Tumor Biol. DOI 10.1007/s13277-015-3250-4
RESEARCH ARTICLE
Thermo-chemotherapy Induced miR-218 upregulation inhibits the invasion of gastric cancer via targeting Gli2 and E-cadherin Qiang Ruan & Zhi-yuan Fang & Shu-zhong Cui & Xiang-liang Zhang & Yin-bing Wu & Hong-sheng Tang & Yi-nuo Tu & Yan Ding
Received: 13 December 2014 / Accepted: 10 February 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract Thermo-chemotherapy has been proven to reduce the invasion capability of cancer cells. However, the molecular mechanism underlying this anti-invasion effect is still unclear. In this study, the role of thermo-chemotherapy in the inhibition of tumor invasion was studied. The results demonstrated that expression of miR-218 was downregulated in gastric cancer tissues, which had a positive correlation with tumor invasion and metastasis. In vitro thermo-chemotherapy increased miR218 expression in SGC7901 cells and inhibited both proliferation and invasion of cancer cells. Gli2 was identified as a downstream target of miR-218, and its expression was negatively regulated by miR-218. The thermo-chemotherapy induced miR-218 upregulation was also accompanied by increasing of E-cadherin expression. In conclusion, the present study indicates that thermo-chemotherapy can effectively decrease the invasion capability of cancer cells and increase cellcell adhesion. miR-218 and its downstream target Gli2, as well as E-cadherin, participate in the anti-invasion process. Keywords Thermo-chemotherapy . miR-218 . Gli2 . Tumor invasion . Gastric cancer . E-cadherin
Introduction Gastric cancer (GC) is the fourth most common cancer, and the second leading cause of cancer-related death worldwide Qiang Ruan and Zhi-yuan Fang contributed equally to this work. Q. Ruan : Z.
[1, 2]. Advances in diagnostic and therapeutic approaches have achieved long-term survival for early GC. However, the prognosis for advanced GC with extensive invasion and metastasis remains poor [3]. Therefore, it is very important to control tumor progression or metastasis of advanced GC. microRNAs are naturally occurring, short, non-coding RNA molecules that negatively regulate gene expression [4]. They can integrate into RNA-inducing silencing complexes, and pair with the 3′ untranslated regions (3′UTR) of specific target messenger RNAs (mRNAs) to suppress translation or induce degradation of target mRNAs [5]. A large number of microribonucleic acids (microRNAs or miRNAs) have been found to be involved in cancer metastasis [6]. Jun et al. [7] demonstrated that miR-218 was downregulated significantly in high invasive tumors, which was closely correlated with GC tumorigenesis and metastasis. Our previous study has found that miR-218 was upregulated by more than eightfold in the serum of advanced GC patients who received cytoreductive surgery (CRS) and hyperthermic intraperitoneal perfusion chemotherapy (HIPEC) [8]. Therefore, further understanding the role of miR-218 in thermo-chemotherapybased regime can lead to a better understanding and therapy of GC metastasis. The Hedgehog (Hh) signaling pathway plays an important role in gastric cancer invasion and metastasis [9, 10]. In the canonical pathway, Hedgehog ligand binds to its receptor, Patched1 (PTCH1), which leads to the activation of Smoothened (SMO), resulting the stabilization of Gli proteins (Gli1, Gli2, Gli3) into transcriptional activators [11]. Gli2, the most transcriptional active Gli proteins, has been reported to mediate melanoma invasion and metastasis [12]. In the present study, the role of thermo-chemotherapy in the inhibition of tumor invasion was studied. The proliferation and invasion of tumor cell, as well as the expressions of miR218 and invasion-related factors, E-cadherin and Gli2, were further investigated.
Tumor Biol.
Materials and Methods Cell culture Human GC cell line SGC7901 was obtained from the Cancer Research Institute of Guangzhou Medical University (Guangzhou, China). All cells were cultured in RPMI 1640 containing 10 % fetal bovine serum (GIBCO, CA, USA) and supplemented with 50 U/mL of penicillin and 50 mg/mL of streptomycin (Invitrogen, USA) in a humidified incubator at 37 °C with 5 % CO2 atmosphere (Thermo Fisher, USA).
cells after the hyperthermic treatment were collected and seeded in the upper chamber at 1.0×105 cells/well. Complete culture medium was added to the lower chamber, and the cells were cultured for 24 h. After then, non-invasive cells were removed from the upper chamber, and invasive cells on the bottom side of the membrane were fixed with methanol for 30 min and stained with gentian violet for 15 min. Invasive cells were further counted in five microscopic fields per well at×200 magnification. The experiment was repeated thrice.
Clinical GC samples Hyperthermic treatment Cells were grown in 6-well plates with 80 % confluence, and cisplatin (Qilu Pharmaceutical, China) was administered at doses of 0, 2, 4, 6, 8, and 10 μg/mL. Hyperthermic treatment was performed in a humidified incubator at 43 °C with 5 % CO2 for 60 min. After hyperthermic treatment, the cells were cultured at 37 °C for another 23 h. Cells cultured in the 37 °C incubator (without any treatment) were served as the controls. After the treatment, cells were collected for real-time RT-PCR and Western blot analysis.
Thirty tumor tissue samples and 30 paired normal tissue samples from 30 GC patients were obtained from the Affiliated Oncologic Hospital of Guangzhou Medical University (Guangzhou, China). All the patients had undergone gastrectomy with lymph node dissection from March 2014 to October 2014. Tumor tissues and normal tissues were collected from patients immediately after surgical removal. The samples were snap-frozen in liquid nitrogen quickly and stored at −80 °C. The expression of miR-218 in clinical GC samples was detected by real-time RT-PCR.
MTS assay Real-time RT-PCR analysis Cells were first cultured in a flask to reach a confluence of 70– 80 % then harvested for further treatment. The cells were seeded in 96-well plates (5×104 cells/mL, 100 μL/well) and cultured at 37 °C for 24 h. One hundred microliters of cisplatin (dissolved in complete culture medium containing 10 % FBS) was added to each well. The final concentrations of cisplatin were 0, 2, 4, 6, 8, and 10 μg/mL, respectively. Hyperthermic treatment was performed as previous described. After 24 h of culture at 37 °C, 20 μL (5 mg/mL) of MTS (Promega, USA) was added to each well, and cells were cultured at 37 °C for another 4 h. All the experiments were carried out for three times. Absorbance was measured at 490 nm and growth inhibition of SGC7901 cells was calculated according to the following formula: cell growth inhibition rate=(1–(cisplatin group–cells blank)/(cells negative–cells blank))×100 %.
Total RNA was extracted with TRIzol reagent (Life Technologies, USA) according to the manufacturer’s instructions. β-actin was used as the internal control (primers were listed in Table 1). The RT-PCR was conducted using a one step SYBR® Primescript™ RT-PCR KitII (Takara BIO Inc, Japan). The complementary (cDNA) synthesis and PCR amplification were performed within one tube continuously in an Applied Biosystems 7500 FAST REAL-TIME PCR System (Life Technologies, USA). The 2−ΔΔCт method was used to calculate the relative expression of miR-218, Gli2, and E-cadherin. All the reactions were run in triplicate.
Table 1
Matrigel invasion assay Invasion of GC SGC7901 cells was evaluated by BD BioCoatt™ Invasion Chamber (24-well, Becton Dickinson Biosciences, USA). The upper and lower compartments of the chamber were separated with a polycarbonate filter (8-μm-pore size). The upper chamber was pre-coated with Matrigel (BD Transduction Laboratories, USA) for 6 h at room temperature before use. Cells (cultured in 6-well plate at 2.0×106 cells/well) were first treated with 0, 3.5, and 7.0 μg/mL of cisplatin at 37 and 43 °C, respectively. Survived
The sequences of the primers used in the experiment
Gene
Sequences
miR-218
Forward Reverse Forward Reverse Forward Reverse Forward Reverse
Gli2 E-cadherin β-actin
GTTGTGCTTGATCTAACCATGT CTCGCTTCGGCAGCACA CGACACCAGGAAGGAAGGTA AGAACGGAGGTAGTGCTCCA GGTATCCTCCCATCAGCT CAGTGTCCGGATAATCTCC TGACGTGGACATCCGCAAAG CTGGAAGGTGGACAGCGAGG
Tumor Biol.
Western blot analysis Total proteins were extracted by ProteoJET™ Mammalian Cell Lysis Reagent (MBI Fermentas, Canada) supplied with protease inhibitors (Bestbio, China) according to the manufacturer’s instructions. The obtained proteins were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Millipore, USA) electrophoretically. Membranes were first blocked with 5 % skimmed milk overnight at 4 °C then incubated with primary antibody overnight at 4 °C. The primary monoclonal antibodies used in this study were anti-Gli2, antiE-cadherin, anti-cleaved caspase-3, anti-Bax, and anti-Bcl-2 (Abcam Biomart, Abcam, UK), β-actin (MultiSciences LiankeBio, China). The membranes were then incubated in horse radish peroxidase (HRP)-conjugated secondary
antibody (MultiSciences LiankeBio, China) for 1 h at room temperature. Targeted proteins in the membrane were detected by ECL kit (PE Applied Biosystems, USA).
Luciferase reporter assay The human Gli2-UTR DNA sequence that predicted to interact with miR-218 was first amplified (5’-AGCCTAACTCTT GAGGTCTCT-3’ (forward) and 5’-CCTGGAATCAGAAT GTGCTCCT-3’ (reverse)). Non-specific Gli2-UTR DNA sequences were amplified with the primers 5’-CACTGTGGAC TCCCAGCTC-3’ (forward) and 5’-ACAAACTCGAGTGA TCGCCA-3’ (reverse). PCR products were cloned into the psi-CHECK2 vector and confirmed by sequencing. These
Fig. 1 Cisplatin and hyperemic treatment inhibits cell proliferation. The up two panels are cell treated with cisplatin (0, 2, 4, 6, 8, and 10 μg/mL) at 37 °C. The other two panels are cell treated with cisplatin (0, 2, 4, 6, 8, and 10 μg/mL) at 43 °C
Tumor Biol. Fig. 2 a Inhibition rate of cell proliferation by cisplatin treatment (0, 2, 4, 6, 8, and 10 μg/ mL) at 37 and 43 °C. b Cisplatin and hyperemic treatment induced cell apoptosis
vectors were then named psi-CHECK2-Gli2 and psiCHECK2-nonGli2. For the luciferase assay, SGC7901 cells were cultured in 24-well plate and transfected with 0.5 μg of either psiCHECK2-Gli2 vector or psi-CHECK2-nonGli2 vector together with 50 nM miR-218 or negative control using siPORTTM NeoFXTM Transfection Agent (Ambion, USA). Cells were harvested and assayed with a Dual-Luciferase Reporter Assay System Kit (Promega, USA) 40 h after transfection.
Statistical analysis All the experiments were carried out for three times independently. Data were shown as the mean±SD and analyzed with the SPSS 13.0 statistical software. Spearman’s rank correlation test was employed to analyze the variables correlation. Statistical significance between two groups was analyzed by student’s t test, and P<0.05 was considered statistically significant difference.
Results Thermo-therapy inhibited cell proliferation and enhanced chemosensitivity to cisplatin. Cells in control group (without treatment) had normal morphology. They were prone to lose viability and detach from the plate when cisplatin or hyperthermic treatment was introduced. There were obvious dead cells and cell debris in both cisplatin and hyperemic groups when cisplatin reached 4 μg/ mL. Furthermore, hyperemic group showed more severe proliferation inhibition and cell death (Fig. 1). MTS assay showed that the inhibition rate of cell proliferation was dependent on cisplatin concentration and treating temperature (Fig. 2a). Hyperthermic treatment increased the chemo-sensitivity of cancer cells significantly as showed by the increased inhibition rate of 43 °C group. The IC50 was 3.41 μg/mL at 43 °C, which was much lower than 7.20 μg/mL at 37 °C (P<0.05). Therefore, cisplatin at 0, 3.5, and 7.0 μg/ mL was used in following studies. As shown in Fig. 2b, expression of Bax and cleaved caspase-3 were elevated after thermal and cisplatin treatment; on the other hand, expression
Fig. 3 Cisplatin and hyperemic treatment inhibited cell invasion. The up panel is cell treated with cisplatin (0, 3.5, and 7 μg/mL) at 37 °C. The down panel is cell treated with cisplatin (0, 3.5, and 7 μg/mL) at 43 °C
Tumor Biol. Table 2 Clinicopathological characteristics and miR-218 expression in gastric cancer patients Characteristics
Fig. 4 Relative invasion of cells after cisplatin and hyperemic treatment. *P<0.05 versus control group
of Bcl-2 was downregulated. The results indicated that cisplatin and hyperemic treatment was able to induce cell apoptosis through caspase pathway. Thermo-chemotherapy suppresses SGC7901 cells invasion Fewer cells invaded into the lower chamber after hyperthermic or chemotherapy (Fig. 3). As shown in Fig. 4, compared to blank control (37 °C without treatment), 43 °C without cisplatin treatment reduced the invaded cells to 55.68 % (P<0.05,). The inhibition of invasion was positively related to the concentration of cisplatin in both 37 and 43 °C group. Thermo-chemotherapy reduced invaded cells to 31.34 % (3.5 μg/mL) and 12.43 % (7.0 μg/mL). The results indicate that hyperthermic treatment has synergistic effect with chemotherapy in reducing the invasion of SGC7901 cells. Low level of miR-218 was associated with the advance of gastric cancer The expressions of miR-218 in 30 GC tissues and 30 paired normal tissues were investigated by RT-PCR. It was found that miR-218 expression was much lower in tumor tissues (2.71±0.82) than in normal tissues (7.04±0.70) (P<0.0001, Fig. 5). The expression pattern of miR-218 was also correlated with clinicopathological characteristics (Table 2). The average
Fig. 5 Relative expression of miR-218 in normal and tumor tissues
Gender Male Female Age (years) ≤60 >60 Size (cm) ≤5.0 >5.0 Tumor site Upper stomach Middle/Lower stomach Differentiation Well/moderate Poor Depth of invasion T1/T2 T3/T4 Lymph node metastasis Negative Positive Stages I/II III/IV
Number
Average expression of miR-218 (range)
19 11
2.55±0.78 3.00±0.86
16 14
2.52±0.76 2.92±0.88
15 15
2.83±0.83 2.60±0.83
14 16
2.67±0.97 2.72±0.70
P value
0.148
0.198
0.455
0.874
0.776 10 20
2.75±0.85 2.66±0.83
9 21
3.53±0.81 2.33±0.52
0.002
0.005 8 22
3.39±0.48 2.47±0.79
12 18
3.14±0.73 2.43±0.78
0.018
expression of miR-218 was 3.53±0.81 in 9 patients with T1/T2 invasion, whereas it was 2.33±0.52 (P=0.002) in 21 patients with T3/T4 invasion. In 22 GC patients with lymph node metastasis, the average expression of miR218 was 2.47 ± 0.79, which was much lower than the average expression (3.39±0.48) in 8 non-metastatic GC cases (P = 0.005). The average expression of miR-218 was 2.43±0.78 in 18 advanced stage (stage III and IV)
Fig. 6 Relative expression of miR-218 before and after hyperthermic and chemotherapy treatment. *P<0.05 versus control group
Tumor Biol. Fig. 7 Thermo-chemotherapy regulated the expression of miR218, Gli2, and E-cadherin. a Predicted miR-218 target site in the 3’UTR of Gli2. b Luminous intensity of Gli2 after psiCHECK2-Gli2 and psiCHECK2-nonGli2 vectors transfection. c Relative expression of miR-218, Gli2, and E-cadherin in thermochemotherapy-treated SGC7901 cells. *P<0.05 versus 37 °C (0 μg/mL), #P<0.05 versus 43 °C (0 μg/mL)
patients, whereas the average expression was 3.14±0.73 (P=0.018) in the 12 early-stage (stages I and II) patients. However, expression of miR-218 did not correlate with gender, age, tumor size, tumor site, or state of differentiation. Thermo-chemotherapy induced invasion suppression through miR-218 and its downstream target Gli2 As the expression of miR-218 was associated with cancer stage and metastasis, the understanding of its mechanism or downstream targets is important for the monitoring of cancer and therapeutic regimes. The in vitro study
Fig. 8 Protein expression of Gli2 and E-cadherin in thermochemotherapy-treated SGC7901 cells
showed that low dosage of cisplatin or single hyperthermic treatment had no effect on miR-218 expression. However, hyperthermic treatment increased the expression of miR-218 significantly in both low and high dosage cisplatin, which indicated its regulatory role in controlling miR-218 expression (Fig. 6). Besides, hyperthermic treatment showed synergistic effect with cisplatin in cancer therapy. The potential downstream targets of miR-218 were further analyzed using miRDB. One of the potential targets Gli2, a transcription factor in hedgehog-GLI signaling in mediating tumor invasion and metastases, was identified as a downstream target of miR-218. The predicted result showed that miR-218 targets the 3’UTR of site Gli2 (Fig. 7a). In vitro experiments were further carried out to obtain evidence of Gli2 as a target of miR-218. Luciferase reporter assay showed that luminous intensity was decreased significantly by miR-218 in psi-CHECK2-Gli2 group, indicating Gli2 as a target of miR-218 (Fig. 7b). Expressions of miR-218 and Gli2 in thermochemotherapy-treated SGC7901 cells were analyzed. The results revealed that the levels of Gli2 mRNA and Gli2 protein were negatively correlated with miR-218 (Figs. 7c and 8). E-cadherin, a transmembrane glycoprotein in maintaining cell-cell adhesion, was also upregulated after thermo-chemotherapy.
Tumor Biol.
Discussion HIPEC has gained acceptance gradually in many countries as an adjuvant treatment. 2010 French guidelines designated CRS and HIPEC as the standard method for treating colorectal peritoneal carcinomatosis [13]. A number of clinical and animal experiments have shown that thermotherapy exerts therapeutic effects not only by delaying tumor growth but also by inhibiting lymph node metastasis [14–16]. The present study revealed that thermo-chemotherapy reduced the invasion capability of SGC7901 cells, which was accompanied by the increased expression of miR-218. Two of the key factors in tumor invasion, Gli2 and E-cadherin, were found to be the potential downstream targets of miR-218. The expression of miR-218 was found to be reduced in cancer proliferation, invasion, and migration in many kinds of cancers, including glioblastoma, gastric cancer, melanoma, lung cancer, and osteosarcoma [17–21]. In this study, we analyzed 30 paired GC samples and their clinicopathologic data. The result demonstrated that miR-218 expression was downregulated significantly in tumor tissues, which was associated with GC depth of invasion, lymph node metastasis, and clinical stage. Therefore, miR-218 can be a valuable biomarker for the diagnosis and prognosis monitoring of GC. However, the hypo-expression of miR-218 can be reversed by hyperthermic chemotherapy. Zhang et al. [8] reported that miR-218 was upregulated in gastric cancer patients after CRS and HIPEC treatment, and in vitro treatment of cancer cells increased their chemosensitivity to cisplatin. The expression of miR-218 was also upregulated in the present study after hyperthermic treatment. It was accompanied by inhibition of proliferation and invasion. Peng et al. also found that the invasion of glioma U87MG and U251MG cells was inhibited when miR-218 expression was increased by transfection[22]. The results indicate that thermo-chemotherapy is an effective modality for the controlling of tumor metastasis, and miR-218 plays an important role in the process. Our further study found that Gli2 was a target of miR-218. The cisplatin-based thermo-chemotherapy inhibited the Gli2 expression significantly, which was accompanied by decreased tumor cell proliferation and invasion. Overexpression of GLIs always causes the progression of a variety of neoplasms via regulation of cell cycle progression and apoptosis [23, 24]. The constitutive activation of the Hedgehog (HH)/ GLI signaling cascade has been implicated as a key process of cancer metastasis in brain, lung, bladder, pancreas, and prostate cancers [25, 26]. Recently, Zeng et al. reported that the inhibition of Hh/Gli2 signaling pathway suppressed gastric tumorigenesis [27]. miR-218 downregulated the expression of Gli2 in both mRNA and protein level in the present study, indicating the important role of Hh/Gli2 signaling in cisplatinbased thermo-chemotherapy.
In addition to Gli2 downregulation, the expression of Ecadherin was increased in SGC7901 cells after thermo-chemotherapy. E-cadherin is considered as a tumor suppressor which is downregulated in gastric cancer [28]. The loss of E-cadherin could increase lymph node metastasis in gastric cancer [29]. In this study, the low expression of E-cadherin was associated with the elevated invasion ability of tumor cells and upregulation of Gli2, which was consistent with previous study [30]. The upregulation of E-cadherin in the present study was highly possible to be conducted by Snail. Snail is a downstream factor of Hh/Gli2 signaling, and it is also a repressor of E-cadherin [31, 32]. The thermo-chemotherapy repressed Hh/Gli2 signaling and further downregulated the activity of Snail, which ultimately de-repressed the expression of E-cadherin. As Ecadherin is a proven hallmark of epithelial-mesenchymal transition (EMT) and a potent malignancy suppressor [33, 34], we hypothesize that the anti-metastasis effect of miR218 was achieved by Hh/Gli2/E-cadherin mediated inhibiting of EMT. In conclusion, thermo-chemotherapy shows beneficial effects for the inhibition of proliferation and invasion of GC cells, which involves the inhibition of Hh/Gli2 signaling pathway and epithelial-mesenchymal transition. Acknowledgments This work was supported by Grants from the PhD Start-up Funds of Guangzhou Medical College, Guangdong Province, China (Nos. 2012C66 and 2012C69), Guangdong Province Natural Science Fund(No S2013010016662), and the National Natural Science Foundation of China (Nos.81201932 and 81372493). Conflicts of interest None
References 1. Kamangar F, Dores GM, Anderson WF. Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol. 2006;24(14):2137–50. 2. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61(2):69–90. doi:10.3322/ caac.20107. 3. Oue N, Aung PP, Mitani Y, Kuniyasu H, Nakayama H, Yasui W. Genes involved in invasion and metastasis of gastric cancer identified by array-based hybridization and serial analysis of gene expression. Oncology. 2005;69 Suppl 1:17–22. 4. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005;120(1):15–20. 5. Lai EC. Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptionalregulation. Nat Genet. 2002;30(4):363–4. 6. Nicoloso MS, Spizzo R, Shimizu M, Rossi S, Calin GA. MicroRNAs—the micro steering wheel of tumour metastases. Nat Rev Cancer. 2009;9(4):293–302. doi:10.1038/nrc2619. 7. Tie J, Pan Y, Zhao L, Wu K, Liu J, Sun S, et al. MiR-218 inhibits invasion and metastasis of gastric cancer by targeting the Robo1
Tumor Biol.
8.
9.
10. 11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
receptor. PLoS Genet. 2010;6(3):e1000879. doi:10.1371/journal. pgen.1000879. Zhang XL, Shi HJ, Wang JP, Tang HS, Wu YB, Fang ZY, et al. MicroRNA-218 is upregulated in gastric cancer after cytoreductive surgery and hyperthermic intraperitoneal chemotherapy and increases chemosensitivity to cisplatin. World J Gastroenterol. 2014;20(32):11347–55. doi:10.3748/wjg.v20.i32.11347. Yoo YA, Kang MH, Kim JS, Oh SC. Sonic hedgehog signaling promotes motility and invasiveness of gastric cancer cells through TGF-beta-mediated activation of the ALK5-Smad 3 pathway. Carcinogenesis. 2008;29(3):480–90. doi:10.1093/carcin/bgm281. Bai R, Zhao H, Zhang X, Du S. Characterization of sonic hedgehog inhibition in gastric carcinoma cells. Oncol Lett. 2014;7(5):1381–4. Grzelak CA, Sigglekow ND, McCaughan GW. GLI2 as a marker of Hedgehog-responsive cells. Hepatology. 2014. doi:10.1002/hep. 27432. Alexaki VI, Javelaud D, Van Kempen LC, Mohammad KS, Dennler S, Luciani F, et al. GLI2-mediated melanoma invasion and metastasis. J Natl Cancer Inst. 2010;102(15):1148–59. doi:10.1093/jnci/ djq257. Golse N, Bakrin N, Passot G, Mohamed F, Vaudoyer D, Gilly FN, et al. Iterative procedures combining cytoreductive surgery with hyperthermic intraperitoneal chemotherapy for peritoneal recurrence: postoperative and long-term results. J Surg Oncol. 2012;106(2): 197–203. doi:10.1002/jso.23062. Airoldi M, Gabriele P, Brossa PC, Pedani F, Tseroni V, D'Alberto M, et al. Serum thyroid hormone changes in head and neck cancer patients treated with microwave hyperthermia on lymph node metastasis. Cancer. 1990;65(4):901–7. Hamaguchi S, Tohnai I, Ito A, Mitsudo K, Shigetomi T, Ito M, et al. Selective hyperthermia using magnetoliposomes to target cervical lymph node metastasis in a rabbit tongue tumor model. Cancer Sci. 2003;94(9):834–9. Huhnt W, Lubbe AS. Growth, microvessel density and tumor cell invasion of human colon adenocarcinoma under repeated treatment with hyperthermia and serotonin. J Cancer Res Clin Oncol. 1995;121(7):423–8. Gao X, Jin W. The emerging role of tumor-suppressive microRNA218 in targeting glioblastoma stemness. Cancer Lett. 2014;353(1): 25–31. doi:10.1016/j.canlet.2014.07.011. Xin SY, Feng XS, Zhou LQ, Sun JJ, Gao XL, Yao GL. Reduced expression of circulating microRNA-218 in gastric cancer and correlation with tumor invasion and prognosis. World J Gastroenterol. 2014;20(22):6906–11. doi:10.3748/wjg.v20.i22.6906. Wei Y, Du Y, Chen X, Li P, Wang Y, Zang W, et al. Expression patterns of microRNA-218 and its potential functions by targeting CIP2A and BMI1 genes in melanoma. Tumour Biol. 2014;35(8): 8007–15. doi:10.1007/s13277-014-2079-6. Zhang C, Ge S, Hu C, Yang N, Zhang J. MiRNA-218, a new regulator of HMGB1, suppresses cell migration and invasion in non-small
21.
22.
23.
24. 25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
cell lung cancer. Acta Biochim Biophys Sin (Shanghai). 2013;45(12):1055–61. doi:10.1093/abbs/gmt109. Jin J, Cai L, Liu ZM, Zhou XS. miRNA-218 inhibits osteosarcoma cell migration and invasion by down-regulating of TIAM1, MMP2 and MMP9. Asian Pac J Cancer Prev. 2013;14(6):3681–4. Peng B, Li D, Qin M, Luo D, Zhang X, Zhao H, et al. MicroRNA218 inhibits glioma migration and invasion via inhibiting gliomaassociated oncogene homolog 1 expression at N terminus. Tumour Biol. 2014;35(4):3831–7. doi:10.1007/s13277-013-1507-3. Ruiz i Altaba A, Sanchez P, Dahmane N. Gli and hedgehog in cancer: tumours, embryos and stem cells. Nat Rev Cancer. 2002;2(5):361– 72. Varjosalo M, Taipale J. Hedgehog: functions and mechanisms. Genes Dev. 2008;22(18):2454–72. doi:10.1101/gad.1693608. Kasper M, Regl G, Frischauf AM, Aberger F. GLI transcription factors: mediators of oncogenic Hedgehog signalling. Eur J Cancer. 2006;42(4):437–45. Mechlin CW, Tanner MJ, Chen M, Buttyan R, Levin RM, Mian BM. Gli2 expression and human bladder transitional carcinoma cell invasiveness. J Urol. 2010;184(1):344–51. doi:10.1016/j.juro.2010.03. 007. Zeng C, Wang Y, Lu Q, Chen J, Zhang J, Liu T, et al. SPOP suppresses tumorigenesis by regulating hedgehog/Gli2 signaling pathway in gastric cancer. J Exp Clin Cancer Res. 2014;33(1):75. Liu X, Chu KM. E-cadherin and gastric cancer: cause, consequence, and applications. Biomed Res Int. 2014;2014:637308. doi:10.1155/ 2014/637308. Xu W, Hu X, Chen Z, Zheng X, Zhang C, Wang G, et al. Normal fibroblasts induce E-cadherin loss and increase lymph node metastasis in gastric cancer. PLoS One. 2014;9(5):e97306. doi:10.1371/ journal.pone.0097306. Zhang D, Cao L, Li Y, Lu H, Yang X, Xue P. Expression of gliomaassociated oncogene 2 (Gli 2) is correlated with poor prognosis in patients with hepatocellular carcinoma undergoing hepatectomy. World J Surg Oncol. 2013;11:25. doi:10.1186/1477-7819-11-25. Chou CH, Lieu AS, Wu CH, Chang LK, Loh JK, Lin RC, et al. Differential expression of hedgehog signaling components and Snail/E-cadherin in human brain tumors. Oncol Rep. 2010;24(5): 1225–32. Fendrich V, Waldmann J, Esni F, Ramaswamy A, Mullendore M, Buchholz M, et al. Snail and Sonic Hedgehog activation in neuroendocrine tumors of the ileum. Endocr Relat Cancer. 2007;14(3):865– 74. Berx G, van Roy F. Involvement of members of the cadherin superfamily in cancer. Cold Spring Harb Perspect Biol. 2009;1(6): a003129. doi:10.1101/cshperspect.a003129. Niessen CM, Leckband D, Yap AS. Tissue organization by cadherin adhesion molecules: dynamic molecular and cellular mechanisms of morphogenetic regulation. Physiol Rev. 2011;91(2):691–731. doi:10. 1152/physrev.00004.
