Tumor Biol. DOI 10.1007/s13277-015-3771-x

ORIGINAL ARTICLE

Serine-arginine protein kinase 1 is associated with hepatocellular carcinoma progression and poor patient survival Jing Zhang 1 & Hua Jiang 1 & Wenfei Xia 4 & Yizhou Jiang 1 & Xiaoyun Tan 1 & Peiying Liu 1 & Hongyun Jia 2 & Xuewei Yang 3 & Gang Shen 1

Received: 27 April 2015 / Accepted: 7 July 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015

Abstract The pre-mRNA splicing regulator serine-arginine protein kinase 1 (SRPK1) promotes cancer development and various pathophysiological processes. However, the clinical relevance of SRPK1 in hepatocellular carcinoma (HCC) is not clear. This study investigates the expression and prognostic value of SRPK1 in HCC. We found that SRPK1 expression was significantly upregulated at the mRNA and protein level in all HCC cell lines or HCC tissue samples compared with the hepatic cell line or matched noncancerous tissue samples, respectively. Higher SRPK1 expression significantly correlated with clinical staging (p=0.031), survival time (p=0.004), and gender (p=0.011) of HCC patients. Together, our study showed that SRPK1 is overexpressed in HCC and may be a promising indicator of prognosis for HCC patients. Keywords SRPK1 . Hepatocellular carcinoma . Prognosis

Background The number of cellular proteins produced far exceeds the number of genes within the human genome, and while this protein diversification may be complex, it is intricately regulated to maintain homeostasis. One such regulatory mechanism is the alternative splicing of pre-messenger RNA (mRNA), where the exons of a transcript are differentially spliced together creating a variety of mature mRNAs that encode different proteins [1]. Serine-arginine protein kinase 1 (SRPK1) is a protein kinase specific for serine-arginine (SR) proteins, which facilitate the process of pre-messenger RNA (mRNA) splicing [2]. Aberrant SRPK1 expression is associated with numerous pathophysiological processes and malignant phenotypes of various cancers. For example, SRPK1 is highly expressed in testis, breast cancer, pancreatic cancer,

Jing Zhang, Hua Jiang and Wenfei Xia contributed equally to this work. * Gang Shen [email protected] Jing Zhang [email protected]

Xuewei Yang [email protected]

1

Department of Interventional Radiology and Vascular Anomalies, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, 9th Jinsui Road, Postal Code 510000, Guangzhou, Guangdong 510623, People’s Republic of China

2

Department of Clinical Examination, The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong 510260, People’s Republic of China

3

Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong 510260, People’s Republic of China

4

Department of General Surgery, Tongji Hospital, Tongji Medical College of Huazhong University of Science and Technology, Wuhan, Hubei, China

Hua Jiang [email protected] Wenfei Xia [email protected] Yizhou Jiang [email protected] Xiaoyun Tan [email protected] Peiying Liu [email protected] Hongyun Jia [email protected]

Tumor Biol.

and gliomas [3–5]. In addition, SRPK1 overexpression promotes chemoresistance in HT29 colon cancer cells, ovarian cancer, and gliomas [5–7]. Nowak and colleagues reported that inhibition of SRPK1/2 reduced the phosphorylation of ASF/SF2 in epithelial cells and reduced angiogenesis, which suggests that inhibition of SRPK1 may be a therapeutic strategy to prevent angiogenesis [5, 8, 9]. While the above reports suggest that SRPK1 may play a role in cancer progression, the clinical relevance and prognostic value of SRPK1 expression is largely unknown. Hepatocellular cancer (HCC) is most common in South Eastern Asia and sub-Saharan Africa and accounts for approximately 6 % of all newly diagnosed cancers worldwide, making it the fifth most common cancer and the third leading cause of cancer mortality [10–12]. While several etiologies of HCC include aflatoxin B, alcohol consumption, smoking, and genetic diseases, chronic infection of hepatitis B virus (HBV) or hepatitis C virus (HCV) is the leading cause [11, 13]. Despite advances in surgical procedures and management technologies, HCC patient prognosis remains unsatisfactory and the 5-year survival rate after curative resection is only 35– 43 % [14, 15]. Patients with the same clinical stage of HCC have variable survival rates, indicating that the TNM staging system is not an adequate prognostic indicator [16, 17]. Therefore, it is of great importance to identify effective prognostic biomarkers and therapeutic targets for HCC. This study demonstrates that SRPK1 is highly expressed in HCC cell lines and cancerous tissues. Furthermore, upregulated SRPK1 expression was significantly associated with aggressive features of HCC, suggesting that SRPK1 may be a useful prognostic indicator for patients with HCC.

Materials and methods Cell lines HCC cell lines (MHCC97H, PLC, SMMC7721, Huh7, QGY7703, HepG2, M3, QGY7701, and M6) and one normal hepatic cell line Lo2 were purchased from the ATCC Cell Biology Collection and were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA) supplemented with 10 % fetal bovine serum (FBS; HyClone, Logan, UT, USA) and 1 % penicillin-streptomycin (Invitrogen, Grand Island, NY, USA) at 37 °C with 5 % CO2. Tissue specimens and patient information Paraffin-embedded HCC tissue samples from 146 HCC patients and had been clinically and histologically diagnosed at Guangzhou Women and Children’s Medical Center, Guangzhou Medical University between 2007 and 2009. For the use of clinical materials for research purposes, prior patient

consents and approval were obtained from the Guangzhou Women and Children’s Medical Center, Guangzhou Medical University. This cohort of patients with HCC included 132 (90.4 %) men and 14 (9.6 %) women. The median age of the cohort was 51 years (range 30–70 years). The follow-up time of the cohort ranged from 1 to 75 months, with a median follow-up time of 18 months. The clinicopathological information is summarized in Table 1. Eight pairs of HCC tissue samples from Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, were frozen and stored in liquid nitrogen for future use. Tumor stages were defined according to the 2002 American Joint Committee on Cancer (AJCC) TNM staging system. HBV infection was diagnosed when HBV surface antigen (HBsAg) was detected by ELISA in the serum. RNA extraction and real-time PCR Total RNA from cell lines and eight paired fresh tissue samples was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. The Table 1

Clinicopathological characteristics of clinical HCC samples

Characteristics

Number of cases (%)

Age (years) ≤51 >51 Gender Male Female

132(90.4) 14(9.6)

TNM classification I II

48(32.9) 26(17.8)

71(48.6) 75(51.4)

III IV HBsAg Positive

50(34.2) 22(15.1)

Negative Vital status (at follow-up) Alive Dead Expression of SRPK1 Low expression High expression AFP >400 μg/L ≤400 μg/L Tumor size >3 cm ≤3 cm

27(18.5)

119(81.5)

43(29.5) 103(70.5) 68(46.6) 78(53.4) 40(27.4) 106(72.6) 119(81.5) 27(18.5)

Tumor Biol.

extracted RNA was pretreated with RNase-free DNase, and 2 μg RNA from each sample was used for complementary DNA (cDNA) synthesis primed with random hexamers. For PCR-mediated amplification of SRPK1 cDNA, an initial amplification using SRPK1-specific primers was carried out with a denaturation step at 95 °C for 10 min, then 30 cycles of denaturation at 95 °C for 60 s, followed by primer annealing at 55 °C for 30 s, and primer extension at 72 °C for 30 s. A final extension at 72 °C for 5 min after completion of the cycling steps was carried out before the reaction was stopped and the products stored at 4 °C. Real-time PCR was then employed to determine the fold increases of SRPK1 mRNA in HCC cell lines relative to normal liver cell line and levels of SRPK1 in each of the primary HCC tumors were compared to the matched noncancerous liver tissue sample from the same patient. Reverse transcription-PCR and real-time PCR primers were designed using the Primer Express v 2.0 software (Applied Biosystems). The sequences of the real-time PCR primers were as follows: SRPK1 forward CCAGAATCTCCTCTTCCTGC and reverse CAAGAAGGACAAAGCCCAAA; GAPDH forward GACTCATGACCACGTCCATGC and reverse AGAGGCAGGGATGATGTTCTG. Expression data were normalized to the geometric mean of the expression of GAPDH and calculated as 2−[(Ct of SRPK1)-(Ct of GAPDH)], where Ct represents the threshold cycle for each transcript. All experiments were performed in triplicate [18]. Western blotting Cells were washed twice with phosphate-buffered saline (PBS), lysed on ice with radioimmune-precipitation assay buffer (RIPA; Cell Signaling Technology, Danvers, MA) containing a complete protease inhibitor cocktail (Roche Applied Sciences, Mannheim, Germany), then heated for 5 min at 100 °C. Fresh tissue samples were ground to powder in liquid nitrogen and lysed with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer. Briefly, equal amounts of protein (30 μg) were separated by electrophoresis on a 10.5 % sodium dodecyl sulfate polyacrylamide gel and transferred to polyvinylidene fluoride (PVDF) membranes (Immobilon P, Millipore, Bedford, MA). Followed by blocking with 5 % milk solution in Tris-buffered saline with Tween-20 (TBST) for 1 h, the membranes were incubated with primary antibody using anti-SRPK1 antibody (1:1000, Abcam, ab58002) overnight at 4 °C, and α-tubulin mouse monoclonal antibody (1:1000, Santa Cruz Biotechnology) was used as an internal loading control. After three washes with TBST, the membranes were incubated with secondary antibodies against rabbit immunoglobulin G or mouse immunoglobulin G. SRPK1 expression was then examined using the enhanced chemiluminescence detection system (Amersham Biosciences Europe, Freiberg, Germany) according to the manufacturer’s instructions.

IHC analysis Immunohistochemistry (IHC) analysis was performed to test SRPK1 expression in HCC patient tissues. Briefly, paraffinembedded specimens were cut into 4-μm sections and baked at 60 °C for 2 h, then deparaffinized with xylene and rehydrated. Then, antigenic retrieval was done by submerging the sections into EDTA antigenic retrieval buffer and microwaving. Following, the sections were treated with 3 % hydrogen peroxide in methanol to quench the endogenous peroxidase activity, followed by incubating with 1 % bovine serum albumin to block the nonspecific binding. Tissue sections were incubated with anti-SRPK1 antibody (1:500, Abcam, ab58002) overnight at 4 °C. For negative controls, the anti-SRPK1 antibody was replaced with normal goat serum. After washing, the tissue sections were treated with biotinylated anti-rabbit secondary antibody (Abcam), followed by a further incubation with streptavidin-horseradish peroxidase complex (Abcam). The tissue sections were immersed in 3-amino-9-ethyl carbazole, counterstained with 10 % Mayer’s hematoxylin, and then dehydrated and mounted in Crystal Mount. The tissue sections were reviewed and scored independently by two pathologists, based on both the proportion of positively stained tumor cells and the intensity of staining. The proportion of tumor cells was scored as follows: 0 (no positive tumor cells), 1 (<10 % positive tumor cells), 2 (10– 50 % positive tumor cells), 3 (50–75 % positive tumor cells), and 4 (>75 % positive tumor cells). The intensity of staining was graded as following: 0 (no staining); 1 (weak staining, light yellow), 2 (moderate staining, yellow brown), and 3 (strong staining, brown). The staining index (SI) was calculated as the product of the staining intensity score and the proportion of positive tumor cells score. Cutoff values for SRPK1 protein expression were chosen on the basis of a measure of heterogeneity with the log-rank test statistical analysis with respect to overall survival (OS). An optimal cutoff value was identified: a SI score of more than or equal to 6 was used to define tumors as high SRPK1 expression and a score less than 6 indicating low expression of SRPK1. Cutoff values were determined on the basis of a measure of heterogeneity using the log-rank test with respect to overall survival. Statistical analysis All statistical analyses were carried out using the SPSS 16.0 statistical software package (SPSS, Chicago). The correlation between SRPK1 expression and the clinicop at h ol og i c al c ha r a c t er i s t i cs w er e a na l y ze d w i t h Spearman’s correlation test. The chi-squared test was applied to analyze the relationship between SRPK1 expression and clinicopathological features. Bivariate correlations between study variables were calculated using Spearman’s rank correlation coefficients. Survival curves

Tumor Biol.

multivariate Cox regression analyses. All reported p values are two-sided. A p value <0.05 was considered statistically significant in all cases.

Results SRPK1 is upregulated in HCC

Fig. 1 SRPK1 expression in HCC cell lines. a Expression of SRPK1 mRNA in Lo2 and the following HCC cell lines: MHCC97H, PLC, SMMC7721, Huh7, HepG2, M3, QGY7701, M6. b SRPK1 protein expression in Lo2 and the following HCC cell lines: MHCC97H, PLC, SMMC7721, Huh7, HepG2, M3, QGY7701, and M6. Expression levels were normalized to α-tubulin and GAPDH, respectively. Columns and bars represent the mean and SD from three parallel experiments, respectively. *p<0.05

were plotted using the Kaplan-Meier method and compared using the log-rank test. The significance of various variables for survival was evaluated using univariate and Fig. 2 Elevated SRPK1 expression in primary HCC tissue samples compared with matched adjacent noncancerous hepatic tissue samples. a Expression of SRPK1 mRNA in primary HCC tumors (T) and adjacent noncancerous tissues (ANT) from the same patient. GAPDH was used as loading control. b Western blot analysis of SRPK1 protein expression in HCC tumors and adjacent noncancerous tissues from the same patient

To investigate SRPK1 expression in HCC, mRNA and protein expression levels were examined by real-time PCR and Western blot, respectively. Real-time PCR revealed that SRPK1 is highly expressed in all HCC cell lines tested (MHCC97H, PLC, SMMC7721, Huh7, HepG2, M3, QGY7701, and M6) compared with the hepatic cell line Lo2 (Fig. 1a). The fold increase in expression ranged from 1.8 to 7.6. In parallel with mRNA transcript levels, there was an increase in SRPK1 protein expression as detected by Western blot (Fig. 1b). Taken together, SRPK1 expression is overexpressed in HCC cell lines compared with a noncarcinoma hepatic cell line at the protein and mRNA transcript level. To confirm the expression of SRPK1 in HCC, we performed Western blotting and real-time PCR analysis of four pair-matched HCC tissue samples and adjacent noncancerous clinical samples. In the cancerous tissue samples, SRPK1 mRNA expression was upregulated compared with noncancerous tissues from the same patient (Fig. 2a). In parallel, the protein expression of SRPK1 in all primary HCC tissues was higher than matched noncancerous samples (Fig. 2b). Therefore, the expression of SRPK1 is induced in HCC cell lines and clinical HCC samples.

Tumor Biol.

SRPK1 protein is highly expressed in archived HCC samples and correlates with clinicopathological parameters To investigate the significance of SRPK1 in HCC and determine if SRPK1 expression correlates with the clinicopathological features of HCC, immunohistochemistry staining was performed on five normal hepatic samples and a cohort of 146 patient samples including 48 (32.9 %) cases of stage I, 26 (17.8 %) cases of stage II, 50 (34.2 %) cases of stage III, and 22 (15.1 %) cases of stage IV tumor samples. In the cohort, 81.5 % of the patients had HBV infection. High SRPK1 expression was found in 78 (53.4 %) patients compared with low expression in 68 (46.6 %) patients (Table 1). While SRPK1 was marginally detected in normal hepatic samples and mainly localized in the cytoplasm, we found that it was highly expressed in all clinical stage samples (Fig. 3). Further analysis demonstrated that SRPK1 expression was significantly correlated with gender (p=0.011), clinical stage (p=0.031), and vital status (p=0.004), but not significantly related to age (p=0.192), tumor size (p=0.059), HBsAg (p= 0.271), or alpha fetoprotein (AFP) (p=0.610) (Table 2). Spearman analysis demonstrated that SRPK1 expression was associated with survival time (R=−0.274, p=0.001), vital status (R=0.232, p=0.005), TNM stage (R=0.818, p<0.001), tumor size (R=0.292, p<0.001), and gender (R=0.343, p<0.001) (Table 3). These results demonstrate that SRPK1 expression is correlated with HCC pathology and suggest that SRPK1 plays an important role in the progression of disease.

High expression of SRPK1 is associated with poor HCC patient prognosis To identify prognostic factors for HCC, univariate and multivariate Cox regression analyses were performed. In the univariate analysis, the following variables showed significant prognostic value for HCC patients: high SRPK1 expression, clinical stage, tumor size, and serum AFP level (>400 μg/L). Moreover, these variables were included in multivariate analysis, which demonstrated that high SRPK1

Table 2 Correlation between SRPK1 expression and patient characteristics Characteristics

Total SRPK1 Low High expression expression

Age (year)

≤51 >51

Gender

Male Female TNM stage I II III

Chi-squared test p Value

71 75

37 31

34 44

0.192

132 14 48 26

66 2 24 15

66 12 24 11

0.011 0.031

50

25

25

IV Tumor size >3 cm ≤3 cm

22 119 27

4 51 17

18 68 10

HBsAg

119 27

58 10

61 17

0.271

40 106 43 103

20 48 28 40

20 58 15 63

0.610

Positive Negative

>400 μg/L ≤400 μg/L Vital status Alive Dead AFP

0.059

0.004

expression, clinical stage, tumor size, and serum AFP level are independent predictive factors for HCC patients (Table 4). Kaplan-Meier analysis and log-rank test were also applied to confirm the prognostic value of SRPK1 protein expression for patients with HCC. Patients with higher SRPK1 expression exhibited substantially shorter survival times than those with lower expression (Fig. 4a, p=0.001). The 5-year survival rate for patients with low and high SRPK1 expression were 41.2 % (95 % confidence interval 29.4–53.0 %) and 19.2 % (95 % confidence interval 10.4– 28.0 %), respectively. The prognostic value of SRPK1 expression was also analyzed in subgroups of HCC patients stratified by clinical stage, serum AFP levels, and tumor size. Patient outcomes significantly correlated with SRPK1 expression in subgroups with clinical stages I–II (Fig. 4b, p = 0.034) and clinical stages III–IV (Fig. 4c, p = 0.007) indicating that SRPK1 could be a prognostic factor for

Fig. 3 SRPK1 protein is highly expressed in archived, paraffin-embedded HCC tissue sections as examined by immunohistochemistry. Representative images show SRPK1 protein staining in normal liver and HCC tissues at different clinical stages

Tumor Biol. Table 3 Spearman analysis of the correlation between SRPK1 expression and clinicopathological characteristics Variables

SRPK1 expression level p Value

Spearman correlation −0.274

0.001

Vital status

0.232

0.005

AFP TNM stage

0.141 0.818

0.089 <0.001

Tumor size Gender

0.292 0.343

<0.001 <0.001

Age

0.037

0.657

Survival time

are well-recognized indicators of poor HCC prognosis [2]. Cox regression and Kaplan-Meier analyses indicate that SRPK1 expression might serve as an independent prognostic factor for HCC patients. Numerous studies demonstrate that SRPK1 overexpression plays a vital role in multiple pathophysiological processes, such as cancer. In 2011, Daniilidou and colleagues found that elevated SRPK1 serum levels act as an autoantigen in Alzheimer’s disease [20]. SRPK1 overexpression is also associated with active MAPK signaling in breast, colonic, and pancreatic cancer [4]. In addition, Qianqian Wu et al. showed evidence that knocking down SRPK1 drastically inhibited the invasion, migration, and induced cisplatin resistance in glioma cells, indicating that SRPK1 plays an important role in glioma progression [5]. Small interfering RNA–mediated knockdown of SRPK1 in pancreatic cancer cells decreased proliferative capacity and increased apoptotic potential, suggesting that SRPK1 might represent a novel treatment strategy for pancreatic cancer [21]. There is accumulating data demonstrated that SRPK1 modulates VEGF splicing in multiple diseases and tumors, including ocular angiogenesis, diabetic nephropathy, neuropathy, and Wilms tumor [22, 23]. An SRPK1-dependent VEGF isoform, VEGF165b, antagonizes VEGF165 and is a partial agonist of the VEGF receptor in vitro and in vivo, suggesting that SRPK1 regulates angiogenesis [24, 25]. This study demonstrates that high SRPK1 expression is closely associated with adverse clinicopathological features. Statistical analyses highlighted that SRPK1 is significantly correlated with poor HCC prognosis and may be an independent prognostic factor for patients. Furthermore, SRPK1 may regulate the development and progression of HCC, which is a highly vascular tumor requiring

both early and late stage HCC (Fig. 4). Similar results were obtained for patient subgroups with serum AFP levels ≤400 μg/L (Fig. 4d, p = 0.004) and tumor sizes >3 cm (Fig. 4e, p=0.006), two commonly used HCC prognostic factors. Taken together, these finding suggest that high SRPK1 expression might be a predictive indicator of HCC prognosis.

Discussion This study provides evidence that SRPK1 is highly expressed in HCC cell lines and HCC tissue samples at the transcriptional and translational levels. A cohort of 146 HCC patient tissue samples revealed that high SRPK1 expression is closely associated with patient characteristics including: gender, clinical stage, and tumor size. Male gender [19] and larger tumor size Table 4 Univariate and multivariate Cox regression analyses of various prognostic parameters in patients with liver cancer

Characteristics

Univariate analysis No. of patients

SRPK1 Low expression High expression TNM stage I II III IV Tumor size >3 cm ≤3 cm AFP >400 μg/L ≤400 μg/L

Multivariate analysis

p

Regression coefficient (SE)

p

Relative risk

95 % confidence interval

<0.00111111

0.616 (0.221)

0.005

1.852

1.202-2.854

<0.001

0.200 (0.098)

0.042

1.221

1.008-1.480

0.011

0.468 (0.321)

0.145

1.596

0.851-2.993

<0.001

0.802 (0.219))

<0.001

2.230

1.452-3.423

68 78 48 26 50 22 119 27 40 106

Tumor Biol. Fig. 4 Kaplan-Meier analysis of HCC patients with low and high SRPK1 expression. a The cumulative 5-year survival rate was drastically higher in patients with low SRPK1 protein expression. The statistical difference between SRPK1 highexpressing and low-expressing patients was compared in clinical stage I–II (b) and clinical stage III–IV (c) patient subgroups and patients with AFP serum levels ≤400 μg/L (d) or tumor sizes >3 cm (e). p Values were calculated by log-rank test

angiogenesis for progression. Since SRPK1 modulates the balance of proangiogenesis and antiangiogenesis, we speculate that SRPK1 might promote HCC progression by favoring VEGF165 splicing isoform. Therefore SRPK1 antagonists may join other antiangiogenic therapies already in clinical trials for HCC management. Moreover, while small molecule SRPK1 inhibitors have been proposed as therapeutic agents for HIV and HCV infection [26, 27], further analysis will be required to determine if they are a promising therapeutic option for HCC patients.

Conclusion This study demonstrates that SRPK1 is highly expressed in HCC and is associated with disease progression and poor patient prognosis. Univariate and multivariate Cox regression analyses revealed that SRPK1 expression might be an independent prognostic factor for HCC patients. Taken as a whole, we propose that SRPK1 may be a useful prognostic biomarker and therapeutic target for patients with HCC.

Tumor Biol. Acknowledgments This work was supported by the Science and Technology Department of Guangzhou (No. 2014 J4100063), National Science Foundation of China (No. 81101317), and Science and Technology Planning Project of Guangdong Province, China (No. 2013B021800040) Authors’ contributions GS, JZ, HJ, and WFX devised the study. JZ, HJ, YZJ, XYT, and PYL selected participants, oversaw diagnostic evaluations, and directed YJ, XJ, and PYL studies and analyses. HYJ and XWY performed the statistical analyses. GS wrote the manuscript and all authors participated in reviewing and editing the manuscript.

References 1.

2. 3.

4.

5.

6.

7.

8.

9.

10. 11.

Scott T. Eblen: Regulation of chemoresistance via alternative messenger RNA splicing. Biochem Pharmacol. 2012;8:1063–72. doi: 10.1016/j.bcp.2011.12.041. Graveley BR. Sorting out the complexity of SR protein functions. RNA. 2000;9:1197–211. Papoutsopoulou S, Nikolakaki E, Chalepakis G, Kruft V, Chevaillier P, Giannakouros T. SR protein-specific kinase 1 is highly expressed in testis and phosphorylates protamine 1. Nucleic Acids Res. 1999;27:2972–80. Hayes GM, Carrigan PE, Miller LJ. Serine-arginine protein kinase 1 overexpression is associated with tumorigenic imbalance in mitogen-activated protein kinase pathways in breast, colonic, and pancreatic carcinomas. Cancer Res. 2007;5:2072–80. Wu Q, Chang Y, Zhang L, Zhang Y, Tian T, Feng G, et al. SRPK1 dissimilarly impacts on the growth, metastasis, chemosensitivity and angiogenesis of glioma in normoxic and hypoxic conditions. J Cancer. 2013;9:727–35. doi:10.7150/jca.7576. eCollection 2013. Plasencia C, Martínez-Balibrea E, Martinez-Cardús A, Quinn DI, Abad A, Neamati N. Expression analysis of genes involved in oxaliplatin response and development of oxaliplatin-resistant HT29 colon cancer cells. Int J Oncol. 2006;1:225–35. Odunsi K, Mhawech-Fauceglia P, Andrews C, Beck A, Amuwo O, Lele S, et al. Elevated expression of the serine-arginine protein kinase 1 gene in ovarian cancer and its role in cisplatin cytotoxicity in vitro. PLoS One. 2012;7(12):e51030. doi:10.1371/journal.pone. 0051030. Nowak DG, Amin EM, Rennel ES, Hoareau-Aveilla C, Gammons M, Damodoran G, et al. Regulation of vascular endothelial growth factor (VEGF) splicing from pro-angiogenic to anti-angiogenic isoforms: a novel therapeutic strategy for angiogenesis. J Biol Chem. 2010;285(8):5532–40. doi:10.1074/jbc.M109.074930. Gammons MVR, Dick AD, Harper SJ, Bates DO. SRPK1 inhibition modulates VEGF splicing to reduce pathological neovascularization in a rat model of retinopathy of prematurity. Invest Ophthalmol Vis Sci. 2013;54:5797–806. doi:10.1167/iovs.1311634. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics. CA Cancer J Clin. 2002;2005(55):74–108. Luca Faloppi B, Mario Scartozzi A, Elena Maccaroni B, Marzia Di Pietro Paolo C, Rossana Berardi A, Michela Del Prete A, Stefano C. Evolving strategies for the treatment of hepatocellular carcinoma: from clinical-guided to molecularly-taylored therapeutic options. Cancer Treat Rev 2011;(37):169–177.

12.

Franceschi S, Raza SA. Epidemiology and prevention of hepatocellular carcinoma. Cancer Lett. 2009;286:5–8. 13. Mazzanti R, Gramantieri L, Bolondi L. Hepatocellular carcinoma: epidemiology and clinical aspects. Mol Aspects Med. 2008;29(12):130–43. 14. Lai EC, Fan ST, Lo CM, Chu KM, Liu CL, Wong J. Hepatic resection for hepatocellular carcinoma An audit of 343 patients. Ann Surg. 1995;221:291–8. 15. Ercolani G, Grazi GL, Ravaioli M, Del Gaudio M, Gardini A, Cescon M, et al. Liver resection for hepatocellular carcinoma on cirrhosis: univariate and multivariate analysis of risk factors for intrahepatic recurrence. Ann Surg. 2003;237:536–43. 16. Kinugasa H, Nouso K, Takeuchi Y, Yasunaka T, Onishi H, Nakamura S, et al. Risk factors for recurrence after transarterial chemoembolization for early-stage hepatocellular carcinoma. J Gastroenterol. 2012;47(4):421–6. doi:10.1007/s00535-011-04929. 17. Qiu J, Huang P, Liu Q, Hong J, Li B, Lu C, et al. Identification of MACC1 as a novel prognostic marker in hepatocellular carcinoma. J Transl Med. 2011;9:166. doi:10.1186/1479-5876-9-166. 18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) method. Methods. 2001;25:402–8. 19. Baig S. Gender disparity in infections of Hepatitis B virus. S J Coll Physicians Surg Pak. 2009;19(9):598–600. doi:09.2009/JCPSP. 598600. 20. Pawlik TM, Delman KA, Vauthey J-N, Nagorney DM, Ng IO, Ikai I, et al. Tumor Size Predicts Vascular Invasion and Histologic Grade: Implications for Selection of Surgical Treatment for Hepatocellular Carcinoma. Liver Transpl. 2005;9:1086–92. 21. Hayes GM, Carrigan PE, Beck AM, Miller LJ. Targeting the RNA splicing machinery as a novel treatment strategy for pancreatic carcinoma. Cancer Res. 2006;7:3819–27. 22. Oltean S, Gammons M, Hulse R, Hamdollah-Zadeh M, Mavrou A, Donaldson L, et al. SRPK1 inhibition in vivo: modulation of VEGF splicing and potential treatment for multiple diseases. Biochem Soc Trans. 2012;40(4):831–5. doi:10.1042/BST20120051. 23. Amin EM, Oltean S, Hua J, Gammons MV, Hamdollah-Zadeh M, Welsh GI, et al. WT1 mutants reveal SRPK1 to be a downstream angiogenesis target by altering VEGF splicing. Cancer Cell. 2011;20(6):768–80. doi:10.1016/j.ccr.2011.10.016. 24. Bates DO, Cui TG, Doughty JM, Winkler M, Sugiono M, Shields JD, et al. VEGF165b, an inhibitory splice variant of vascular endothelial growth factor, is down-regulated in renal cell carcinoma. Cancer Res. 2002;14:4123–31. 25. Qiu Y, Hoareau-Aveilla C, Oltean S, Harper SJ, Bates DO. The antiangiogenic isoforms of VEGF in health and disease. Biochem Soc Trans. 2009;37:1207–13. doi:10.1042/BST0371207. 26. Fukuhara T, Hosoya T, Shimizu S, Sumi K, Oshiro T, Yoshinaka Y, et al. Utilization of host SR protein kinases and RNA-splicing machinery during viral replication. Proc Natl Acad Sci U S A. 2006;30:11329–33. 27. Karakama Y, Sakamoto N, Itsui Y, Nakagawa M, Tasaka-Fujita M, Nishimura-Sakurai Y, et al. Inhibition of hepatitis C virus replication by a specific inhibitor of serine-arginine-rich protein kinase. Antimicrob Agents Chemother. 2010;8:3179–86. doi:10.1128/ AAC.00113-10.