Mycol Progress DOI 10.1007/s11557-012-0816-z
SHORT COMMUNICATION
Systemic spread of downy mildew in basil plants and detection of the pathogen in seed and plant samples Roxana Djalali Farahani-Kofoet & Peter Römer & Rita Grosch
Received: 20 January 2012 / Revised: 14 March 2012 / Accepted: 14 March 2012 # German Mycological Society and Springer 2012
Abstract Downy mildew on sweet basil (Ocimum basilicum L.) occurs worldwide. Contaminated seeds are considered as the primary inoculum source. So far no strategy to control the disease is available. Hence, the use of pathogen-free seeds is the only alternative to prevent disease outbreaks. Therefore, a rapid diagnostic method for seed testing is urgently needed. The sensitivity of a specific PCR method for direct detection of the downy mildew pathogen Peronospora belbahrii on basil samples, particularly on seeds, was evaluated. The applied PCR method proved to be very sensitive for direct detection of the pathogen on seeds and plant samples. The PCR detection limit of P. belbahrii in artificially infested seeds corresponded to the DNA amount of a single spore per seed. Additionally, the systemic spread of the pathogen from naturally infected seeds was investigated. The experiments showed that outgrowing basil plants were latently infected with the downy mildew pathogen, and the infection continued within the plant. Contaminated seeds were harvested from symptomless latently infected plants. These results support the implementation of PCR-based detection in a seed certification scheme and the necessity to control the pathogen on seeds. The PCR method can also be used for evaluation of pathogen control on seeds based on detection of the pathogen in outgrowing plants.
R. Djalali Farahani-Kofoet : R. Grosch (*) Leibniz-Institute of Vegetable and Ornamental Crops, Theodor-Echtermeyer-Weg 1, 14979, Großbeeren, Germany e-mail:
[email protected] P. Römer GHG Saaten GmbH, Albert-Drosihn-Str. 9, 06449, Aschersleben, Germany
Keywords Latent infection . Pathogen detection . Peronospora belbahrii . Seed contamination . Specific PCR
Introduction Downy mildew has become a serious disease in sweet basil (Ocimum basilicum L.) worldwide. The sudden appearance and rapid spread of the pathogen Peronospora belbahrii throughout various herb production regions in the world is attributed to both contaminated seeds and basil cuttings (Belbahri et al. 2005; Garibaldi et al. 2004). Based on additional morphological and molecular phylogenetic investigations carried out by Thines et al. (2009) downy mildew on sweet basil is named Peronospora belbahrii. Initial symptoms on basil plants are chlorotic patches on leaves, especially near central veins. Under favourable conditions for disease development a characteristic grey to brown furry growth becomes evident on the lower epidermis of infected leaves within two to three days. In later stages of pathogenesis the foliage turns yellow and necrotic. Warm temperatures (21 to 23 °C) and high humidity, which coincide with cultivation conditions for basil favour the spreading of disease due to the airborne nature of asexually produced spores of the causal agent. Currently, no resistant basil cultivars are available, and registered fungicides for control of downy mildew on basil seeds and plants only have limited approval. In order to prevent disease outbreak, growers must continuously monitor basil crops and remove diseased plants. Hence, implementation of seed certification schemes to exclude seed batches infested with P. belbahrii from marketing would be of great value for both seed-producing companies and growers. Downy mildews are obligate biotrophic organisms that cannot be detected by in vitro cultivation, and detection by growout tests is very time-consuming. Currently, contamination of
Mycol Progress
basil seeds is verified by the wash-off method used for detection of pathogens of corn salad as described by Champion and Mécheneau (1979). This equally time-consuming method is not specific for the detection of P. belbahrii. In contrast, the classic PCR method offers rapid and specific identification of P. belbahrii in a large number of samples. However, the diagnostic method based on classic PCR should be sensitive enough to detect small amounts of pathogen in plant samples before symptoms appear, as Patzak (2005), Tsay et al. (2006), Landa et al. (2007) and Ioos et al. (2007) indicated for downy mildew on hop, tobacco, opium poppy and sunflower, respectively. Belbahri et al. (2005) have already designed a specific primer pair (Bas-F/Bas-R) based on sequences within the unique genomic ribosomal DNA (ITS1) for detecting P. belbahrii on basil with real-time PCR. The primer pair generates a single fragment of approximately 134 base pairs. The aim of our study was to evaluate the sensitivity of a classic PCR assay using this Bas primer pair for direct detection of the downy mildew pathogen on basil seed and plant samples. As the sensitivity of this method has not previously been proved, our investigations concerned the figuring out of the lowest detection threshold on seeds inoculated with spores of the pathogen. Furthermore, we concentrated our research in the systemic infection of mature plants, as we hypothesised that the downy mildew pathogen is able to grow out from infested seed and continue proliferation inside the plant tissue without the occurrence of visible symptoms.
Materials and methods Preparation of pathogen inoculum All experiments were carried out with the P. belbahrii isolate PA06 isolated from infested basil plants originated from a commercial basil nursery in Germany. On the basis of previous pathogenicity tests with various isolates in basil (cv. Bavires) the isolate PA06 was classified as highly virulent. Since the pathogen P. belbahrii (isolate PA06) is an obligate biotrophic parasite, the inoculum was produced on basil plants (cv. Bavires; GHG Saaten, Aschersleben, Germany). Six seeds were sown in each pot (Ø 9 cm) containing substrate [Fruhstorfer Einheitserde Typ P, Vechta, Germany; chemical analysis (mg per 100 g): N0 75, P075, K0125; pH 5.9] and initially cultivated under greenhouse conditions (min. 18°C and max. 23 °C) until the 4-leaf-stage. Pathogen inoculation was performed by spraying of 5 ml of a conidial suspension (105 spores ml−1) per pot. Germination of spores and infection of plants by the pathogen was induced by incubating inoculated plants at 20 °C and 100 % humidity for almost 18 h in growth
chambers (York, Mannheim, Germany). Plants were further cultivated in a 12 h/12 hday/night cycle, 500 μmol m−2 s−1, 23/18 °C and 60 %/80 % relative humidity. Nine days after pathogen inoculation, freshly developed asexual spores were washed from leaves with sterile tap water and stored at −20°C until use. PCR assay using P. belbahrii specific primers To identify P. belbahrii PA06 on artificially inoculated seeds by PCR, the specific primer set of Belbahri et al. (2005) (Bas-F: CCGTACAACCCAATAATTTGGGGGTTAAT and Bas-R TTCAATTAGCTACTTGTTCAGACAAAG) was used. The reaction mixture, total volume 20 μl, contained PCR buffer, 2 mM dNTPs (2 μl), 10 mM of each BAS primer (1 μl), 0.1 µl Taq Polymerase (Applied Biosystem, Darmstadt, Germany) and 1 μl of P. belbahrii template DNA or 1 μl of distilled water for the negative control. PCR amplification of the samples was performed in the GeneAmp®PCR-System 9700 thermal cycler (PE Biosystems, Weiterstadt, Germany) with the following cycle parameters: initial denaturation at 95 °C for 5 min, 30 cycles of denaturation at 95 °C for 30 s, annealing at 63 °C for 30 s, extension at 72 °C for 30 s and a final extension at 72 °C for 5 min. PCR products were separated by 1.5 % agarose gel electrophoresis in TBE buffer (40 mM l−1 of Tris-borat, pH 8.0, 1 mM l−1 of EDTA) at 200 V for 45 min and stained with ethidium bromide under UV light in comparison with the 1-kb Gene-RulerTM DNA ladder (Fermentas, St LeonRot, Germany) run on the same agarose gel. DNA was extracted according to the method described by Tinker et al. (1993), from both isolated spores and plant material. DNA was purified as outlined by Gebhardt et al. (1989) and stored at −20 °C until use. Direct detection of P. belbahrii PA06 on seed and plant samples The sensitiveness of classic PCR for detection of P. belbahrii PA06 on basil seeds was evaluated by treating 100 uncontaminated seeds with 100 μl of the appropriate spore suspension (106, 105, 104, 103, 102 and 10 spores ml−1) dripped onto seeds mixing vigorously in 5-ml glass tubes on a rotary shaker. Classic PCR was performed to identify PA06 in pure spore solutions and in total DNA extracted directly from 100 inoculated seeds after a harsh lysis step with Precellys 24 (Peqlab Biotechnologie GmbH, Erlangen, Germany). Experiments were carried out twice. On the basis of this method, natural contamination with P. belbahrii in three commercial basil seed batches (MT1, harvested in 2005; MT2 and MT3 harvested in 2007) was analysed. A self-produced and harvested seed batch (eiS) was included in the analysis. These seeds were harvested from infected basil
Mycol Progress
plants after 8 months of cultivation under greenhouse conditions. Plant infection was assured by inoculating basil seedlings with the pathogen as described above. After successful inoculation (establishment of the pathogen in inoculated leaves was observed by presence of sporangiophores with spores), plants were cultivated separately in a greenhouse to avoid contact. In order to inhibit further infection cycle and spread of spores, humidity in the greenhouse was held low (not favourable for spore germination and infection). Leaves were regularly scrutinised using a magnifying glass to confirm that spore production of the pathogen did not occur. The occurrence of spores in seed batches MT1 (100 oospores/100 seeds), MT2 (8 oospores /100 seeds) and MT3 (150 oospores /100 seed) was confirmed based on the washoff test by LUFA (Augustenberg, Germany). According to this method, the self-produced seed lot eiS comprised 100 oospores/100 seeds. The presence of P. belbahrii in each seed batch was tested by ten PCR replications with 100 seeds, totalling 1,000 seeds per seed batch. In order to test the specificity of the PCR protocol on naturally infested seed samples, and to ensure that generated specific fragments from these seed samples corresponded to the P. belbahrii target, two PCR products amplified from the batches MT1 were cloned according to the method described by Grosch et al. (2007) and sequenced (Eurofins MWG, Ebersberg, Germany). Viability of P. belbahrii on naturally infested seed stocks (MT1, MT2, MT3 and eiS) was evaluated by measuring disease incidence (DI) on plants derived from these stocks. A total of 100 randomly selected seeds per seed stock were sown individually in separate pots. Basil plants were cultivated for 7 weeks in a greenhouse according to usual practice. To favour disease development and pathogen sporulation, plants were incubated in the dark once a week for 18 h under plastic hoods with a relative humidity of approximately 95 %. DI was assessed weekly by visual monitoring of the plants. Plants were evaluated as diseased when typical sporangiophores almost always combined with chlorotic patches on leaves appeared. Basil plants originating from healthy and non-contaminated seeds served as controls. Additionally, latent infection in plants (outgrowing from naturally infected seed stocks MT1, MT2, MT3 and eiS) showing no visible symptoms of downy mildew was investigated at the 8-leaf-stage. Leaves and stems were scrutinised by stereo-binocular microscope to confirm that no spores of the pathogen were present on plant surfaces. Stems (including attached leaves) of five randomly selected basil plants were subdivided in internode pieces (10eldest and 40youngest internode) and stored at −20 °C until use. Total DNA of each individual internode was directly extracted and analysed by classic PCR method as described above.
Results Detection of P. belbahrii PA06 in seed and plant samples DNA fragments of the expected size of 134 bp were amplified reproducibly from pure spores of PA06 in densities ranging from 106 to 102 spores ml−1 using the Bas primer set (Bas-F/Bas-R) (Fig. 1a). A weak band was generated at the spore density of 102 spores ml−1. The detectable band generated at the spore density of 103 spores ml−1 was equivalent to 3.47 pg of genomic PA06 DNA in 1 μl of template in the PCR mixture. The specific genomic DNA fragment was generated reproducibly from artificially infested seeds up to an inoculated density of 100 spores (this corresponds with an application of 100 μl of 103 spores ml−1) per 100 seeds (Fig. 1b). Consequently, projection of the data exposed that direct extraction of DNA from infested seeds resulted in a PCR detection limit of one spore per seed. Sensitivity of the specific PCR assay was not influenced by excess DNA from basil seeds. Pathogen DNA could be detected with a high frequency in each naturally infested seed batch, but not in all ten replications. The specific PCR fragment was amplified in seven samples of both seed batches MT1 and MT2, and in nine samples of seed batch MT3 and in seven of seed batch eiS. The sequences of the amplified PCR products obtained from seed batch MT1 were completely homologous to corresponding sequences of P. belbahrii targets (Accession: HM486901.1, HM462242.1, GQ390795.1, FJ394337.1) in the NCBI GenBank database (http:// www.ncbi.nlm.nih.gov/BLAST). Disease incidence (DI) was evaluated after sowing 100 seeds randomly picked from each seed stock, MT1, MT2, MT3 and eiS. The number of plants with visible symptoms of downy mildew was quite low in each seed lot. The highest DI was noticed on plants originating from seed lot eiS, with 23 out of 100 plants showing disease symptoms. In total, 15 diseased plants were observed from seed stock MT1 and 7 from seed stock MT3, while seed stock MT2 exposed the lowest DI with 5 diseased plants. In plants grown from seed stocks MT1, MT2 and MT3, the pathogen could be detected in individual plants and in several stem sections of one plant (Fig. 2a–c). However, the specific PCR fragment was not detected in each selected plant, nor in each tested internode piece originating from one investigated plant. But interestingly, PCR product of P. belbahrii PA06 was amplified in all five plants and internode sections originating from seed batch eiS except in the 1st internode of the plant samples 4 and 5.
Mycol Progress
Fig. 1 Detection of genomic DNA of Peronospora belbahrii PA06 by classic PCR using the Bas primer pair (Bas-F/Bas-R). a DNA was extracted from 1 μl of pure spore suspensions with densities of 106, 105, 104, 103, 102 and 10 spores ml−1, corresponding the positive control for seed treatment with appropriate spore densities. b DNA
was extracted directly from 100 seeds (cv. Bavires) respectively inoculated with 100 μl of spore densities of 106, 105, 104, 103, 102 and 10 spores ml−1. C control (NaCl); PC positive control; NC negative control; M molecular weight marker (1-kb ladder)
Discussion
infection can result in contamination of basil seed. The presence of latent infection in basil plants and seeds has been assumed for a long time, particularly by growers, who tightly control the temperature and humidity in their greenhouses to avoid the onset of symptoms. Our PCR test could detect as little as 3.4 pg of P. belbahrii genomic DNA extracted from a pure spore suspension at a density of 103 spores ml−1 using 1 µl as a template. This corresponds to the DNA amount of a single spore. Ioos et al. (2007) detected a comparable amount of 3.0 pg of genomic Plasmopara halstedii DNA using PCR with a specific primer set (PHAL-F/ R PCR), and Tsay et al. (2006) obtained a detection limit of 1.0 pg of genomic P. tabacina DNA. The minimal
This study describes the use of a classic PCR assay for a rapid and direct detection of P. belbahrii DNA in basil seed and plant tissues. The high specificity of the primer set used had previously been demonstrated by Belbahri et al. (2005) by means of quantitative PCR. With the PCR protocol used in this study, it was confirmed that P. belbahrii can be detected with high sensitivity in different parts of a plant, such as seeds, leaves and stems, even if symptoms are not evident. This is the first report on indication of systemic and latent infection with downy mildew in basil plants grown out from contaminated seeds. Moreover, latent systemic Fig. 2 Detection of Peronospora belbahrii in basil plants showing no visible downy mildew symptoms. PCR amplification products obtained from single stem sections of five randomly selected plants (1–5) that grew from naturally contaminated basil seed batches MT1, MT2, MT3 and eiS (cv. Bavires). Each stem was sectioned into four internode pieces (a–c) at 8-leaf-stage. PC positive control; NC negative control; M molecular weight marker (1-kb ladder)
a
1st internode MT1/Plants 2 3 4
1
MT2/Plants MT3/Plants 1 2 3 4 5 1 2 3 4
5
5
eiS/Plants 1 2 3 4 5
PC NC
134 bp
b
2nd internode M
MT1/Plants 1 2 3 4
5
MT2/Plants 1 2 3 4 5
MT3/Plants eiS/Plants 1 2 3 4 5 1 2 3 4 5
PC NC
134 bp
c
4th internode M
MT1/Plants 1 2 3 4
MT2/Plants 5 1 2 3 4 5
MT3/Plants 1 2 3 4 5
eiS/Plants 1 2 3 4
5
NC PC
134 bp
Mycol Progress
detectable amount of 0.1 pg was attained from Plasmopara viticola based on real-time PCR (Valsesia et al. 2005). Realtime PCR as described by Belbahri et al. (2005) is also an option for improving the detection limit of the downy mildew pathogen on basil seeds and plant samples. However, this approach is more costly compared to classic PCR assay. Applying a nested PCR approach might be another possibility for improving the detection limit of P. belbahrii. Ploch and Thines (2011) detected, via nested PCR, 0.1–1 pg genomic DNA of Albugo candida and 0.5 pg DNA of Pustula tragopogonis, and 0.5 pg of DNA of the downy mildew pathogen Protobremia sphaerosperma. Detection of P. belbahrii in several commercially produced basil seed batches confirmed that the pathogen is seed-borne and infected seeds act as primary inoculum source in basil production as assumed previously (Thines et al. 2009; Belbahri et al. 2005; Garibaldi et al. 2004). Seed transmission is noted for several downy mildew pathogens such as Plasmopara halstedii in sunflower (Ioos et al. 2007), P. arborescens in opium poppy (Landa et al. 2007), Peronosclerospora sorghi in maize (Adenle and Cardwell 2000), P. viciae in pea seeds (Corbiere et al. 1995) or Hyaloperonospora brassicae s.l. in radish seeds (Jang and Safeeulla 1990). The detection threshold of P. belbahrii using classic PCR assay on inoculated basil seeds was estimated at one spore per seed (equivalent to 3 pg of genomic P. belbahrii DNA per 20 ng of genomic plant DNA). However, the amplified band generated in this treatment (inoculation of 100 seeds with 100 spores per 100 μl) was faint. According to Ioos et al. (2007), this problem can be resolved when using higher amounts of genomic DNA. Our detection limit was, considering plant background DNA, similar to the detection threshold of P. halstedii in sunflower seeds with 3 pg of pathogen DNA against 20 ng of background DNA (Ioos et al. 2007), and that of P. arborescens in opium poppy seeds with 0.1–10 pg of pathogen DNA against 10–20 ng of background DNA (Landa et al. 2007). Schearer et al. (2009) compared a wash-off test, grow-out test and specific PCR-based method for their efficacy in detecting P. valerianellae in corn salad. They noted that the PCR test was the most sensitive, detecting the pathogen below the actual detection limit of 1 % of contamination rate per seed lot. The analysis of naturally infested seed stocks indicated heterogeneous infection with P. belbahrii in basil seed samples. However, high contamination rates were determined in evaluated commercially obtained seed stocks. On average, P. belbahrii was detected in 80–90 % of randomly investigated commercial seed stock samples, independent from the harvest year. The fragment amplified from naturally infested seed samples corresponded to the targeted P. belbahrii sequence. Hence, our results confirmed the high specificity of the PCR protocol (Belbahri et al. 2005), since no crossamplification occured.
Moreover, plants cultivated from these seed stocks showed disease incidence of 5–22 %, with additional pathogen detected in plants without visible symptoms. Both observations attested the presence of downy mildew in seeds and its heterogenic distribution in seed stocks. The results of this study support the relevance of seeds as a primary inoculum source. Although disease incidence was low, there is a risk of epidemic distribution of the pathogen in glasshouses and close-packed production areas, since epidemic outbreaks can arise from single infected plants. The importance of single infected plants for epidemics was demonstrated for H. brassicae s.l. on radish by Fink and Kofoet (2005). Commercially produced basil pots contain at least 40 plants. Thus, disease development will be favoured by the microclimate dominating each pot and the high humidity in greenhouses. In addition, since disease outbreak start from seed stocks harvested in different years, it can be concluded that the pathogen is able to survive for several years on seeds. Systemic growth of P. belbahrii within plants was observed on leaves and stem sections of symptomless plants. The pathogen was detected in each stem section of plants derived from recently harvested seed stock (eiS). This further confirmed latent infection in plants originating from contaminated seeds. Additionally, the results also demonstrated that the presence of the pathogen in seed stocks cannot be evaluated solely by a “grow-out test”. Latent infection of Brassicaceae with oomycetes like Albugo on symptomless plants was confirmed by Ploch and Thines (2011). They found the pathogen was transferred vertically via endophytic mycelium to the next generation. The existence of latent infection, plus the fact that systemic spread of the pathogen in plants without visible symptoms can result in infested seeds, complicate the situation for seed producers and farmers, and underline the importance of implementing seed certification schemes. However, one should keep in mind that the presence of pathogen DNA in seeds does not implicate spontaneous disease outbreaks, as shown in the present work, since the interaction between pathogen, host and existing environmental conditions is complex. As we have shown in our work, specific fragments were amplified from DNA of the pathogen regardless of its origin (seed and plant tissue). Hence, there is no differentiation between asexually produced spores (used for inoculating seeds and plants) and durable oospores (in naturally infested seeds) and mycelium of the pathogen (e.g. in stem sections). Oospores usually occur on seeds or in plant residues which get incorporated in soil after harvest with the consequence of soil infestation (Adenle and Cardwell 2000). Currently, no information exists to consider the impact of pathogen inoculum in soil on disease incidence of downy mildew on basil, particularly because seed production happens in distant locations. To limit the spread of the pathogen by seed
Mycol Progress
shipments, it is crucial for breeders and growers to draw on an early, fast and specific detecting test. Our results demonstrated the sensitivity of the classic PCR assay for detection of P. belbahrii on basil plant and seed samples. However, the PCR test cannot assess the viability of spores, since specific fragments can also be generated from DNA material of dead spores. Nevertheless, it is a method that allows the testing of high numbers of samples within a short time and should be admitted in seed certification schemes for routine testing of seed materials in order to inhibit marketing of infested seeds. Based on its capability of detecting the pathogen in outgrowing plants, this method can also be used for evaluation of procedures to control the downy mildew pathogen on seeds. Acknowledgments The authors thank Sieglinde Widiger, Sabine Breitkopf and Mandy Heinze for valuable technical and practical assistance. We are also grateful to the colleagues of the institute who supported the horticultural work. This research was supported by the Federal Office for Agriculture and Food (BLE, Germany).
References Adenle VO, Cardwell KF (2000) Seed transmission of maize downy mildew (Peronosclerospora sorghi) in Nigeria. Plant Pathol 49:628–634 Belbahri L, Calmin G, Pawlowski J, Lefort F (2005) Phylogenetic analysis and Real Time PCR detection of a presumably undescribed Peronospora species on sweet basil and sage. Mycol Res 109:1276–1287 Champion R, Mécheneau H (1979) Méthode de détection de Peronospora valerianellae, agent du Mildiou, sur les semences de Mâche (Valerianella locusta). Comparaison en culture des résultats obtenus. Seed Sci Technol 7:259–263 Corbiere R, Molinero V, Lefebvre A, Spire D (1995) Detection of pea downy mildew (Peronospora viciae) in seed lots by ELISA. Bulletin OEPP 25:47–56 Fink M, Kofoet A (2005) A two-dimensional stochastic model of downy mildew of radish. Ecol Model 81:139–148
Garibaldi A, Minuto G, Bertetti D, Gullino ML (2004) Seed transmission of Peronospora sp. of basil. J Plant Dis Protect 111:465–469 Gebhardt C, Ritter E, Debener T, Schachtschabel U, Walkemeier B, Uhrig H, Salamini F (1989) RFLP analysis and linkage mapping in Solanum tuberosum. Theor Appl Genet 78:65–75 Grosch R, Schneider JHM, Peth A, Waschke A, Kofoet A, Franken P, Jabaji-Hare SH (2007) Development of a specific PCR assay for the detection of Rhizoctonia solani AG 1-IB using SCAR primers. J Appl Microbiol 102:806–819 Ioos R, Laugustin L, Rose S, Tourvieille J, Tourvieille de Labrouhe D (2007) Development of a PCR test to detect the downy mildew causal agent Plasmopara halstedii in sunflower seeds. Plant Pathol 56:209–218 Jang P, Safeeulla KM (1990) Modes of entry, establishment and seed transmission of Peronospora parasitica in radish. Proc Indian Acad Sci Plant Sci 100:369–373 Landa BB, Montes-Borrego M, Munoz-Ledema FJ, Jimenez-Diaz RM (2007) Phylogenetic analysis of downy mildew pathogens of opium poppy and PCR-Based in planta and seed detection of Peronospora arborescens. Phytopathology 97:1380–1390 Patzak J (2005) PCR detection of Pseudoperonospora humuli and Podosphaera macularis in Humulus lupinus. Plant Prod Sci 41:141–149 Ploch S, Thines M (2011) Obligate biotrophic pathogens of the genus Albugo are widespread as asymptomatic endophytes in natural populations of Brassicaceae. Mol Ecol 20:3692–3699 Schearer HJ, Penzkofer M, Reents H-J, Braendle F (2009) SaatgutTestmethoden für Falschen Mehltau an Feldsalat. Werte-WegeWirkungen: Biolandbau im Spannungsfeld zwischen Ernährungssicherung, Markt und Klimawandel. Beiträge zur 10. Wissenschaftstagung Ökologischer Landbau, ETH Zürich Thines M, Telle S, Ploch S, Runge F (2009) Identity of the downy mildew pathogens of basil, coleus, and sage with implications for quarantine measures. Mycol Res 113:532–540 Tinker NA, Fortin MG, Mather DE (1993) Random amplified polymorphic DNA and pedigree relationship in spring barley. Theoret Appl Genet 85:976–984 Tsay JwuGuh, Chu ChiShih, YaHan C, Chen RS (2006) Specific detection of Peronospora tabacina by PCR-amplified rDNA sequences. Plant Pathol J 5:378–382 Valsesia G, Gobbin D, Patocchi A, Vecchione A, Pertot I, Gessler C (2005) Development of a high-throughput method for quantification of Plasmopara viticola DNA in grapevine leaves by means of quantitative real-time polymerase chain reaction. Phythopathology 95:672–678
