MMP-9 mRNA was higher than in the medium AAAs than in the large AAAs, though the difference was not significant This is partially consistent with the report by McMillan et al. who found MMP-9 mRNA expression was significantly

higher in medium AAA (5.0–6.9 cm) than either a small (3.0–4.9 cm) or large AAA (>7.0 cm) [12]. Immunohistochemistry confirmed a diffuse distribution of MMP-9-positive cells in the entire aneurysmal wall, in contrast to mainly intimal localization of MMP-2- and TIMP-1-positive cells. In spite of the expression ratio of MMP-9 being lower than that of MMP-2, the results indicated that MMP-9 might influence the disorder of elastin metabolism and participate in the growth stage of AAAs, as suggested by McMillan et al. [12]. The ratio of MMP-2 to TIMP-1 mRNA level was significantly increased in small AAAs compared with controls, and the ratio of MMP-9 to TIMP-1 mRNA level was significantly increased in both small AAAs and medium-large AAAs compared with controls. TIMP-1 has been shown to inhibit the activity of MMPs and to prevent the degeneration of elastic fibers, as well as development and rupture of AAAs [1,3]. Considering that medial elastic fibers in AAAs were markedly fragmented or lost compared with controls, the mRNA imbalanced expression of MMP-2/TIMP-1 and MMP-9/TIMP-1 might play an important rule of the fragmented elastin in AAAs. The increases in mRNA imbalanced expression of MMPs/TIMP-1, as well as increases of MMP-2 and MMP-9 expression, might influence medial elastic degeneration, which characterizes AAAs.

K. Nishimura et al.: Relationship of MMP-2 and MMP-9 in AAAs

109

Table 3. mRNA expression of MMP-2, MMP-9, TIMP-1 in small AAAs, medium-large AAAs and controls

Controls Small AAAs Medium-large AAAs

Controls Small AAAs Medium-large AAAs

MMP-2

MMP-9

TIMP-1

0.02 (0.03) * 2.72 (5.64) 0.17 (0.37)

0.001 (0.002) * * 0.03 (0.03)  0.10 (0.25)

MMP-2/TIMP-1

MMP-9/TIMP-1

1.99 (7.28) * 822 (2452) 1.95 (5.15)

0.11 (0.19) * * 0.54 (1.31) 0.28 (0.62)



0.01 (0.03) 0.49 (0.85) 0.21 (0.37)



12 mean ± SD; mRNA = messenger RNA, AAA = abdominal aortic aneurysm, MMP = matrix metalloproteinase, TIMP = tissue inhibitor of metalloproteinase. *P > 0.05 Table 4. Correlation of MMP-2, MMP-9 and TIMP-1 in small AAAs, medium-large AAAs, total AAAs and controls

MMP-2 and MMP-9 MMP-2 and TIMP-1 MMP-9 and TIMP-1

Small AAA

Medium-large AAA

AAA

Control

0.14 (7) 0.32 (7) 0.74 (8)

0.38 (22) 0.42 (22) 0.39 (23)

0.38 (29)* 0.37 (29)* 0.47 (31)**

0.06 (10) 0.39 (10) 0.52 (11)

AAA = abdominal aortic anenrysm, MMP = matrix metalloproteinase, TIMP = tissue inhibitor of metalloproteinase. *P < 0.05, **P < 0.01, Speanman’s correlation coefficient by rank. () indicates number of patients.

The correlation between MMP-2 and MMP-9 is unknown. We previously reported that the expression levels of MMP-2 and MMP-9 significantly correlated in all the AAAs and the medium-large AAAs, but not in the small AAAs and controls [14]. However we examined more specimens of AAAs, it is of interest that MMP-2 and MMP-9 expression well correlated in all the AAAs, but not in controls. Moreover, correlation coefficient of between MMP-2 and MMP-9 in AAAs is higher than that in controls. Simultaneous expression of MMP-2 and MMP-9 could imply that the gene expression might be regulated by the aneurysmal stroma or cell-stromal interaction in the remodeled aneurysmal wall in the development and growth of AAAs. MMP-2 and MMP-9 might act cooperatively and play a crucial role in the AAAs. In the present study, TIMP-1 expression significantly correlated with MMP-9 and MMP-2 in all the AAAs, but not in controls. This may be consist with the report that TIMP-1 has been shown to inhibit the activity of MMPs and to prevent the degeneration of elastic fibers, as well as development and rupture of AAAs [1,3]. TIMP-1 might play an important rule of preventing the aortic expansion.

Conclusion This study demonstrates that increases in mRNAimbalanced expression of MMPs/TIMP, as well as increases of MMP-2 and! MMP-9 expression, may play crucial roles in the development and growth of AAAs, and TIMP-1 may play an important rule of preventing the aortic expansion. Acknowledgements. We are grateful to Professor Hisao Ito, First Department of Pathology, and Professor Tadashi Terada, Second De-

partment of Pathology, Faculty of Medicine, Tottori University for their helpful advice and suggestions. We are grateful to Associate Professor Hitoshi Ohshiro, Department of Public Health, Faculty of Medicine, Tottori University for his helpful statistical advice. We are grateful to Ami Inata, Kaori Adachi and Makiko Tamura, Gene Research Center, Tottori University for their technical help.

References 1. Allaire E, Forough R, Clowes M, Starcher B, Clowes AW (1998) Local overexpression of TIMP-1 prevents aortic aneurysm degeneration and rupture in a rat model. J Clin Invest 102:1413– 1420. 2. Baxter BT, McGee GS, Shively VP, Drummoud IA, Dixit SN, Yamauchi M, Pearce WH (1992) Elastin content, cross-links, and mRNA in normal and aneurysmal human aorta. J Vasc Surg 16:192–200. 3. Birkedal-Hansen H, Moore WGI, Bodden MK, Windsor LJ, Birkedal-Hansen B, Decarlo A, Enqler JA (1993) Matrix metalloproteinases: a review. Crit Rev Oral Biol Med 4:197–250. 4. Campa JS, Greenhalgh RM, Powell JT (1987) Elastin degeneration in abdominal aortic aneurysms. Atherosclerosis 65:13–21. 5. Davis V, Persidskaia R, Baca-Regen L, Itoh Y, Nagase H, Persidsky Y, Ghorpada A, Baxter BT (1998) Matrix metalloproteinase-2 production and its binding to the matrix are increased in abdominal aortic aneurysms. Arterioscler Thromb Vasc Biol 18:1625–1633. 6. Elmore JR, Keister BF, Franklin DP, Youkey JR, Carey DJ (1998) Expression of metalloproteinases and TIMP in human abdominal aortic aneurysms. Ann Vasc Surg 12:221–228. 7. Freestone T, Turner RJ, Coady A, Higman DJ, Greenhalgh RM, Powell JT (1995) Inflammation and matrix metalloproteinases in the enlarging abdominal aortic aneurysm. Arterioscler Thromb Vasc Biol 15:1145–1151. 8. Gandhi RH, Irizarry E, Cantor JO, Keller S, Nackman GB, 7 Halpern VJ, Newman KM, Tilson MD (1994) Analysis of elastin cross-linking and the connective tissue matrix of abdominal aortic aneurysms. Surgery 115:617–620. 9. Ho SN, Hunt HD, Horton RM (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59.

110 10. McMillan WD, Patterson BK, Keen RR, Shively VP, Cipollone M, Pearce WH (1995) In situ localization and questification of mRNA for 92-kD type IV collagenase and its inhibitor in aneurysmal, occlusive, and normal aorta. Arterioscler Thromb Vasc Biol 15:1139–1144. 11. McMillan WD, Patterson BK, Keen RR, Pearce WH (1995) In situ localization and quantification of seventy-two kilodalton type IV collagenase in aneurysmal, occulusive and normal aorta. J Vasc Surg 22:295–305. 12. McMillan WD, Tamarina NA, Cipollone M, Johnson DA, Parker 8 MA, Pearce WH (1997) Size matters: the relationship between MMP-9 expression and aortic diameter. Circulation 96:2228– 2232 13. Newman KM, Jean-Claude J, Li H, Scholes JV, Ogata Y, Nagase 9 H, Tilson MD (1994) Cellular localization of metalloproteinases in the abdominal aortic aneurysm wall. J Vasc Surg 20:814–820.

K. Nishimura et al.: Relationship of MMP-2 and MMP-9 in AAAs 14. Nishimura K, Ohgi S, Nanba E (2001) Expression of MMP-2, MMP-9 and TIMP-1 in the wall of abdominal aortic aneurysms. Yonago Acta Medica 44:25–35. 15. Senior RM, Griffin GL, Hiszar CJ, Shapiro SD, Goldberg GI, Welgus HG (1991) Human 92- and 72-kilodalton type IV collagenases are elastases. J Biol Chem 266:7870–7875. 16. Tamarina NA, McMillan WD, Shively VP, Pearce WH (1997) Expression of metalloproteinases and their inhibitors in aneurysms and normal aorta. Surgery 122:264–272. 17. Thompson RW, Holmes DR, Mertens RA, Liao S, Botney MD, Mecham RP, Welqus HG, Parks WC (1995) Production and localization of 92-kilodalton gelatinase in abdominal aortic aneurysms: an elastolytic metalloproteinase expressed by aneurysminfiltrating macrophages. J Clin Invest 96:318–326. 10 18. Tilson MD (1988) Histochemistry of aortic elastin in patient with non-specific aortic aneurysmal disease. Arch Surg 123:503–505.