9 1991 S. Karger AG, Basel

Immunol Res 1991;10:141-155

0257-277XI91/0102-014152.75/0

Tumor Necrosis Factor Regulation of Major Histocompatibility Complex Gene Expression David R. Johnson, Jordan S. Pober Department of Pathology, Brigham and Women's Hospital and Harvard Medical School, Boston, Mass., USA

Introduction

Two qualitatively different activity types of tumor necrosis factor (TNF) have been extensively characterized: (1) T N F is directly cytotoxic, independent of protein or mRNA synthesis, to some oncogenically transformed cells [1], and (2) T N F regulates the expression of proteins in normal and transformed cells, including the highly polymorphic, immunoregulatory molecules encoded within the major histocompatibility complex (MHC). The immunological importance of the MHC arises from the fact that specific helper or killer T cells only recognize antigen efficiently when it is bound by one of two classes of MHC-encoded cell surface proteins: class-I molecules, which are expressed on nearly all cell types, or class-II molecules, which are normally found only on B cells, macrophages and certain other cells. Although both class-I and class-II molecules appear to fold into similar peptide-binding structures, these molecules show important functional differences. Class-I molecules preferentially bind peptide antigens from endogenously synthesized proteins, e.g. viraI proteins, that are subsequently displayed on the cell surface to be recognized by cytotoxic

CD8 + T cells, which kill virus-infected cells. In contrast, class-II M H C molecules preferentially bind peptides from exogenous proteins and present antigen most efficiently to helper CD4 § T cells. The quantitative expression of class-I and class-II M H C molecules may be important in determining the efficiency of T-cell stimulation. Here we review the specific actions of T N F upon MHC molecule expression and discuss the mechanisms o f TNF-mediated gene regulation.

T N F Effects on M H C Molecule Expression

T N F increases the cell surface expression of class-I molecules, 2- to 4-fold in 24 h [2]. This increase in surface expression reflects the increase in total cellular class-I protein, which is preceded by a rise in the steady-state levels of mRNA encoding both subunits of the class-I ctl3 heterodimer. In endothelial cells we have found that the increase in mRNA results from increased transcription, with no evidence of increased mRNA stability [3]. Since peptides bind most readily to class I as the nascent a and 13 chains fold to form the antigen-binding structure [4], this

142

increased rate of MHC protein biosynthesis might be more relevant than the overall level of surface expression in determining the efficiency of antigen presentation. TNF is usually found together with other cytokines at sites of inflammation. In particular, interferon-13 (IFN-[3) and TNF are synthesized by virus-infected cells [5] and IFN-y and TNF are released by some activated T cells [6]. Individually, these interferons also induce MHC class-I expression (8- to 10fold). However, TNF combines with either IFN to produce a much greater than additive (i.e. synergistic) increase in MHC class-I expression (>20-fold). In contrast, the two IFN types combine to produce a less than additive induction of class I. Although these observations were initially made in cultured vascular endothelial cells, which are of particular interest because endothelium might play a role in recruiting specific T cells from the bloodstream into inflammatory sites, these observations have since been extended to several other cell types [7] (and HeLa, unpublished observation). Class-II regulation by TNF is controversial, perhaps reflecting differences among the cell types in which it has been studied. TNF does not induce de novo expression of class-II mRNA in human endothelial cells [2, 8] (although contradictory results have been reported in rat endothelial cells [9], in human vascular smooth muscle cells [10]), or in normal murine macrophage, although induction occurs in malignant murine macrophage [11]. In several studies TNF inhibited the induction of class-II molecules by IFNq, in human endothelial cells [12-I4], although the effect is small in comparison to that of IFN-13, which markedly inhibits IFN7 induction of class-II mRNA [12, 13]. In contrast, TNF has been reported to enhance

Johnson/Pober

class-II expression on virus- or IFNq,-induced astrocytes [ 15, 16], activated T-cell- or IFN-y-induced Schwann cells [17], and IFNy-induced monocytes [18]. In human monocyte cell lines TNF increases constitutive class-II expression in THP-t but does not induce de novo expression in U937 [11]. Similarly, class II is induced in human pancreatic [3 cells by combined IFN-y and TNF but not by either cytokine alone [19], although it should be noted that this combination markedly impairs 13-cell function [20] and has been implicated in insulin-dependent diabetes [21]. Therefore, TNF may regulate on-going class-II synthesis but it is usually unable to initiate transcription of the class-II gene. In summary, the inflammatory cytokines TNF, IFN-[3 and IFN-y, each induce class-I MHC expression; however, TNF combines with either IFN type to increase synergistically the transcription of MHC class-I genes. In general TNF does not induce class-II molecule expression de novo and its interaction with IFNs may be cell-type dependent.

TNF Receptor Signal Transduction All TNF effects are believed to be initiated by the binding of TNF to cell surface receptors. The signal generated by TNF binding is transduced by activation of one or more second messenger pathways. Second messenger pathways may be complex, with single agents activating multiple, cell-specific enzyme systems. Therefore, to unambiguously identify a second messenger pathway as the mediator of a cytokine signal, three criteria must be met: (1) the cytokine must activate the second messenger pathway in the cell of interest; (2) activators of the

TNF Regulation of MHC Gene Expression

second messenger must mimic the cytokine, and (3) inhibitors of the second messenger must inhibit the cytokine. To date, these criteria have not been met for the T N F regulation of M H C genes. Several second messengers are activated by T N F in a variety of experimental systems. We will review the interaction o f T N F with its receptor and discuss TNF-activated second messengers as they may relate to the induction of transcription factors that regulate MHC genes.

TNF Receptor Biochemistry The detailed structure of the T N F receptor (TNF-R) is a yet unknown. H u m a n endothelial cells [22] and HeLa cells [23] have a single class of high affinity receptors (K~ about 10-1~ although a second class of lower affinity receptors may exist, or co-exist (SK-CO-1) [24] on myeloid cells [25]. The TNF-R affinity has been shown to change with cell density in cultured bovine endothelial cells [26]. Biochemical analyses suggest that the two classes of TNF-Rs are each composed of at least two, possibly distinct [25], TNF-binding subunits that combine to form one or more TNF-binding sites and that T N F binding stabilizes this receptor complex [25, 27]. Lymphotoxin (LT), also known as TNF~, is a close functional homologue of T N F that competes with T N F for binding to TNFRs. T N F and LT have essentially identical activities and potencies on MHC genes [12, 28], although potencies may differ for some activities [24]. Interleukin-1 (IL-1) does not stimulate MHC gene expression [28], although IL-1 and T N F share many other activities [29]. Therefore, second messenger pathways activated by both T N F and IL-1 are less likely to be directly involved in MHC regulation.

143

However, IL-1 may regulate the response of M H C genes to other cytokines; IL-let has been reported to antagonize T N F synergy with IFN-7 inducing class-II expression on rat endothelium [30].

TNF Receptor Regulation The cytotoxic, antiviral [31] and MHCinducing [12] activities of T N F are enhanced by IFN-3,, which was thought to result from an IFN-7-induced increase in TNF-receptor expression on the cell surface [32]. However, this view is challenged by the observation that in some cells IFN-ct and IFN-[3 also potentiate T N F cytotoxicity though they do not increase T N F - R expression [33]. Similarly, synergy between IFNs and T N F in inducing M H C class-I expression by endothelial cells does not appear to require increased TNF-R expression, since IFN-y does not significantly alter the n u m b e r of T N F receptors or their affinity on these cells [3]. T N F - R expression is increased up to 7fold in some human tumor cells and normal peripheral blood monocytes by direct activators of the cAMP-dependent protein kin a s e A (PKA), dibutyric-cAMP and 8-brotoo-cAMP, and by inhibitors of phosphodiesterase, which stimulate PKA indirectly by elevating cytosolic cAMP levels. This PKA activity is blocked on these cells by activators of protein kinase C (PKC), which act by reducing the affinity of the TNF-R [34]. TNF-R expression is also downregulated by PKC activators on human fibroblast [35] and cell lines [36, 37]. In contrast, PKC activators reverse TNF-R downregulation induced by IFN-et or IFN-y on primary or transformed murine macrophages, which is surprising since IFN-y has been shown to stimulate PKC activity in the macrophage cell lines THP-I and U937 [38] (and endo-

144

thelial cells [39]). These reports of changes in TNF-R number have been interpreted as implicating PKC and PKA in regulating TNF signal transduction in several cell types. However, this interpretation is open to question since both growth- and MHC-regulating activities of TNF appear to be independent of TNF-R modulation.

Autocrine and Paracrine Mediators of TNF Activity In human endothelial cells, TNF-mediated increases in class-I mRNA levels is protein synthesis-dependent [2], consistent with the possibility that TNF induces a second cytokine which mediates or augments the TNF effect. TNF induces a transient accumulation of TNF mRNA, which is enhanced by IFNq,, in murine peritoneal macrophages [40]. TNF has also been reported to induce IL-1 and IL-6 in endothelial cells [22]. However, these cytokines do not increase class-I MHC expression. Autocrine secretion of TNF by IFN-7-treated human monocytes has been reported to enhance class-II expression [18]. In contrast, exogenous TNF inhibits IFN-y-induced class-II expression by endothelial cells [ 12]. The constitutive and TNF-induced expression of classI in human fibroblasts has been reported to be mediated by IFN-~3 [41], although this mechanism is probably not operating in human endothelial cells or in HeLa cells since (1) neutralizing antibodies directed against IFNq3 (or IFN-a) do not inhibit TNF induction of class I on endothelial cells (unpublished observations), and (2) maximal IFN-13-induced class-I expression is markedly further enhanced by exogenous TNF [12]. Moreover, TNF does not induce measurable IFN-13 mRNA or activity in these cells.

Johnson/Pober

TNF-stimulated growth of confluent human FS-4 fibroblasts is enhanced by the addition of the prostglandin inhibitors, indomethacin or acetylsalicylic acid (aspirin), suggesting that prostaglandins induced by TNF antagonize its mitogenic activity [42, 43]. Whether prostaglandins affect the expression of MHC molecules by these cells is unclear, although prostaglandins have been shown to regulate MHC expression in murine macrophages [44].

Intracelhdar Second Messenger Coupling The best described intracellular second messenger systems are PKC (activated by Ca 2+ and diacyl glycerol or arachidonic acid), tyrosine kinase (often receptor-associated and directly activated by ligand binding) and calmodulin-dependent kinase (activated by Ca 2§ and calmodulin). There is no evidence that TNF affects intracellular calcium or can be mimicked by calcium ionophore in endothelial cells (unpublished observations), although it should be noted that a calcium ionophore has been shown to mimic TNF in inducing a transcription factor in human fibroblasts [45]. In several systems TNF is mimicked by activators of PKC, observations that initially suggested that TNF binding is transduced by PKC activation. In endothelial cells both TNF and phorbol-i 2-myristate-13-acetate (PMA), an activator of PKC, induce transient expression (4 h maximum) of the adhesion molecule ELAM-1, although protracted PMA stimulation results in PMA unresponsiveness while leaving the TNF response largely intact [28]. Similarly, in human gingival fibroblasts, TNF and PMA induce phosphorylation and reduction in number of epidermal growth factor receptors; the activity of PMA is blocked by the PKC inhibitor staurospo-

TNF Regulationof MHC Gene Expression

145

fine [46], but TNF is not [47]. Similarly, we tion of the EGF-R, coincident with reduchave found that in human endothelium, tion in affinity for EGF, by a PKC-indepenstaurosporine also blocks PMA-induced but dent mechanism [47]. Growth conditions not TNF-induced expression of ELAM-I may directly affect constitutive and TNF(unpublished observations). induced MHC expression by altering the levTNF and IL- 1 cause a rapid accumulation els of inhibitory or activating protooncogene of intracellular cAMP in human FS-4 fibro- products. For example, addition of serum or blasts, which peaks in 5 rain and returns to growth factor to endothelial cell cultures inbasal levels by 15 min [48]. Extracts of TNF- duces both c-fos, which promotes class-I extreated cells cause the phosphorylation of pression, and c-myc, which inhibits class-I added histone proteins under conditions expression [51]. that are chosen to minimize PKC activity The coupling of ligand binding to second and phosphorylation is blocked by the PKA messenger activation is often mediated by inhibitor H-8. The addition of an activator guanosine triphosphate (GTP)-binding proof PKA, forskolin, induces a similar rise in teins (G proteins) and often involves the cAMP and activation of histone kinase in action of phospholipases. TNF increases the these cells. Furthermore, TNF, IL-1 and binding of GTPTs, an unhydrolyzable anaforskolin each strongly induce the accumula- log, to several cellular G proteins, and stimtion of IL-6 mRNA by 1 h. In contrast to the ulates a pertussis toxin-sensitive GTPase acabrogation of agonist-induced cAMP eleva- tivity nearly 4-fold in the promyelocytic leution by H-8, however, only the forskolin kemia cell line HE-60 and murine L929 induction of IL-6 is blocked by H-8; the fibroblasts [52]. One of the pertussis toxininduction of IL-6 by TNF or IL- 1 is only par- binding G proteins was identified as Gi, tially reduced. These results implicate PKA which shortens activation by virtue of its in mediating TNF (and IL- 1) effects but sug- high GTPase activity. Furthermore, the gest the involvement of additional second TNF-induced increase in permeability of enmessenger systems. dothelial cell monolayers is blocked by perTNF stimulates the rapid (30 s) phos- tussis toxin [53], suggesting a G-protein inphorylation of serine and tyrosine residues termediary in this TNF activity. However, of a protein and myeloid HL-60 cells [49]. IL-1 also acts through pertussis toxin-sensiTyrosine kinase activity is correlated with tive G proteins [54] and cAMP [55], though mitogenic activity in products of many cellu- a novel mechanism has been proposed in T lar oncogenes. Both TNF and epidermal cells wherein IL-1 stimulates PKC activation growth factor (EGF) stimulate growth in by causing hydrolysis of phosphotidylchoconfluent diploid human FS-4 fibroblasts line, without demonstrable hydrolysis of [50]. In human carcinoma cell lines TNF phosphatidylinositol [56]. Similarly, TNF transiently stimulates EGF-R tyrosine ki- acts independent of phosphatidylinositol hynase activity 3-fold within 10 min, which drolysis by phospholipase C or phospholicorrelates with increased phosphorylation of pase D, albeit through a pertussis toxin-inthe EGF-R at sites similar to those modified sensitive, dibutyryl cAMP-inhibited pathby EGF but distinct from those modified by way in the respiratory burst response of huPMA [42]. IL-1 also induces phosphoryla- man neutrophils [57]. Since IL-1 does not

146

induce MHC class-I expression, these similarities in G-protein activation by TNF and IL-1 suggest that this is not a major pathway of TNF-regulated MHC class-I expression. On the other hand, IL-1 and TNF have similar activities on some cells in regulating class-II expression, so G proteins may mediate this TNF activity. Phospholipase has been implicated in the cytotoxic and mitogenic activities of TNF on dividing or quiescent cultured cells [58]. Both activities are inhibited by quinacrine, an inhibitor of phospholipase, and mimicked by melittin, an activator of phospholipase-A2. Whether this phospholipase is directly involved in regulating MHC genes is unknown. However, one of the products of phospholipid hydrolysis by phospholipaseA2, arachidonic acid, can be further metabolized to yield prostaglandins, which are able to directly regulate MHC expression by some cell types [44].

Transcriptional Activation of MHC Genes by TNF

MHC Genes The MHC occupies approximately 3,500 kb on chromosome 6 in man and chromosome 17 in mice. Within the MHC, class-Ict chain genes, called HLA-A, B, C in man, and class-II genes, called HLA-DR, DP, DQ in man, are found grouped by class and, in class-II genes, a and [3 genes for each molecule are proximal. The class-II3 chain, also called 132-microglobulin, is monomorphic and encoded on a separate chromosome in both man and mice. The Y-flanking region of class-I genes contains homologous cis-acting DNA sequences, which allow the coordinate transcriptional regulation of these

Johnson/Pober

genes. Similarly, class-II genes share regulatory elements that allow coordinate expression of the class-II genes. However, these elements differ between class-I and class-II genes, consistent with their distinct patterns of expression.

Protein Factors/DNA Elements Mediating TNF Effects TNF activates at least two families of transcription factors: AP-1 and NF-~B. In human fibroblasts TNF causes transcriptional activation of e-jun and c-los [59], the genes encoding the major subunits of AP-1, which in turn promotes the transcription of genes containing a so-called TPA (12-0tetradecanoylphorbol-13-acetate, PMA) response element (TRE) in their 5'-noncoding regions (GTGAGTA/cA) [60-62]. These protooncogenes regulate their own transcription through TREs and their transcription is also regulated through serum response elements (SREs) and cAMP response elements (CREs) [63]. In T cells TNF and PMA activate the transcription factor NK-KB, which promotes transcription of genes containing a 5'-KB element (ACGGGGACTTTCCG) [64]. NF-~B is found ubiquitously associated with an inhibitory subunit, I-KB, in the cytoplasm of unstimulated cells. TNF- or PMA-activated NF-~:B dissociates from the inhibitory subunit, perhaps as a result of the phosphorylation of I-~:B, and is then translocated to the nucleus where, in T cells, it promotes ~:Bmediated transcription of IL-2 and IL-2 receptor genes [65, 66], although a requirement for additional regulatory elements in TNF-induced IL-2 receptor expression has been suggested [67]. However, in T cells stimulated with IL-1 and antigen the transcription ofjun andros is also activated, suggesting a role for AP-1 in mediating IL-2

TNF Regulation of MHC Gene Expression

5'

147

Sequence

3'

Identity

position

~2m (human)

-201

HLA-A3 HLA*A2 HLA'~27 H-2L-

-148 -143 "141 -167

#

TCCTAGAATG AGCGCCGGTG TCCCAAGCT- GGGGCGCGCA CCCCAGATCC GGAGGGCGCC GCTGTGTAAG GATTGGGGAG TCCCAGCCT/ -GGGATTCCC CAACTCCGCA GTTTCTTTTC GCGGTGTATG GATTGGGGAG TCCCAGCCTT GGGGATTCCC CAACTCCGCA GTTTCTTTTC GCCTTGTCTG CATTGGGGAG GCGCACAGTT GGGGATTCCC CACTCCCACG AGTTTCACTT GGTGAGGTCAG GGGTGGGGAA GCCCAGGGCT GGGGATTCCC CATCTCCT 99 9

CRE I I , I CRE I I I

( GTGAGGTCAG GGGTGGGG~ GCCCAGGGCT GGGGATTCCC CATCTCCAC 9 ( ) ~ - -

ACAA AGGGACTTTC CCATITTCAGTT

H-2K b

-166

KB-(ike repeats a , b ' . a , b gB-Like repeats b J . ' d ~2m (murine)

-166

A GGGGACTTTC CGAGAG

Ig~ ~8, NF-KB-binding

............ C ....

mutant K8, H2TF1/KBF1-binding

Fig. 1. Class-I enhancer sequences compared with known transcription factor binding sites. Sequences have been aligned for maximum homology, gaps are indicated by -. Sequences are from GenBank, except for H-2Ld [72], for which the orientations of the classI regulatory,elements (CRE) are indicated with arrows and H2-Kb [74], for which the orientation of the

gene induction [68]. The activity of KB-like enhancer mediating the lipopolysaccharide (LPS)-stimulated transcription of the T N F gene itself in primary macrophages [69] suggests that this element may also mediate autocrine expression of TNF. Recently, the transcription factor interferon regulatory factor-1 (IRF-I) has been shown to be strongly induced by T N F in both h u m a n fibroblasts and murine L929 cells [45]. IRF-1 binds to a portion of the interferon response element in the 5' region of M H C class-I genes [70] and the same sequence binds a second, putative negative regulatory factor IRF-2. Whether IRF-2 is modulated by T N F is unknown. At least two other families of transcription factors might be involved in TNF-

repeated elements are indicated with arrows. Position numbers indicate distance (bp) from base indicated with a # to the TATA-likeTCTA sequence, except for H-2Ld and H-2Kb (relative to cap) and 132m, which has a TATA sequence. Underlined sequences are DNase footprints with NF-~B [96, 97]. The cAMP response-like element is double underlined.

induced gene activation, in addition to AP1, NF-~:B and IRF-1/2. The cAMP-response element (CRE) differs from the TRE by the insertion of a single C (GTGAC__GTA/cA/6) [62] and a sequence highly homologous to the CRE is found within the class-I enhancer (fig. 1). Several genes encoding CRE-binding proteins (CREBs) have been isolated. Since T N F elevates cAMP levels [48], it is possible that the CREB family of transcription factors is involved in T N F regulation of M H C expression. The recently-described transcription factor H-2RIIBP also binds to region II of the class I regulatory element [71] (fig. 1). However, the nuclear factors that bind to this region have been previously shown to be present in various issues irrespective of the

148

Johnson/Pober

A 10

20

30 I

40

50

60

i

i

70

80

i

i

90 i

i

AAG~TTA~T~TcT~A~AAAcT~cATG~GATGAT~TTT~TC~TA~AAGAGT~CA~GT~AcA~TAA~GA~T~G~A~T~A~GA~TC~AGTT~A~ i

i

i

|

I

i

100 i

GGACAGAGATTACGGGATAA~AGGAGAGGGACGGGG~CCATGCCGAGGG~TTCTCCCTTGTTTCTCAGACAG~TCTTGGGCCAAGACTCAGGG 200 i

i

i

r

i

i

i

AGACATTGAGACAGAGC•CTTGGCA•AGAAGCAGAGGGGTCAGGGCGAAGTCCAGGGCCC•AGGCGTTGGCTCTCAGGGTCT•AGGCC••GAAGGCGGTG i

I

i

i

i

300 i

TATGGATTGGGGAGTCCCAGCCTTGGGGATTCCCCAAcTCCGCAGTTTCTTTTCTCCCTCTCCCAACCTATGTAGGGTCCTTCTTCCTGGATACTCACGA I

I

I

I

I

|

CG~GGAC~CAGTTC~C}CCATTGGGTGT~GGGTTT~CAGAGAAG~AAT~AGTGT~GT~GCGGTCG~GGTT~TAAAGTCCGEACGCAC~CA~EGGGA

400 I

500

CTCAGATTCTCCCCAGACGCCGAGGA~GCCGTCATGGCGCCCCGAA B TGAGTCA ,..,..T .... A..

C consensus TRE [60] HLA-A2 190" 207

~ ...... ..... C

H-2Kb [70] HLA-A2 122" 415

Fig. 2. A Analysis of the 5' flanking region of the human class-I MHC gene HLA-A2.Sequence is from GenBank, locus HUMMHA2, accession number K02883. CAAT box and variant TATA box (TTCTAAA) are underlined, translation initiation codon is indicated with an arrow. TPA response elements (TRE) homologies are underlined, interferon

regulatory factor-l-binding site homologies are boxed. The NF-KB/H2TFI/KBFI-binding site homology is indicated by a dotted line over the sequence [76]. B. TRE homologies are listed and compared with the consensus TRE [60]. C. IRF-l-binding site homologies are listed and compared with that of the murine class-I binding site [70].

class-I expression [72] and little is known about the regulation of this transcription factor.

lates with the level of constitutive class-I expression in h u m a n leukemic T-cell lines. Israel et al. [74] have suggested that T N F induces transcription of the murine class-I gene (H-2K b) by activating an NK-~:B-like transcription factor, which displaces constitutive binding proteins (AP-2 and KBF1/H2TF1) from two imperfect ~B sites and stimulates transcription. They show that either site is unresponsive while multimers of either site are TNF-responsive. However, the h u m a n class-I ct chain genes HLA-A2, A3 and B27, which have only a single full repeat, and human [32-microglobulin, which has only a partial element 5' of the gene, respond to T N F [2, 3] (fig. I). In addition, in functional studies with transfected reporter genes

Class-I Regulation The 5' regions of M H C class-I a and [3 chain genes contain a sequence homologous to a ~:B site and several sequences with homologies to the TRE (fig. 2). In addition, a CRE is located within the class-I regulatory. element (CRE) region I [72]. Whether these sites mediate T N F activation ofclass-I genes remains unclear. Several groups have noted an enhancer activity in a region 5' of class-I genes [72]. Zachow and Orr [73] have shown that the amount of enhancer binding activity corre-

TNF Regulation of MHC Gene Expression

149

these investigators showed that a promoter the 5' region of the HLA-DRct gene contains construct lacking most of the principal ~cB a l l0-bp sequence that binds different facsite responds even better to T N F than does a tors in different cell types, such as B cells, T promoter with the entire KB site, weakening cells, murine macrophages, and IFN-vthe argument that this nB site mediates the treated or untreated HeLa cells [77, 78]. One T N F response of class-I genes. c o m m o n factor, RF-X, appears to be reA recently described transcription factor, quired for IFN-y inducibility in fibroblasts, PRDII-BF1, binds the ~cB-like sequence in and a second, NF-S, binds to a CRE-like elethe murine class-I gene H-2K b, and displays ment [79]. Little is known about protein facnovel characteristics [75]. Unlike other ~cB- tors or sequence elements that may mediate binding factors, PRDII-BF1 is under tran- positive and negative T N F regulation o f scriptional regulation and is induced only class-II expression. Although T N F strongly slowly, over a period of hours, by serum or induces IRF-1, no binding site is apparent in virus stimulation of human MG63 cells. the l l0-bp sequence mentioned above. These are the characteristics that would be Whether a cryptic site exists in this region, expected of a transcription factor mediating or can be found elsewhere, remains to be T N F regulation of HLA class-I genes since seen. A second attractive mediator for T N F they are induced slowly and since cyclohex- regulation of class II is mXBP/CRE-BP2. It imide, a protein-synthesis inhibitor, has pre- is unknown whether this factor is regulated viously been shown to block T N F induction, by TNF, but some regulatory effects are implicating a protein factor synthesized de likely through T N F regulation of PKA acnovo [2]. Moreover, the authors report that tivity. serum stimulation increases HLA class-I mRNA with kinetics that are slightly slower Transcription Factor Modification than those of PRDII-BF1. A similar or idenProtein kinases can control the activity of tical factor has been identified in endothelial transcription factors. For example, PKC is cells [Tucker Collins, Brigham and Women's believed to phosphorylate I•B, resulting in Hospital, personal commun.]. Therefore this activated NF-~cB [64]. Subunits of the tranfactor is an attractive candidate for a role in scription factor AP-1 (c-Fos,c-Jun) are also mediating T N F induction of class-I genes. It regulated by phosphorylation [80, 81]. It is should be noted that PRDII-BF1 is much unclear whether Jun-B or Jun-D, which are larger (predicted 250-290 kD) than either recently described alternative, regulatory NF-KB (45-50 kD and an associated 65-kD forms o f c - J u n [82, 83], are also regulated by polypeptide) [76] or KBF1/H2TF1 (120 kD), phosphorylation. CREB is phosphorylated so it is unlikely to be the factor observed by by PICA [84] and is also predicted to have Israel et al. [74]. PKC and casein kinase-II phosphorylation sites [85]. In addition, CREB [85] and CREClass-H Regulation BP2 [86], like Jun and Fos, contain leucineThe cell-type-specific regulation of class- zipper domains, which mediate hetero- and II mRNA expression is reflected in the vari- homo-dimerization of these transcription ety of nuclear factors that bind to the pro- factors. The presence of PKA, P K C and camoter regions of class-II genes. For example. sein kinase-II phosphorylation sites on

150

Johnson/Pober

CREB suggests that this transcription factor could be modified by different activated second messengers systems.

Second Messenger~Transcription Factor Cross-Talk In one cell type the response of a single gene to either IFN- 7 or IFN-a can be blocked by different second messenger antagonists [87]. This suggests that different receptors will be found that activate distinct second messengers. However, a single transcription factor subunit (c-Jun) can combine with different subunits (mXBP/CRE-BP2 or c-Fos) to form complexes mediating responses to cAMP or PMA [86]. In addition, c-Fos but not v-Fos represses c-fos transcription through a serum response element (SRE) [88], perhaps because v-Fos is not phosphorylated under the same conditions as c-Fos [80]. In contrast, the c-fos SRE mediates transcriptional stimulation by an activated G protein, c-Ha-ras, or by an inhibitor of phosphodiesterase, dibutyl cAMP, both of which may stimulate PKA [63]. Taken together, these results suggest a mechanism by which cross-talk between second messenger systems might occur: particular agonist-activated second messenger enzyme(s) may modify transcription factors that are used in common by several different transcription complexes. Transcription factors may undergo phosphorylation-regulated dimerization (or form higher multimers) mediated by interaction domains, such as leucine zippers. These complexes may be themselved modified by phosphorylation and undergo allosteric changes such as those observed in the phosphorylation of muscle phosphorylase [89]. The initial pattern of gene expression induced by T N F would be a function of the second messenger systems

activated and the pre-existing transcription factors that are substrates of the activated second messenger enzyme systems. Subsequent gene expression is likely to be complex due to alterations in second messenger enzyme activities over time and interactions with previously modified transcription factors.

Post-Transcriptional Regulation T N F stimulates phosphorylation of a capbinding protein (p28) in vivo and in vitro, suggesting a role in post-transcriptional regulation [90]. However, M H C class-I expression is regulated exclusively at the transcriptional level in endothelial cells [3]. Class II is also regulated at the transcriptional level in most cells, but post-transcription regulation is reported in some cells. T N F is itself regulated in response to LPS at the transcriptional level [69], in the stability of T N F mRNA, and at the secretory level [9 i].

Oncogenes The adenovirus E IA protein is a strong, general repressor of many different kinds of enhancers, including the ~B element in the murine class-I gene H-2K b enhancer, the AP1 binding element in polyomavirus and human metallothionein enhancers and the multiple enhancer elements of SV40 [92]. This is one of the ways in which adenovirus reduces the expression of class I on the cell surface. T N F overcomes this repression in adenovirus-transformed mouse fibroblast cell lines and synergizes with IFN-7 in this activity [93]. IFN-y has been shown to increase mRNA for the class I c~ and 13 chains in such cells. It is probable, therefore, that these cytokines are circumventing E1A repression at the level of class-I transcription. The cytokine stimulation of class I appears

TNF Regulation of MHC Gene Expression

to be independent of the anti-tumor activities of IFN-y and T N F since A d l 2 E1A m R N A and protein continues to accumulate in treated ceils.

Conclusion In this review we have correlated early events in T N F signal transduction, such as second messenger activation, with later transcriptional activation of MHC genes. This description remains incomplete at several levels. However, we have suggested guidelines for defining activated second messengers involved in mediating T N F effects intracellularly, and we have indicated some of the ways in which transcription factors may be modified by TNF-activated second messenger enzymes to regulate gene expression. An exact model for TNF-activated gene expression can be formulated only when more is understood about the various transcription factors and sequence elements that are involved. However, from what is already known about these mediators it can be anticipated that transcriptional regulation by T N F will initially involve enzymatic modification of pre-existing transcription factors that are then capable of forming active transcription complexes. Subsequent regulation will probably involve competition for transcription factor subunits between transcription complexes and allosteroic modifications of the complexes themselves. The importance of T N F in regulating M H C molecule expression is underscored by the observation that T N F is most potent in vivo at causing the regression of immunogenic tumors and is less effective in immunosuppressed mice [94]. In addition, a role for T N F in regulating MHC expression in

151

vivo is suggested by the observation that T N F enhances the T-cell dependent immune response in mice [95]. However, T N F has many additional immunoregulatory functions. The induction by T N F of cell adhesion molecules, such as ELAM-1, ICAM-1, INCAM-1 10/VCAM-1, and cytokines, such as IL-1, IL-6, IL-8 and MCP-1, is also clearly of great importance in the context of the immune response. Nevertheless, because of the central role of M H C molecules in cell and antigen recognition by T cells, the affect of T N F on M H C expression is a major component o f these immunoregulatory activities.

References 1 Chen M, Holskin B, Strickler J, et al: Induction by E 1A oncogene expression of cellular susceptibility to lysis by TNF. Nature 1987;330:581-583. 2 Collins T, Lapierre LA, Fiers W, et al: Recombinant human tumor necrosis factor increases mRNA levels and surface expression of HLA-A,B antigens in vascular endothelial cells and dermal fibroblasts in vitro. Proc Natl Acad Sci USA 1986; 83:446-450. 3 Johnson DR, Pober JS: TNF and IFN-gamma synergistically increase transcription of HLA heavy and light chain genes in vascular endothelium. Proc Natl Acad Sci USA 1990;87:51835187. Cox JH, Yewdell JW, Eisenlohr LC, et al: Antigen presentation requires transport of MHC class t molecules from the endoplasmic reticulum. Science 1990;247:715-718. Goldfield A, Maniatis T: Coordinate viral induction of tumor necrosis factor alpha and interferon beta in human B cells and monocytes. Proc Natl Acad Sci USA 1989;86:1490-1494. Cherwinski H, Schumacher J, Brown K, et al: Two types of mouse helper T cell clone. III. Further differences in lymphokine synthesis between Thl and Th2 clones. J Exp Med 1987;166:12291244. Takemura Y, Koide Y, Kawabata M, et al: Syner-

152

gistic enhancement of class I major histocompatibility complex antigen expression in K562 cells induced by recombinant human interferongamma and tumor necrosis factor in combination. Exp Hematol 1989; 17:795-799. 8 Pober JS, Gimbrone MA Jr, Cotran RS, et al: Ia expression by vascular endothelium is inducible by activated T cells and by human gamma-interferon. J Exp Med 1983;157:1339-1353. 9 Male D, Pryce G: Synergy between interferons and monokines in MHC induction on brain endothelium. Immunol Lett 1988; 17:267-271. 10 Warner S, Friedman G, Libby P: Regulation of major histocompatibility gene expression in human vascular smooth muscle cells. Arteriosclerosis 1989;9:279-288. l 1 Hofmann M, Weinberg J: Tumor necrosis factoralpha induces increased hydrogen peroxide production and Fc receptor expression, but not increased Ia antigen expression by peritoneal macrophages. J Leukocyte Biol 1987;42:704-707. 12 Lapierre L, Fiers W, Pober JS: Three distinct classes of regulator5, cytokines control endothelial cell MHC antigen expression. Interactions with IFN-gamma differentiate the effect of TNF and LT from those of IFN-alpha and IFN-beta. J Exp Med 1988;167:794-804. 13 Leeuwenberg JF, Van Damme J, Meager T, et al: Effects of tumor necrosis factor on the interferongamma-induced major histocompatibility complex class II antigen expression by human endothelial cells. Eur J Immunol 1988;18:1469-1472. 14 Wedgwood J, Hatam L, Bonagura V: Effect of interferon-gamma and tumor necrosis factor on the expression of class I and class II major histocompatibility complex molecules by cultured human umbilical vein endothelial cells. Cell Immunol 1988;111:1-9. 15 Benveniste E, Sparacio S, Bethea J: Tumor necrosis factor-alpha enhances interferon-gamma-mediated class II antigen expression on astrocytes. J Neuroimmunol 1989;25:209-219. 16 Massa P, Schimpl A, Wecker E, et al: Tumor necrosis factor amplifies measles virus-mediated Ia induction on astrocytes. Proc Natl Acad Sci USA 1987;84:7242-7245. 17 Kingston A, Bergsteinsdottir K, Jessen K, et al: Schwann cells co-cultured with stimulated T cells and antigen express major histocompatibility complex (MHC) class 1I determinants without in-

Johnson/Pober

18

19

20

21

22

23

24

25

26

27

28

terferon-gamma pretreatment: Synergistic effects of interferon-gamma and tumor necrosis factor on MHC class II induction. Eur J Immunol 1989;19: 177-183. Arenzana-Seisdedos F, Mogensen S, Vuillier F, et al: Autocrine secretion of tumor necrosis factor under the influence of interferon-gamma amplifies HLA-DR gene induction in human monocytes. Proc Natl Acad Sci USA 1988;85:60876091. Campbell I, Oxbrow L, West J, et al: Regulation of MHC protein expression in pancreatic beta-cells by interferon-gamma and tumor necrosis factoralpha. Mol Endocrinol 1988;2:101-107. Campbell I, Harrison L: Viruses and cytokines: Evidence for multiple role in pancreatic beta cell destruction in type 1 insulin-dependent diabetes mellitus. J Cell Biochem 1989;40:57-66. Campbell I, lscaro A, Harrison L: IFN-gamma and tumor necrosis factor-alpha. Cytotoxicity to murine islets of Langerhans. J Immunol 1988; 141:2325-2329. Nawroth P, Bank I, Handley D, et al: Tumor necrosis factor/cachectin interacts with endothelial cell receptors to induce release of interleukin 1. J Exp Med 1986;163:1363-1375. Baglioni C, McCandless S, Tavernier J, et al: Binding of human tumor necrosis factor to high affinity receptors on HeLa and lymphoblastoid cells sensitive to growth inhibition. J Biol Chem 1985;260:13395-13397. Browning J, Ribolini A: Studies on the differing effects of tumor necrosis factor and lymphotoxin on the growth of several human tumor lines. J Immunol 1989;143:1859-1867. Hohmann H, Remy R, Brockhaus M, et al: Two different cell types have different major receptors for human tumor necrosis factor (TNF alpha). J Bio| Chem 1989;264:14927-14934. Gerlach H, Lieberman H. Bach R, et al: Enhanced responsiveness of endothelium in the growing/motile state to tumor necrosis factor/cachectin. J Exp Med 1989;170:913-931. Stauber G, Aiyer R, Aggarwal B: Human tumor necrosis factor-alpha receptor. Purification by immunoaffinity chromatography and initial characterization. J Biol Chem 1988;263:19098-19104. Pober J, Lapierre L, Stolpen A, et al: Activation of cultured human endothelial cells by recombinant lymphotoxin: Comparison with tumor necrosis

TNF Regulation of MHC Gene Expression

factor and interleukin 1 species. J Immunol 1987; 138:33 l 9-3324. 29 Dinarello C, Mier J: Current concepts: Lymphokines. N Engl J Med I987;317:940-945. 30 Leszczynski D: Interleukin-I alpha inhibits the effects of gamma-interferon and tumor necrosis factor alpha on the expression of the major histocompatibility antigens by the rat endothelium. Am J Pathol 1990;136:229-237. 31 Wong G, Goeddel D: Tumor necrosis factors alpha and beta inhibit virus replication and synergize with interferons. Nature 1986;323:819-822. 32 Aggarwal B, Eessalu T, Hass P: Characterization of receptors for human tumor necrosis factor and their regulation by gamma-interferon. Nature 1985;318:665-667. 33 Aggarwal B, Eessalu T: Induction of receptors for tumor necrosis factor-alpha by interferons is not a major mechanism for their cytotoxic response. J Biol Chem t 987;262:10000-10007. 34 Scheurich P, Kobrich G, Pfizenmaier K: Antagonistic control of tumor necrosis factor receptors by protein kinases A and C. Enhancement of TNF receptor synthesis by protein kinase A and transmodulation of receptors by protein kinase C. J Exp Med 1989;170:947-958. 35 Holtmann H, Wallach D: Down regulation of the receptors for tumor necrosis factor by interleukin 1 and 4-beta-phorbol- 12-myristate- 13-acetate. J Immunol 1987;139:1161-1167. 36 Aggarwal B, Eessalu T: Effect of phorbol esters on down-regulation and redistribution of cell surface receptors for tumor necrosis factor. J Biol Chem 1987;262:16450- 16455. 37 Unglaub R, Maxeiner B, Thoma B, et al: Downregulation of tumor necrosis factor (TNF) sensitivity via modulation of TNF binding capacity by protein kinase C activators. J Exp Med 1987;166: 1788-1797. 38 Fan X-D, Goldberg M, Bloom B: IFN-gammainduced transcriptional activation is mediated by protein kinase C. Proc Natl Acad Sci USA 1989; 85:5122-5125. 39 Mattila P, H~iyry P, Renkonen R: Protein kinase C is crucial in signal transduction during interferon-gamma induction in endothelial cells. Transplant Proc 1990;22:130-130. 40 Kindler V, Sappino A-P, Grau G, et al: The inducing role of tumor necrosis factor in the develop-

153

41

42

43

44

45

46

47

48

49

50

ment of bactericidal granulomas during BCG infection. Cell 1989;56:731-740. Leeuwenberg J, Van Damme J, Jeunhomme G, et al: Interferon beta t, an intermediate in the tumor necrosis factor alpha-induced increased MHC class I expression and an autocrine regulator of the constitutive MHC class I expression. J Exp Med 1987;166:1180-1185. Donato N, Gallick G, Steck P, et al: Tumor necrosis factor modulates epidermal growth factor receptor phosphorylation and kinase activity in human tumor cells. Correlation with cytotoxicity. J Biol Chem 1989;264:20474-20481. Hori T, Kashiyama S, Hayakawa M, et al: Possible role of prostaglandins as negative regulators in growth stimulation by tumor necrosis factor and epidermal growth factor in human fibroblasts. J Cell Physiol 1989;141:275-280. Snyder DS, Beller DI, Unanue ER: Prostaglandins modulate macrophage Ia expression. Nature 1982;299:163-165. Fujita T, Reis LFL, Watanabe N, et al: Induction of the transcription factor IRF-1 and interferon-J3 mRNAs by cytokines and activators of secondmessenger pathways. Proc Natl Acad Sci USA 1989;86:9936-9940. Bird T, Saklatvala J: Down-modulation of epidermal growth factor receptor affinity in fibroblasts treated with interleukin 1 or tumor necrosis factor is associated with phosphorylation at a site other that threonine 654. J Biol Chem 1990;IX265: 235-240. Bird T, Saklatvala J: IL-I and TNF transmodulate epidermal growth factor receptors by a protein kinase C-independent mechanism. J Immunol 1989;142:126-133. Zhang Y, Lin J-X, Yip Y, et al: Enhancement of cAMP levels and of protein kinase activity by tumor necrosis factor and interleukin l in human fibroblasts: Role in the induction of IL-6. Proc Natl Acad Sci USA 1988;85:6802-6805. Evans J, Mire-Sluis A, Hoffbrand A, et al: Binding of G-CSF, GM-CSF, tumor necrosis factor-alpha, and gamma-interferon to cell surface receptors on human myeloid leukemia cells triggers rapid tyrosine and serine phosphorylation of a 75-Kd protein. Blood 1990;75:88-95. Hori T, Kashiyama S, Hayakawa M, et al: Tumor necrosis factor is cytotoxic to human fibroblast in

I54

the presence of exogenous arachidonic acid. Exp Cell Res 1989; 185:41-49. 51 Lampugnani MG, Polentarutti N, Pedenovi M, et al: c-fos and c-myc expression in human endothelial cells as a function of different culture conditions. Exp Cell Res 1990;186:381-384. 52 Imamura K, Sherman M, Spriggs D, et al: Effect of tumor necrosis factor on GTP binding and GTPase activity in HL-60 and L929 cells. J Biol Chem 1988;263:10247-10253. 53 Brett J, Gerlach H, Nawroth P, et al: Tumor necrosis factor/cachectin increases permeability of endothelial cell monolayers by a mechanism involving regulatory G proteins. J Exp Med 1989; 169:1977-1991. 54 Chedid M, Shirakawa F, Naylor P, et al: Signal transduetion pathway for IL-l. Involvement of a pertussis toxin-sensitive GTP-binding protein in the activation of adenylate cyclase. J Immunol 1989;142:4301-4306. 55 Shirakawa F, Yamashita U, Chedid M, et al: Cyclic AMP - an intracellular second messenger for interleukin 1. Proc Natl Acad Sci USA 1988;85: 8201-8205. 56 Rosoff P, Savage N, Dinarello C: Interleukin-I stimulates diacylglycerol production in T lymphocytes by a novel mechanism. Cell 1988;54:73-81. 57 Laudanna C, Miron S, Berton G, et al: Tumor necrosis factor-alpha/cachectin activates the O2generating system in human neutrophils independently of the hydrolysis of phosphoinositides and the release of arachidonic acid. Biochem Biophys Res Commun 1990; 166:308-315. 58 Palombella V, Vilcek J: Mitogenic and cytotoxic actions of tumor necrosis factor in BALB/c 3T3 cells. Role of phospholipase activation. J Biol Chem 1989;264:18128-18136. 59 Brenner DA, O'Hara M, Angel P, et al: Prolonged activation o f j u n and collagenase genes by tumor necrosis factor-a. Nature 1989;337:661-663. 60 Lee W, Mitchell P, Tjian R: Purified transcription factor AP-I interacts with TPA-inducible enhancer elements. Cell 1987;49:741-752. 61 Rauscher F, Sambucetti L, Curran T, et al: Common DNA binding site for Fos protein complexes and transcription factor AP-1. Cell 1988;52:47148O. 62 Ziff E: Transcription factors: a new family gathers as the cAMP response site. Trends in Genetics 1990;6:69-72.

Johnson/Pober

63 Fukumoto Y, Kaibuchi K, Oku N, et al: Activation of the c-los serum-response element by the activated c-Ha-ras protein in a manner independent of protein kinase C and cAMP-dependent protein kinase. J Biol Chem 1990;265:774-780. 64 Baeuerle PA, Baltimore D, Ikappa B: A specific inhibitor of the NF-kappaB transcription factor. Science 1988;242:540-546. 65 Hoyos B, Balard DW, Bohnlein E, et al: Kappa B-specific DNA binding proteins: Role in the regulation of human interleukin-2 gene expression. Science 1989;244:457-460. 66 Cross SL, Halden NF, Lenardo M J, et al: Functionally distinct NF-kappaB binding sites in the immunoglobulin kappa and IL-2 receptor alpha chain genes. Science 1989;244:466-469. 67 Freimuth W, Depper J, Nabel G: Regulation of the IL-2 receptor alpha-gene. Interaction of a kappa B binding protein with cell-specific transcription factors. J Immunol 1989;143:30643068. 68 Muegge K, Williams T, Kant J, et al: Interleukin-I costimulatory activity on the interleukin-2 promoter via AP-I. Science 1989;246:249-251. 69 Shakhov A, Collart M, Vassalli P, et al: KappaB-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages. J Exp Med 1990;171:35-47. 70 Miyamoto M, Fujita T, Kimura Y, et al: Regulated expression of a gene encoding a nuclear factor, IRF-I, that specifically binds to IFN-beta gene regulatory elements. Cell 1988;54:903-913. 71 Hamada K, Gleason S, Levi B, et al: H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element. Proc Natl Acad Sci USA 1989;86:8289-8293. 72 Burke P, Hirschfeld S, Shirayoshi Y, et al: Developmental and tissue-specific expression of nuclear proteins that bind the regulatory element of the major histocompatibility complex class I gene. J Exp Med 1989;169:1309-1321. 73 Zachow K, Orr H: Regulation of HLA class I transcription in T cells. J Immunol 1989:143:33853389. 74 Israel A, Le Bail O, Hatat D, et al: TNF stimulates expression of mouse MHC class I genes by inducing an NFnB-like enhancer binding activity which

TNF Regulation of MHC Gene Expression

displaces constitutive factors. EMBO J 1989;8: 3793-3800. 75 Fan C-M, Maniatis T: A DNA-binding protein containing two widely separated zinc finger motifs that recognize the same DNA sequence. Genes Dev 1990:4:29-42. 76 Lenardo M J, Baltimore D: NF-kappaB: A pleiotropic mediator of inducible and tissue-specific gene control. Cell 1958;58:227-229. 77 Dedrick RL, Jones PP: Sequence elements required for activity of a murine major histocompatibility complex class II promoter bind common and cell-type-specific nuclear factors. Mol Cell Biol 1990;10:593-604. 78 Tsang SY, Nakanishi M, Peterlin BM: Mutational analysis of the DRA promoter: Cis-acting sequences and trans-acting factors. Mol Cell Biol 1990;10:711-719. 79 Kobr M, Reith W, Herrero-Sanchez C, et al: Two DNA-binding proteins discriminate between the promoters of different members of the major histocompatibility complex class II multigene family. Mol Cell Biol 1990;10:965-971. 80 Barber JR, Verma IM: Modification of Fos proteins: phosphorylation of c-Fos, but not v-Fos, is stimulated by 12-tetradecanoyl-phorbol-13-acetare and serum. Mol Cell Biol 1987;7:22012211. 81 Berk A J, Schmidt MC: How do transcription factors work. Genes Dev 1990;4:15 I-155. 82 Chiu R. Angel P, Karin M: Jun-B differs in its biological properties from, and is a negative regulator of, c-Jun. Cell 1989;59:979-986. 83 Schutte J, Viallet J, Nau M, et al: Jun-B inhibits and c-fos stimulates the transforming and transactivating activities of c-jun. Cell 1989;59:987997. 84 Yamamoto KK, Gonzalez GA, Menzel P, et al: Characterization of a bipartite activator domain in transcription factor CREB. Cell 1990;60:611617. 85 Gonzalez G, Yamamoto K, Fischer W, et al: A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequence. Nature 1989;337:749-752. 86 Ivashkiv LB, Liou H-C, Kara CJ, et al: mXBP/CRE-BP2 and c-Jun form a complex which binds to the cyclic AMP, but not to the 12o-tetradecanoylphorbot-13-acetate, response element. Mol Cell Biol 1990;t0:i609-1621.

I55

87 Lew D J, Decker T, Darnell JE Jr: Alpha interferon and gamma interferon stimulate transcription of a single gene through different signal transduction pathways. Mol Cell Biol 1989;9:5404-5411. 88 Lucibello F, Lowag C, Neuberg M, et al: Transrepression of the mouse c-fos promoter: A novel mechanism of Fos-mediated trans-regulation. Cell 1989;59:999-1007. 89 Perutz M: Control by phosphorylation. Nature 1988;336:202-203. 90 Marino M, Pfeffer L, Guidon P Jr, et al: Tumor necrosis factor induces phosphorylation o f a 28kD mRNA cap-binding protein in h u m a n cervical carcinoma ceils. Proc Natl Acad Sci USA 1989;86: 8417-8421. 91 Beutler B, Cerami A: The biology of cachectin/TNF - a primary mediator of the host response. Annu Rev Immunol 1989;7:625-655. 92 Rochette-Egly C, Fromental C, C h a m b o n P: General repression of enhanson activity by the adenovirus-2 EIA proteins. Genes Dev 1990;4:137150. 93 Eager K, Pfizenmaier K, Ricchiardi R: Modulation of MHC class I genes in A d l 2 transformed cells. IFN-gamma increases class I expression by a mechanism that circumvents E1A induced-repression and TNF enhances the effect of IFN-gamma. Oncogene 1988;4:39-44. 94 Havell E, Fiers W, North R: The antitumor function of tumor necrosis factor. J Exp Med 1988; 167:1067-1085. 95 Ghiara P, Boraschi D, Nencioni L, et al: Enhancement of in vivo immune response by tumor necrosis factor. J Immunol 1987;139:3676-3679. 96 Mauxion F, Sen R: Alteration of a single nucleotide allow efficient binding of H2TFI/KBFI to the immunoglobulin kappa enhancer motif. Mol Cell Biol 1989;9:3548-3552. 97 Yano O, Kanellopoulos J, Kieran M, et al: Purification of KBF1, a common factor binding to both H-2 and beta2-microglobulin enhancers. EMBO J 1987;6:3317-3324.

Dr. David R. Johnson Department of Pathology Brigham and Women's Hospital and Harvard Medical School Boston, MA 02115 (USA)