Biotechnol Lett (2011) 33:2469–2474 DOI 10.1007/s10529-011-0723-4
ORIGINAL RESEARCH PAPER
Synthesis of c-aminobutyric acid by expressing Lactobacillus brevis-derived glutamate decarboxylase in the Corynebacterium glutamicum strain ATCC 13032 Feng Shi • Youxin Li
Received: 27 June 2011 / Accepted: 28 July 2011 / Published online: 9 August 2011 Ó Springer Science+Business Media B.V. 2011
Abstract Purpose of work Purpose of this work is to synthesize c-aminobutyric acid by glutamate-producing species expressing Lactobacillus brevis-derived glutamate decarboxylase genes, i.e. recombinant Corynebacterium glutamicum strains, which directly convert endogenous L-glutamate precursor into c-aminobutyric acid (GABA) through single-step fermentation. To express exogenous glutamate decarboxylase (GAD) in an L-glutamate-producing strain, Lactobacillus brevis Lb85, which can produce GABA, was used. Two Lb85 GAD genes, gadB1 and gadB2, and the ancillary genes, gadC-gadB2 and gadR-gadCgadB2, were cloned separately into pDXW-8 and transformed into C. glutamicum. All four recombinant strains produced GABA whereas the wild-type strain
did not. GABA produced by the recombinant strains continually increased after 36 h of fermentation. Although the mRNA levels of LbgadB2 and LbgadC were similar among the corresponding recombinants, GABA production of pDXW-8/gadRCB2 at 72 h (2.15 g/l) was higher than that of pDXW-8/gadCB2 (1.25 g/l) and pDXW-8/gadB2 (0.88 g/l). Thus, by introducing Lbgad genes, C. glutamicum was genetically engineered to synthesize GABA using endogenous L-glutamate. Keywords Corynebacterium glutamicum c-aminobutyric acid Glutamate decarboxylase Lactobacillus brevis
Introduction Electronic supplementary material The online version of this article (doi:10.1007/s10529-011-0723-4) contains supplementary material, which is available to authorized users. F. Shi (&) Y. Li State Key Laboratory of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi 214122, China e-mail:
[email protected] Y. Li e-mail:
[email protected] F. Shi Y. Li Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, Wuxi 214122, China
Glutamate decarboxylase (GAD) catalyses the irreversible a-decarboxylation of L-glutamate to c-aminobutyric acid (GABA). GABA is an amino acid that is not incorporated into proteins and functions as a major inhibitory neurotransmitter in animals. It has many physiological properties related to anti-anxiety and hypotension and is useful for tranquilizers, diuretics, and analgesics (Wong et al. 2003). Therefore, GABA may function as a bioactive component in the food, feed, and pharmaceutical fields. The chemical synthesis of GABA as a food additive is considered dangerous, so a safe method to produce GABA, such as microbial fermentation, is highly desirable.
123
2470
Because many lactic acid bacteria (LAB) are probiotic to humans and animals, LAB would be the most suitable microorganisms for GABA fermentation. Several GABA-producing LAB have been isolated from a variety of traditional fermented foods such as kimchee, Chinese paocai, and cheese (Park and Oh 2007; Siragusa et al. 2007). These LAB isolates belong to the Lactobacillus and Lactococcus genera and have ample GABA production capacity. Furthermore, GABA produced by LAB is acceptable for food usage. Some GAD genes FROM LAB have been sequenced. However, the GABA precursors, L-glutamate or monosodium glutamate (MSG), must be added during fermentation using these LAB species. Corynebacterium glutamicum has been used for the industrial production of amino acids, especially L-glutamate (Hermann 2003). The complete genome of C. glutamicum ATCC 13032 was sequenced by Kalinowski et al. (2003) and Ikeda & Nakagawa (2003), but neither the gene encoding GAD was identified nor was GABA production reported. Here, Lactobacillus brevis Lb85, a strain producing GABA, was isolated from pickles. Each of the GAD-encoding genes gadB1 or gadB2 was singly expressed on the pDXW-8 vector using the C. glutamicum strain ATCC 13032. Two other expression plasmids were prepared encoding either gadB2 accompanied by the upstream L-glutamate/GABA antiporter gene gadC or gadC-gadB2 along with the upstream regulator gene gadR. These four recombinant strains were allowed to ferment in flasks, and their GABA production was analysed.
Materials and methods Bacterial strains and growth conditions Plasmids and bacterial strains used are listed in Supplementary Table 1. Lactobacillus brevis Lb85 was isolated from a traditional fermented food as described by Pan et al. (2011). LABs were grown under static conditions in MRS medium at 30°C. To screen for LAB capable of synthesizing GABA, each strain was precultured stationarily in GYP medium, inoculated into GYP medium containing 10 g L-glutamate/l, and incubated at 30°C for 48 h (Ueno et al. 1997). Escherichia coli strain JM109 was used for constructing and propagating plasmids. E. coli was
123
Biotechnol Lett (2011) 33:2469–2474
grown in LB medium with or without 50 mg kanamycin/l at 37°C and shaken at 200 rpm. Corynebacterium glutamicum ATCC 13032 was used to express GAD gene of LAB. It was grown in LBG medium (LB medium supplemented with 5 g glucose/l) at 30°C and shaken at 200 rpm with 30 mg kanamycin/l if necessary. Screening and genotypic identification of LABs capable of producing GABA c-aminobutyric acid produced from fermented LAB cultures was detected initially using paper chromatography (Li et al. 2009), and confirmed using an automatic amino acid analyser. The LAB isolate capable of producing GABA was identified by 16S rRNA gene sequencing. The two universal primers AGAGTTTGATCCTGGCTCAG (forward) and ACGGCTACCTTGTTACGACTT (reverse) were used to amplify 16S rDNA. Construction of C. glutamicum strains overexpressing L. brevis GAD genes The two GAD genes (gadB1 and gadB2), gadB2 plus the upstream L-glutamate/GABA antiporter gene gadC (gadCB2), and gadCB2 plus the upstream transcriptional regulator gene gadR (gadRCB2) were amplified from genomic L. brevis Lb85 DNA. Primers were designed using the L. brevis ATCC 367 genomic sequence reported by NCBI and are listed in Supplementary Table 2. The 1,407 bp gadB1 gene was amplified using the primers LbgadB1F and LbgadB1R, which introduced NheI and HindIII restriction sites to the 50 -and 30 -termini, respectively. Similarly, gadB2 (1,440 bp) was flanked by 50 -NheI and 30 -HindIII sites, gadCB2 (3,001 bp) was flanked by 50 -XhoI and 30 -HindIII sites, and gadRCB2 (3,785 bp) was flanked by 50 -NheI and 30 -HindIII sites. These fragments were amplified using primers LbgadB2F and LbgadB2R, LbgadCB2F and LbgadB2R, and LbgadRCB2F and LbgadB2R, respectively. The amplified GAD genes were introduced into C. glutamicum ATCC 13032 on the plasmid pDXW-8. pDXW-8 is a shuttle expression vector for cloning between E. coli and Corynebacteria. The lacIPF104 fragment encoded in pDXW-8 tightly regulates expression driven by the tac promoter (Xu et al. 2010). The purified PCR product containing gadB1
Biotechnol Lett (2011) 33:2469–2474
2471
was digested with NheI and HindIII, ligated into pDXW-8 (also digested with NheI and HindIII), and transformed into competent E. coli JM109 cells yielding the recombinant E. coli strain JM109/ pDXW-8/gadB1. Similarly, gadB2, gadCB2, and gadRCB2 were ligated into pDXW-8 at NheI–HindIII, XhoI–HindIII, and NheI–HindIII sites, respectively, and transformed into JM109 yielding JM109/pDXW8/gadB2, JM109/pDXW-8/gadCB2, and JM109/ pDXW-8/gadRCB2. The plasmids pDXW-8/gadB1, pDXW-8/gadB2, pDXW-8/gadCB2, and pDXW-8/ gadRCB2 were isolated from E. coli, and transformed into electro-competent C. glutamicum (ATCC 13032) according to the protocol of Xu et al. (2010), yielding the recombinant C. glutamicum strains ATCC 13032/ pDXW-8/gadB1, ATCC 13032/pDXW-8/gadB2, AT CC 13032/pDXW-8/gadCB2, and ATCC 13032/ pDXW-8/gadRCB2, respectively. All plasmids from positive transformants were verified by restriction enzyme digestion and target gene amplification.
extracted from the harvested cells. DNA was digested with DNase I and cDNA was reverse transcribed using gadB2 or gadC gene-specific primers. Real-time PCR was carried out in an ABI StepOne real-time PCR system. Primers for detection of gadB2 were CGATC AGGAAACACAGCAG (forward) and TGGTACA GAAGGTCGCTAGG (reverse); gadC primers were CCTCGTACAAGGAAACCCAG (forward) and CTG CTAGTGCCATCATAACC (reverse). The cycling conditions for real-time PCR were: 94°C for 1 min; 40 cycles of 94°C for 10 s, 55°C for 30 s and 68°C for 15 s. The specificity of the PCR products was confirmed by melting curve analysis. Relative gene expression analysis was performed by the 2-DDCt method (Livak and Schmittgen 2001).
GABA production by C. glutamicum
Lactobacillus brevis Lb85 can produce 2.5 g GABA/l from 10 g L-glutamate/l. Genotypic identification of this strain was confirmed by 16S rDNA sequencing. A 1.5 kb fragment of 16S rDNA was amplified and sequenced (data not shown) with 99% identity to L. brevis ATCC 367 (GenBank accession no. NC_008497.1). It has been deposited into the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M 2010367.
C. glutamicum was precultured in seed medium (25 g glucose/l, 30 g corn steep liquor/l, 6 g urea/l, 1.5 g K2HPO43H2O/l, 0.4 g MgSO47H2O/l, pH 7.0–7.5) for 12 h at 30°C and shaken at 200 rpm. Two ml was then inoculated 20 ml into fermentation medium (50–160 g glucose/l, 3 g corn steep liquor/l, 4 g urea/ l, 2 g K2HPO43H2O/l, 0.8 g MgSO47H2O/l, 2 mg MnSO4/l, 2 mg FeSO4/l, pH 7.0–7.5), which was shaken at 200 rpm at 30°C for 36–72 h. After 12 h, IPTG was added to 1 lM to induce the expression of the GAD gene. During the first 36 h of fermentation, the pH was maintained at 7.0–7.5 with urea. The concentrations of L-glutamate and GABA in the fermented broth were measured using an automatic amino acid analyser. Quantification of gadB2 and gadC mRNA in recombinant C. glutamicum mRNA transcription levels of gadB2 and gadC in recombinant C. glutamicum during fermentation were determined by real-time PCR. C. glutamicum ATCC 13032/pDXW-8/gadB2, ATCC 13032/pDXW-8/gadCB2, and ATCC 13032/pDXW-8/gadRCB2 were precultured in seed medium for 12 h and then cultured in fermentation medium for 38 h. Total RNA was
Results Isolation and identification of L. brevis Lb85
Cloning the two GAD genes from L. brevis Lb85 According to the genomic sequence of L. brevis ATCC 367, the following three glutamate decarboxylase genes exist: LVIS_1847 (1,407 bp, written as gadB1 here), LVIS_0079 (1,440 bp, written as gadB2) and LVIS_2213 (1,881 bp, written as gadB3). Upstream of gadB2 is the L-glutamate/GABA antiporter gene (LVIS_0078, gadC) and the transcriptional regulator gene (LVIS_0077, gadR). Two GAD genes, gadB1 and gadB2, and gadC-gadB2 (gadCB2) and gadR-gadC-gadB2 (gadRCB2) were amplified from the genome of L. brevis Lb85. The PCR products were purified, cloned into pMD19-T, and sequenced (data in Chinese patents 201110020606.8 and 201110020575.6). The sequence identities of gadB1, gadB2, gadC, and gadR corresponded to the L. brevis ATCC 367 genes 1383/1407, 1434/1440,
123
2472
Biotechnol Lett (2011) 33:2469–2474
1492/1506, and 580/591, respectively. However, the third GAD gene, gadB3, could not be amplified from L. brevis Lb85 using the LbgadB3F and LbgadB3R primers.
Production of GABA in recombinant C. glutamicum
GABA concentration (g/l)
L-glutamate concentration (g/l)
L. brevis gadB1, gadB2, gadCB2, and gadRCB2 were introduced into the C. glutamicum clone ATCC 13032 using the plasmid pDXW-8. GABA fermentation was measured for the four recombinant C. glutamicum strains and the wild-type parental strain ATCC 13032. When the initial glucose concentration in the fermentation medium was 160 g/l, all four recombinant strains could synthesize GABA after 60 h, whereas wild-type ATCC 13032 could not. These results indicate that both LbgadB1 and LbgadB2 were expressed and exhibited glutamate
A
decarboxylase activity in ATCC 13032. GABA production in C. glutamicum clone ATCC 13032/ pDXW-8/gadB2 (0.74 g/l) was slightly higher than in ATCC 13032/pDXW-8/gadB1 (0.57 g/l), indicating that LbgadB2 had better activity than LbgadB1 in C. glutamicum. GABA production in ATCC 13032/ pDXW-8/gadCB2 (0.74 g/l) was not higher than in ATCC 13032/pDXW-8/gadB2, indicating either that LbGadC did not act as an L-glutamate/GABA antiporter in C. glutamicum or that GABA was transported out of C. glutamicum cells without LbGadC. GABA production in ATCC 13032/pDXW-8/gadRCB2 (1.45 g/l) was higher than in ATCC 13032/pDXW-8/gadB2, indicating that LbGadR could activate the LbgadCB2 operon in recombinant C. glutamicum. The amount of GABA produced at different cultivation times by three gadB2-expressing strains was measured. As shown in Fig. 1, L-glutamate was synthesized within 36 h, whereas GABA began to accumulate after 36 h and increased continuously
B
C
6
6
6
5
5
5
4
4
4
3
3
3
2
2
2
1
1
1
0
0 0
0
20
40
60
80
cultivation time (h)
20
40
60
80
0
2.5
2.5
2
2
2
1.5
1.5
1.5
1
1
1
0.5
0.5
0.5
20
40
60
cultivation time (h)
80
0 0
20
60
cultivation time (h)
Fig. 1 L-Glutamate and GABA production of recombinant C. glutamicum in fermentation medium. C. glutamicum cells were precultured in seed medium for 12 h at 30°C and shaken at 200 rpm, inoculated into fermentation medium, and cultivated at 30°C for 72 h with 200 rpm shaking. After 12 h of fermentation, IPTG was to 1 lM to induce the expression of GAD. During the first 36 h of fermentation, the pH was
123
40
20
40
60
80
cultivation time (h)
2.5
0 0
0
cultivation time (h)
80
0 0
20
40
60
80
cultivation time (h)
maintained at 7.0–7.5 with urea. The initial glucose concentrations of the fermentation medium were 50 g/l (a), 100 g/l (b) and 160 g/l (c). Closed squares, C. glutamicum ATCC 13032/pDXW-8/gadB2; closed triangles, C. glutamicum ATCC 13032/pDXW-8/gadCB2; open circles, C. glutamicum ATCC 13032/pDXW-8/gadRCB2. Each point represents the average of three independent
Biotechnol Lett (2011) 33:2469–2474
2473
thereafter. When the initial glucose concentration in the fermentation medium was 50 g/l, the rate of GABA accumulation in the gadB2-expressing strain was higher than in the gadCB2- and gadRCB2expressing strains within 60 h. After 60 h, the GABA concentration in the gadB2-expressing strain did not increase, whereas the other two strains continued to accumulate GABA. When the initial glucose concentration was increased to 100 g/l, the GABA accumulation rate of gadCB2- and gadRCB2-expressing strains improved noticeably and was much higher than that of the gadB2-expressing strain. At 72 h, the GABA production of gadCB2- and gadRCB2expressing strains increased to 1.65 ± 0.05 and 1.67 ± 0.04 g/l, respectively. When the initial glucose concentration was increased to 160 g/l, the GABA accumulation rate of the gadRCB2-expressing strain increased, while that of the gadCB2-expressing strain decreased a little, and that of the gadB2expressing strain remained low. At 72 h, the GABA production of the gadRCB2-expressing strain was 2.15 ± 0.16 g/l. These results indicate that when GABA accumulates quickly (higher than 40 mg/l h), expression of LbgadC could help transport GABA out of C. glutamicum cells. Similarly, when the initial glucose level increases to 160 g/l, the expression of LbgadR could improve GABA production in C. glutamicum, demonstrating its role as an activator for the LbgadCB operon. Transcriptional level of gadC and gadB2 in recombinant C. glutamicum In L. brevis, GadR has been proposed to be a positive transcriptional regulator of gad genes. To confirm
that LbGadR acts as a positive transcriptional regulator in recombinant C. glutamicum, the transcriptional level of gadB2 among the C. glutamicum strains ATCC 13032/pDXW-8/gadB2, ATCC 13032/pDXW-8/gadCB2, and ATCC 13032/pDXW-8/gadRCB2 were measured during fermentation. The transcriptional level of gadC was also determined for ATCC 13032/pDXW-8/gadCB2 and ATCC 13032/pDXW-8/gadRCB2. Relative mRNA levels were quantified using the 2-DDCt value from realtime PCR. The recombinant cells were harvested after 38 h of fermentation because by this time, accumulation of L-glutamate had been accomplished. Analysis of mRNA levels revealed that LbgadB2 was transcribed at nearly same level in all three recombinant C. glutamicum strains. Furthermore, the mRNA level of LbgadC was the same between the two LbgadC expressing strains (Table 1), indicating that the presence of LbgadR in C. glutamicum could not increase gadB2 and gadC transcription despite increased GABA accumulation in high glucose.
Discussion Recently, several LAB strains exhibiting high GABA production have been investigated. Some GAD genes have been cloned and sequenced from these strains, including the genes from L. brevis. However, in each of these studies, only one L. brevis gad gene has been cloned. Some strains display high identity with the 1,407 bp gadB1 gene of L. brevis clone ATCC 367, including the Lbgad of the strains OPK-3 (Park and Oh 2007), BH2 (Kim et al. 2007), and CGMCC 1306
Table 1 The expression level of gadB2 and gadC in recombinant C. glutamicum C. glutamicum strains
Gene analysed
Ct
2-DDCt
ATCC 13032/pDXW-8/gadB2
gadB2
13.46 ± 0.18
1
ATCC 13032/pDXW-8/gadCB2
gadB2
13.25 ± 0.16
1.16
ATCC 13032/pDXW-8/gadRCB2
gadB2
13.54 ± 0.12
0.95
ATCC 13032/pDXW-8/gadCB2
gadC
15.96 ± 0.14
1
ATCC 13032/pDXW-8/gadRCB2
gadC
16.36 ± 0.14
0.76
Cells were precultured in seed medium for 12 h and then cultured in fermentation medium for 38 h. Glucose in the medium was at 160 g/l. Total RNA was extracted from the harvested cells, cDNA was synthesized with gadB2 or gadC gene-specific primers, and real-time PCR was performed. The specificity of the PCR products was confirmed by melting curve analysis. Relative gene expression was determined by the 2-DDCt value. Ct is the minimum number of cycles achieved when the accumulated PCR products generate a detectable fluorescence signal. Averages of three independent experiments are provided
123
2474
(Huang et al. 2007). One strain, IFO 12005 (Hiraga et al. 2008), expresses LbgadB with high homology to the 1,440 bp gadB2 gene of ATCC 367. In this study, two GAD genes (gadB1 and gadB2) of the new L. brevis isolate Lb85 were cloned and expressed in C. glutamicum. Both genes had the capacity to convert their own accumulated L-glutamate into GABA, with the capacity of gadB2 being higher than that of gadB1. However, gadB3 could not be amplified using the primers designed from the genomic sequence of L. brevis ATCC 367. The potential absence of gadB3 in Lb85 needs further exploration. Although GABA production by some LABs is already very high, L-glutamate must be added as the precursor. C. glutamicum ATCC 13032 is a model bacterium for the production of L-glutamate, but no GABA was detected in its fermented culture. Here, by introducing the L. brevis GAD gene into C. glutamicum clone ATCC 13032, recombinants obtained the capacity to synthesize GABA (Fig. 1). Synthesis of GABA by these recombinant C. glutamicum strains did not require additional L-glutamate or MSG precursors because C. glutamicum can produce sufficient endogenous L-glutamate. Thus, the two steps of (1) L-glutamate fermentation and (2) GABA conversion were combined for a single-step GABA production strategy. This method of GABA synthesis requires only glucose as a carbon source and urea as a nitrogen source, in contrast to GABA synthesis by LAB strains or by a Bacillus subtilis strain expressing the L. brevis OPK-3 gad gene (Park and Oh 2006), which requires peptone and yeast extract nitrogen sources. In addition, C. glutamicum could be further improved to produce functional products other than amino acids. Further studies are in progress to increase the production of GABA by these recombinant C. glutamicum strains. Acknowledgments The authors thank the ‘‘Program of State Key Laboratory of Food Science and Technology (contract no. SKLF-TS-201103)’’ and the ‘‘Fundamental Research Funds for the Central Universities (contract no. JUSRP21109)’’ for financial support.
123
Biotechnol Lett (2011) 33:2469–2474
References Hermann T (2003) Industrial production of amino acids by coryneform bacteria. J Biotechnol 104:155–172 Hiraga K, Ueno Y, Oda K (2008) Glutamate decarboxylase from Lactobacillus brevis: activation by ammonium sulfate. Biosci Biotechnol Biochem 72:1299–1306 Huang J, Mei LH, Sheng Q, Yao SJ, Lin DQ (2007) Purification and characterization of glutamate decarboxylase of Lactobacillus brevis CGMCC 1306 isolated from fresh milk. Chinese J Chem Eng 15:157–161 Ikeda M, Nakagawa S (2003) The Corynebacterium glutamicum genome: features and impacts on biotechnological processes. Appl Microbiol Biotechnol 62:99–109 Kalinowski J, Bathe B, Bartels D et al (2003) The complete Corynebacterium glutamicum ATCC 13032 genome sequence and its impact on the production of L-aspartatederived amino acids and vitamins. J Biotechnol 104:5–25 Kim SH, Shin BH, Kim YH, Nam SW, Jeon SJ (2007) Cloning and expression of a full-length glutamate decarboxylase gene from Lactobacillus brevis BH2. Biotechnol Bioprocess Eng 6:707–712 Li HX, Qiu T, Cao YS, Yang JY, Huang ZB (2009) Pre-staining paper chromatography method for quantification of gammaaminobutyric acid. J Chromatogr A 1216:5057–5060 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25:402–408 Pan L, Hu XQ, Wang XY (2011) Assessment of antibiotic resistance of lactic acid bacteria in Chinese fermented food. Food Control 22:1316–1321 Park KB, Oh SH (2006) Enhancement of c-aminobutyric acid production in Chungkukjang by applying a Bacillus subtilis strain expressing glutamate decarboxylase from Lactobacillus brevis. Biotechnol Lett 28:1459–1463 Park KB, Oh SH (2007) Cloning, sequencing and expression of a novel glutamate decarboxylase gene from a newly isolated lactic acid bacterium, Lactobacillus brevis OPK-3. Bioresour Technol 98:312–319 Siragusa S, Angelis MD, Cagno RD, Rizzello CG, Coda R, Gobbetti M (2007) Synthesis of c-aminobutyric acid by lactic acid bacteria isolated from a variety of Italian cheeses. Appl Environ Microbiol 73:7283–7290 Ueno Y, Hayakawa K, Takahashi S, Oda K (1997) Purification and characterization of glutamate decarboxylase from lactobacillus brevis IFO 12005. Biosci Biotechnol Biochem 61:1168–1171 Wong CGT, Bottiglieri T, Snead OC (2003) GABA, chydroxybutyric acid, and neurological disease. Ann Neurol 54:S3–S12 Xu DQ, Tan YZ, Huan XJ, Hu XQ, Wang XY (2010) Construction of a novel shutter vector for use in Brevibecterium flavum, an industrial amino acid producer. J Microbiol Methods 80:86–92
