Curr Microbiol (2011) 63:366–371 DOI 10.1007/s00284-011-9988-z

The GAL10 Gene is Located 40 kbp Away from the GAL7-GAL1 Region in the Yeast Kazachstania naganishii Chisa Sugihara • Taisuke Hisatomi Takuya Kodama • Michio Tsuboi

•

Received: 5 April 2011 / Accepted: 17 July 2011 / Published online: 7 August 2011 Ó Springer Science+Business Media, LLC 2011

Abstract Of the genes involved in galactose metabolism, GAL7, GAL10, and GAL1 are tightly linked in this order on chromosome II in Saccharomyces cerevisiae. While several species of the order Saccharomycetales have similar gene organization, Kazachstania naganishii is unique, in which GAL7 and GAL1 are close to each other whereas GAL10 is substantially apart from them on chromosome XI. In this study, we inserted the recognition sequence of I-SceI homing-endonuclease into GAL10 and also into the intervening segment of GAL7-GAL1. By cleaving chromosome DNA of the gene-manipulated strain with I-SceI, we obtained evidence that chromosome XI (610 kbp) was replaced with three fragments (305, 265, and 40 kbp). Using appropriate probes, we further found that GAL10 was about 40 kbp apart from the GAL7-GAL1 cluster and that orientation of GAL10 was reversed comparing to the S. cerevisiae counter part. We, therefore, contend that comparison of the organization of the GAL cluster among Saccharomycetales is of importance to elucidate evolution of chromosomes and that the experimental scheme developed in this study is useful for this line of investigation.

Chisa Sugihara and Taisuke Hisatomi contributed equally to this study. C. Sugihara  T. Hisatomi (&)  T. Kodama  M. Tsuboi Department of Biotechnology, Faculty of Life Sciences and Biotechnology, Fukuyama University, Gakuen-cho, Fukuyama, Hiroshima 729-0292, Japan e-mail: [email protected] M. Tsuboi Department of Welfare Science, Faculty of Welfare and Health Science, Fukuyama Heisei University, Miyuki-cho, Fukuyama, Hiroshima 720-0001, Japan

123

Introduction Almost all yeasts from the family Saccharomycetaceae assimilate and ferment galactose effectively. In Saccharomyces cerevisiae, genes controlling metabolic pathway for galactose have been well characterized. Extracellular galactose enters the cytoplasm through Gal2p, a galactosespecific membrane bound transporter, and is metabolized to glucose-6-phosphate through steps catalyzed by Gal1p (galactokinase), Gal7p (galactose-1-phosphate uridyl transferase), Gal10p (UDP-glucose 4-epimerase), and Gal5p (phosphoglucomutase). The metabolic product, glucose-6phosphate is then used as an energy source for glycolysis. Transcriptions of GAL1, GAL7, and GAL10 genes are enhanced 1000-fold by the activator Gal4p in the presence of galactose, and are repressed by Mig1p in concert with Ssn6p and Tup1p in the presence of glucose. The GAL7, GAL10, and GAL1 genes are clustered on the right arm of chromosome II, with GAL7 being proximal and GAL1 distal to the centromere. GAL10 and GAL1 are tightly linked and have their own regulatory sequences, respectively [10]. The gene order of GAL7-GAL10-GAL1 has been reported in several yeasts in the order Saccharomycetales including S. cerevisiae [3, 5-7, 11, 14, 18, 21, 22]. We found that S. naganishii, which was lately renamed as Kazachstania naganishii [15–17], had the genes corresponding to these S. cerevisiae GAL genes on chromosome XI. However, the gene order was unique in that GAL7 and GAL1 are close together whereas GAL10 is more than 10 kbp apart from them [13]. In this study, we attempted to determine precise locations and orientations of these genes in K. naganishii. In order to determine locations and orientations of GAL genes on chromosome XI of K. naganishii, recognition sites for a homing endonuclease, I-SceI, were introduced

C. Sugihara et al.: GAL Gene Locations in Yeasts

into the GAL10 gene and the GAL7-GAL1 region. Then chromosome-sized DNAs from the recombinant were digested with I-SceI, electrophoresed with CHEF, and subjected to Southern-blot hybridization using appropriate probes. Here, we present our results.

Materials and Methods Yeast Strains and Culture Conditions Since both recombinant GAL10 and GAL7-GAL1 region had to be integrated into the identical chromosome XI of K. naganishii, a heterothallic haploid strain from K. naganishii was used in this study. A yeast strain AE12-22B (MATa ura4 his5 leu2) was isolated from a heterothallic haploid strain, THE1-16C (MATa) of K. naganishii at this time. THE1-16C was isolated from a homothallic wild type strain of S. exiguus Yp74L-3 [8, 9]. Mikata et al. [17] separated the Yp74L-3 strain from S. exiguus group and designated the strain as a new species S. naganishii. Then Kurtzman [15] reclassified S. naganishii into the genus Kazachstania, resulting in K. naganishii. The collection number of the homothallic type strain from K. naganishii is CBS 8797 (IFO 10181). Another yeast strain used to prepare genomic DNAs for PCR templates is a type strain of S. cerevisiae CBS 1171 (IFO 10217). Yeasts were cultured on complete medium (YPD) plates or minimal medium (SD) plates containing appropriate nutrition at 26°C for several days [1].

Fig. 1 Structures of plasmids containing K. naganishii GAL genes interrupted with I-SceI recognition sites and selective marker genes. a A PCR product of a 50 -region from the KnGAL10 was inserted in the HindIII site on pBR322 through an In-Fusion reaction. Then a PCR product containing the ScURA3, an I-SceI recognition site, and a 30 -region from the KnGAL10 was inserted in the EcoRV site on pBR322 through an In-Fusion reaction. b A PCR product from the

367

PCR Amplification, DNA Manipulation, and Yeast Transformation Chromosomal DNAs from K. naganishii were prepared according to Amberg et al. [1] for use as PCR templates. PCR primers were designed to amplify specific regions in Fig. 1a and b, and listed in Tables 1 and 2, respectively. PCR amplifications were performed according to Kodama et al. [13] with slight modifications. PCR products were introduced into plasmids with In-Fusion Advantage PCR Cloning Kit (TaKaRa Bio, Ohtsu, Shiga, Japan) in accordance with instructions from the supplier. Yeast transformation was performed according to Amberg et al. [1] with slight modifications. Treatment with I-SceI and Pulsed-Field Gel Electrophoresis Chromosome-sized DNAs were prepared from yeast cells, and electrophoresed in agarose gels using a CHEF apparatus (CHEF-DRII system, Bio-Rad Laboratories, Richmond, CA, USA) [9]. Agarose plugs containing chromosomesized DNAs were treated in 3 ml of 1 mM phenylmethylsulfonyl fluoride (PMSF) in a 3.5 cm Petri dish at 50°C for 30 min, to inactivate proteinase K. These treatments were performed two times, and then the plugs were thoroughly washed several times to eliminate residual PMSF. Next, chromosome-sized DNAs in agarose plugs were digested with 5 units of a homing endonuclease, I-SceI (New England Biolabs, Ipswich, Massachusetts, USA) in a reaction solution of 700 ll in a 2.0 ml microtube at 37°C for 2 h.

KnGAL7 and a PCR product containing the ScHIS5 were prepared to have I-SceI recognition sequences, then introduced into the EcoRV site on pBR322 through an In-Fusion reaction, reviving an EcoRV site. Next, a PCR product from the KnGAL1 was inserted in the EcoRV site on the above plasmid. Closed arrowheads indicate positions for PCR primers (detailed in Tables 1, 2)

123

368

C. Sugihara et al.: GAL Gene Locations in Yeasts

Table 1 PCR primers used to construct a plasmid, pKnrG10 and to produce probes for three region (Fig. 1a)

Primer names

Primer sequences (50 to 30 )

K56

TATCATCGATAAGCTGGAGGAGTTGTTCAGTTACC

K57

TACCGCATTAAAGCTTCTCTCTCGTATCGTAGTCG

L23

GGCCTCTTGCGGGATTCATGGATCTGCACATGAAC

L24

GCCGACGGCTATTACCCTGTTATCCCTAGTGCAATCGTAGGACGTCAT

J2

GCCGACGGCTTAGGGATAACAGGGTAATACATCCACGTTGTCGACTTG

L5

GTCGGAATGGACGATCCTTGAAGAACACATGAACC

E9

GGAGGAGTTGTTCAGTTACC

E12

GCTTGAAGAACACATGAACC

E9

GGAGGAGTTGTTCAGTTACC

F15

ACTTACCGTCTTCGGAGTGT

F66

TAAGGAACGTGCTGCTACTC

F67

GTCAGATCCTGTAGAGACCA

J2

GCCGACGGCTTAGGGATAACAGGGTAATACATCCACGTTGTCGACTTG

E12

GCTTGAAGAACACATGAACC

Table 2 PCR primers used to construct a plasmid, pKnrG7-1 and to produce probes for three region (Fig. 1b) Primer names

Primer sequences (50 to 30 )

L10

GGCCTCTTGCGGGATGTGCTCTTCAATTGCCTGCT

L11

ACCCTGTTATCCCTAGCACTCTTCAACATGCAGTA

L12 L13

GGATAACAGGGTAATGCTGGCAATTCTTGTACTGT GGAATGGACGATATCACTGAAGATGTAGCCAATGC

L8

TACATCTTCAGTGATGGAAGTAGTCAAGATGTGCT

L9

GTCGGAATGGACGATCGTGCTTGGATCTCTGGTAT

H64

GTGCTCTTCAATTGCCTGCT

H70

CGTGCTTGGATCTCTGGTAT

This treatment was sequentially performed for 4 h. The treatment was done one more time for overnight. These samples were subjected to CHEF mentioned above. Southern-blot Hybridization DNAs separated in agarose gels were transferred to GeneScreen nylon membranes (New England Nuclear, Boston, MA, USA), and hybridized with DNA probes [19]. DNA probes labeled with Dig-dUTPs were prepared by PCR-amplifying specific regions with primers (Fig. 1a, b; Tables 1, 2) [9, 13].

Fig. 2 Integration of recombinant KnGAL10 and KnGAL7-GAL1 into the chromosome of K. naganishii. Chromosomal DNAs were extracted from AE12-22B (lane 1), an Ura? transformant (KNG10) derived from AE12-22B with a recombinant KnGAL10 fragment (a PCR product with E9 and E12 primers in Fig. 1a) (lanes 2 and 3), and a His? transformant (KNG10-71) derived from KNG10 with a recombinant KnGAL7-GAL1 fragment (a PCR product with H64 and H70 primers in Fig. 1b) (lane 4). These samples were subjected to PCR with E9 and E12 primers (lanes 1 and 2) and with H64 and H70 primers (lanes 3 and 4), and then resultant PCR products were electrophoresed in an agarose gel. Symbol M stands for a k/HindIII marker, and an origin indicates a position of wells where PCR samples were loaded

Results and Discussion Construction of Recombinant GAL Genes Containing I-SceI Recognition Sites In order to identify the locations and orientations of the GAL10 gene (KnGAL10) and the GAL7-GAL1 region

123

(KnGAL7-GAL1) on chromosome XI in K. naganishii, the 18 bp sequence (50 -TAGGGATAACAGGGTAAT-30 ), which is recognized and cleaved by a homing endonuclease, I-SceI, was introduced in each region. The KnGAL10 (Accession no. AB098559) was interrupted with an I-SceI recognition site and a selective marker

C. Sugihara et al.: GAL Gene Locations in Yeasts

gene, URA3 gene of S. cerevisiae (ScURA3) as follows (Table 1; Fig. 1a). First, a 50 -region from KnGAL10 was PCR-amplified with K56 and K57 primers, and inserted in the HindIII site of pBR322 by means of an In-Fusion reaction. Second, ScURA3 attached with an I-SceI recognition site in the 30 -end of the ScURA3, and a 30 -region of KnGAL10 attached with an I-SceI site in the 50 -end of the region were PCR-amplified with primer sets of L23-L24 and J2-L5, respectively. These fragments were digested with I-SceI, ligated with each other, and inserted into the EcoRV site of the above plasmid by means of an In-Fusion reaction. The resultant plasmid constructed above was named pKnrG10. The KnGAL7-GAL1 region (Accession no. AB098558) was interrupted with an I-SceI recognition site and a selective marker gene, HIS5 gene of S. cerevisiae (ScHIS5) as follows (Table 2; Fig. 1b). First, KnGAL7 attached with an I-SceI recognition site in the 30 -end of the region, and ScHIS5 attached with an I-SceI site in the 50 -end of the ScHIS5 were PCR-amplified with primer sets of L10-L11 and L12-L13, respectively. These fragments were inserted into the EcoRV site of pBR322 by means of an In-Fusion reaction, retaining an EcoRV site in the 30 -end of the ScHIS5. Second, KnGAL1 was PCR-amplified with L8 and L9 primers, and inserted into the EcoRV site of the above

Fig. 3 Chromosome assignments of recombinant KnGAL10 and KnGAL7-GAL1 in K. naganishii. Chromosome-sized DNAs from KNG10-71 (transformant exhibiting Ura? and His? phenotypes) were electrophoresed with a CHEF apparatus (lanes 1 and 3), and probed with ScURA3 (F66-F67 fragment in Fig. 1a; Table 1) (lane 2) and ScHIS5 (L12-L13 fragment in Fig. 1b; Table 2) (lane 4). Conditions for electrophoresis were as follows. The first run was performed at 180 V with pulse time of 60 s for 12 h. The second run was performed at 200 V with pulse time of 120 s for 12 h. The third run was performed at 200 V with pulse time of 60 s for 11 h. Other conditions were referred to Inoue et al. [9]. Hybridization signals were observed on chromosome XI of 610 kbp in K. naganishii

369

plasmid by means of an In-Fusion reaction. The resultant plasmid constructed above was named pKnrG7-1. Integration of Recombinant GAL Genes into the Chromosome of K. naganishii Through Homologous Recombination A recombinant KnGAL10 region containing an I-SceI recognition site and an ScURA3 gene was PCR-amplified with a primer set of E9 and E12 (Table 1; Fig. 1a), and introduced into the AE12-22B strain from K. naganishii. Chromosomal DNA from Ura? transformant (KNG10) was examined with PCR, using a specific primer set which amplify the recombinant GAL10 region. As a result, a PCR product of 4.7 kbp, which is longer than a PCR product of 2.7 kbp from Ura- host cells, was detected, indicating that

Fig. 4 Southern-blot hybridization analyses of fragments digested with I-SceI in K. naganishii. Chromosome-sized DNAs from KNG1071 (transformant exhibiting Ura? and His? phenotypes) were electrophoresed with a CHEF apparatus (lanes 1, 3, 5, and 7), and probed with a 50 -region and a 30 -region from KnGAL10 (probe A: E9-F15 and probe B: J2-E12, respectively in Fig. 1a; Table 1) (lanes 2 and 4, respectively) and a region from KnGAL7 and a region from KnGAL1 (probe C: L10L11 and probe D: L8-L9, respectively in Table 2; Fig. 1b) (lanes 6 and 8, respectively). Conditions for electrophoresis were as follows. The first run was performed at 200 V with pulse time of 60 s for 15 h. The second run was performed at 200 V with pulse time of 90 s for 8 h. Other conditions were referred to Inoue et al. [9].Roman numerals stand for chromosome numbers in K. naganishii. Arrowheads accompanying Arabic numerals indicate positions of hybridization signals observed, representing DNA length. Chromosome XI disappeared due to the digestion with I-SceI

123

370

C. Sugihara et al.: GAL Gene Locations in Yeasts

Next, chromosome-sized DNAs were prepared from KNG10-71 transformant and electrophoresed with a CHEF apparatus (Fig. 3, lanes 1, 3). When Southern-blots were probed with ScURA3 (F66-F67 fragment in Fig. 1a; Table 1) (Fig. 3, lane 2) and ScHIS5 (L12-L13 fragment in Fig. 1b; Table 2) (Fig. 3, lane 4), hybridization signals appeared on chromosome XI of 610 kbp from K. naganishii in both cases. These results indicated that a recombinant KnGAL10 and a recombinant KnGAL7-GAL1 were integrated into appropriate positions on chromosome XI of K. naganishii.

the recombinant KnGAL10 was integrated into the chromosome of K. naganishii (Fig. 2, lanes 1, 2). Then, a recombinant KnGAL7-GAL1 region containing an I-SceI recognition site and an ScHIS5 gene was PCRamplified with a primer set of H64 and H70 (Table 2 and Fig. 1b), and introduced into the KNG10 transformant. His? transformant (KNG10-71) represented a PCR product of 5.7 kbp, which is longer than a PCR product of 3.8 kbp from KNG10 transformant, indicating that the recombinant KnGAL7-GAL1 region was integrated into the chromosome of K. naganishii in addition to the recombinant KnGAL10 (Fig. 2, lanes 3, 4). The KNG10 and KNG10-71 transformants lost the abilities to assimilate galactose as a carbon source, indicating that the KnGAL10 gene was disrupted with the recombinant KnGAL10 fragment.

Identification of the Locations and Orientations of GAL Genes on Chromosome XI of K. naganishii Chromosome-sized DNAs were prepared from KNG10-71 transformant, which have I-SceI recognition sites in both KnGAL10 and KnGAL7-GAL1 region, and digested with a homing endonuclease, I-SceI. When these samples were subjected to pulsed-field gel electrophoresis, the band corresponding to chromosome XI (610 kbp) was not observe. Instead, three new bands (305, 265, and 40 kbp) were observed. These three bands showed positive signals by Southern-blot hybridization using probes A (305 kbp), B (40 kbp), C (40 kbp) and D (265 kbp), respectively (Fig. 4). The positions of the sequences used as the probes and the deduced organization of the GAL cluster of K. naganishii are shown in Fig. 5. In summary, it was found that

K.naganishii Chr. XI (610 kbp) GAL10

A

GAL7

B

I-SceI site

C

GAL1

D

I-SceI site

265 kbp

305 kbp 40 kbp

Fig. 5 Schematic representation of the locations and orientations of KnGAL10 and KnGAL7-GAL1 on chromosome XI of K. naganishii. A, B, C, and D indicate positions for hybridization probes shown in Fig. 1

TATA TAT A

ScGAL7

ScGAL10

ScGAL1

TATA

1 kbp

S. cerevisiae chr. II (810 kbp) 40 kbp K. naganishii chr. XI (610 kbp)

100 kbp

KnGAL10 TATA

KnGAL7

KnGAL1

TATATATA

1 kbp

Fig. 6 Comparative representation of locations and orientations of GAL1, GAL7, and GAL10 genes in S. cerevisiae and K. naganishii. These GAL genes are located on chromosome II of S. cerevisiae and on chromosome XI of K. naganishii. A small circle on chromosome II of S. cerevisiae represents the centromere II. Short portions of 30 -regions from KnGAL10, KnGAL7, and KnGAL1 have not yet been

123

sequenced, with sequenced regions of KnGAL10 (1612 bp), KnGAL7 (517 bp), and KnGAL1 (1396 bp) representing 70.4, 69.0, and 68.5% identities to the orthologs from S. cerevisiae, respectively. Small vertical arrows and small squares represent sequences resembling the consensus sequence of the Gal4p-binding site and Mig1p-binding site from S. cerevisiae, respectively

C. Sugihara et al.: GAL Gene Locations in Yeasts

KnGAL7 and KnGAL1 were tightly lined to each other and that KnGAL10 was 40 kbp apart from them. The deduced organization of the GAL cluster of K. naganishii was compared with that of S. cerevisiae (Fig. 6). It is clearly seen that the gene order is GAL7-GAL10-GAL1 in S. cerevisiae whereas it is GAL10-GAL7-GAL1 in K. naganishii. Moreover, in K. naganishii, GAL7 and GAL1 are close together while GAL10 is 40 kbp apart from them. It is also apparent that GAL10 of K. naganishii has the opposite orientation comparing to the S. cerevisiae counterpart. A simple explanation is that a segment containing GAL10 has been translocated and inverted to make the K. naganishii GAL cluster from the S. cerevisiae-type GAL cluster. Since there is no Ty element or d sequence in the regions of the K. naganishii GAL cluster and the S. cerevisiae GAL cluster, simple translocation is not likely. Nevertheless, variations of the organization of the GAL clusters between S. cerevisiae and K. naganishii draw our attention. Depending on The Yeast Gene Order Browser analysis, yeasts including an ancestor before whole genome duplication have configurations of the GAL7-GAL10-GAL1 gene clusters [2]. We now focus our attention on the organization of GAL cluster of K. sinensis, the species nearest to K. naganishii. It is also of interest to see the relationship between the K. naganishii GAL cluster and S. cerevisiae GAL cluster further. To this aim, sequencing of the full K. naganishii GAL cluster is needed. Moreover, it is of great interest to see whether K. naganishii chromosome XI and S. cerevisiae chromosome II are homeologous to each other. To test this speculation, sequencing of the entire K. naganishii chromosome XI is desired. The experimental procedure we developed in this study facilitates these lines of study and helps elucidation of evolution of chromosomes within Saccharomycetales and evolution of species among Saccharomycetales [4, 5, 12, 20, 23, 24]. Acknowledgments The authors are very grateful to Mr. Y. Igari, Mr. H. Satoh, Mr. K. Kosaka, and Miss R. Nagai for their faithful assistances. This study was supported by Grant no. 12640688 to T. Hisatomi from the Japanese Ministry of Education, Science, and Sports.

References 1. Amberg DC, Burke DJ, Strathern JN (2005) Methods in yeast genetics: a Cold Spring Harbor laboratory course manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2. Byrne KP, Wolfe KH (2005) The yeast gene order browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15:1456–1461 3. Citron BA, Donelson JE (1984) Sequence of the Saccharomyces GAL region and its transcription in vivo. J Bacteriol 158:269–278 4. Conant GC, Wolfe KH (2008) Probabilistic cross-species inference of orthologous genomic regions created by whole-genome duplication in yeast. Genetics 179:1681–1692

371 5. Fischer G, James SA, Roberts IN, Oliver SG, Louis EJ (2000) Chromosomal evolution in Saccharomyces. Nature 405:451–454 6. Hittinger CT, Gonc¸alves P, Sampaio JP, Dover J, Johnston M, Rokas A (2010) Remarkably ancient balanced polymorphisms in a multi-locus gene network. Nature 464:54–58 7. Hittinger CT, Rokas A, Carroll SB (2004) Parallel inactivation of multiple GAL pathway genes and ecological diversification in yeasts. Proc Natl Acad Sci USA 101:14144–14149 8. Hisatomi T, Yanagishima N, Banno I (1986) Induction of heterothallic strains and their genetic and physiological characterization in a homothallic strain of the yeast Saccharomyces exiguus. Curr Genet 10:887–892 9. Inoue K, Kajihara H, Umemura T, Hisatomi T, Tsuboi M (1993) Physical characterization of the chromosomal DNA of the yeast Saccharomyces exiguus. Plant Cell Physiol 34:997–1001 10. Johnston M, Carlson M (1992) Regulation of carbon and phosphate utilization. In: Jones EW, Pringle JR, Broach J (eds) The Molecular and cellular biology of the yeast Saccharomyces: gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 193–281 11. Kellis M, Patterson N, Endrizzi M, Birren B, Lander ES (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423:241–254 12. Keogh RS, Seoighe C, Wolfe KH (1998) Evolution of gene order and chromosome number in Saccharomyces, Kluyveromyces and related fungi. Yeast 14:443–457 13. Kodama T, Hisatomi T, Kakiuchi M, Aya R, Yoshida K, Bando Y, Takami T, Tsuboi M (2003) Unique distribution of GAL genes on chromosome XI in the yeast Saccharomyces naganishii. Curr Microbiol 47:497–500 14. Slot JC, Rokas A (2010) Multiple GAL pathway gene clusters evolved independently and by different mechanisms in fungi. Proc Natl Acad Sci USA 107:10136–10141 15. Kurtzman CP (2003) Phylogenetic circumscription of Saccharomyces, Kluyveromyces and other member of the Saccharomycetaceae, and the proposal of the new genera Lachancea, Nakaseomyces, Naumovia, Vanderwaltozyma and Zygotorulaspora. FEMS Yeast Res 4:233–245 16. Kurtzman CP, Robnett CJ (2003) Phylogenetic relationship among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res 3:417–432 17. Mikata K, Ueda-Nishimura K, Hisatomi T (2001) Three new species of Saccharomyces sensu lato van der Walt from Yaku Island in Japan: Saccharomyces naganishii sp nov., Saccharomyces humaticus sp. nov., and Saccharomyces yakushimaensis sp. nov. Int J Syst Evol Microbiol 51:2189–2198 18. Park SM, Ohkuma M, Masuda Y, Ohta A, Takagi M (1997) Galactose-inducible expression systems in Candida maltosa using promoters of newly-isolated GAL1 and GAL10 genes. Yeast 13:21–29 19. Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor 20. Seoighe C, Wolfe KH (1999) Yeast genome evolution in the postgenome era. Curr Opin Microbiol 2:548–554 21. Skrzypek M, Maleszka R (1994) A gene homologous to that encoding UDP galactose-4-epimerase is inducible by xylose in the yeast Pachysolen tannophilus. Gene 140:127–129 22. Webster TD, Dickson RC (1988) Nucleotide sequence of the galactose gene cluster of Kluyveromyces lactis. Nucleic Acids Res 16:8192–8194 23. Wolfe KH, Shields DC (1997) Molecular evidence for an ancient duplication of the entire yeast genome. Nature 387:708–713 24. Wong S, Butler G, Wolfe KH (2002) Gene order evolution and paleopolyploidy in hemiascomycete yeasts. Proc Natl Acad Sci USA 99:9272–9277

123