Molecular and Cellular Biochemistry 172: 47–57, 1997. © 1997 Kluwer Academic Publishers. Printed in the Netherlands.
47
Use of a hammerhead ribozyme with cationic liposomes to reduce leukocyte type 12-lipoxygenase expression in vascular smooth muscle Jia-Li Gu,1 Jerry Nadler1 and John Rossi2 1
Department of Diabetes, Endocrinology and Metabolism, City of Hope Medical Center, Duarte, CA 91010; 2Department of Molecular Biology, Beckman Research Institute of the City of Hope, Duarte, CA 91010, USA
Abstract Chemically synthesized hammerhead-type ribozymes targeted against the porcine leukocyte-type 12-lipoxygenase (LO) have been developed and studied. One chimeric ribozyme consists of DNA in the non-enzymatic portions, and RNA in the enzymatic core as well as two phosphorothioate internucleotide linkages at 3′ terminus. The second ribozyme consists of ribonucleotide sequences generated by in vitro transcription. In this chapter we describe methodologies to first analyze the ribozyme catalytic activity in vitro by studying cleavage of target RNA in vitro. The subsequent sections will describe how to target the catalytic ribozyme and deliver it to porcine vascular smooth muscle cells (PVSMC) by a liposome-mediated method. Finally ways to evaluate its activity to inhibit expression of the 12-LO mRNA will be presented. These results demonstrate the feasibility of using ribozymes as novel candidates for therapeutic agents to block specific gene expression in vascular cells. (Mol Cell Biochem 172: 47–57, 1997) Key words: smooth muscle, gene transfer, DNA, RNA, ribozyme, liposome, lipoxygenase, gene expression
Introduction Recent studies indicate that activation of a leukocyte-type 12lipoxygenase (12-LO) activity is involved in angiotensin II (A-II)-induced actions in vascular smooth muscle cells [1, 2]. The pharmacological inhibition of 12-LO activity can reduce All-induced cellular growth in VSMC [1]. Data indicates that at least two forms of 12-LO exist. One is the platelet-type which has been originally isolated and cloned from human platelets [3–6] and erythroleukemia cells [6, 7]. The other type of 12-LO has been isolated and cloned from porcine leukocytes [8, 9]. Both forms of 12-LO share 65% amino acid identity. Our recent studies show that the leukocyte-type 12LO exists in porcine VSMC (PVSMC) and that 12-LO expression and activity can be enhanced by All and glucose [10]. In addition, we have found that the 12-LO pathway mediates glucose induced PVSMC growth [11]. These data suggest that the 12-LO pathway plays a role in accelerated vascular disease mediated by high glucose and All in diabe-
tes mellitus. More recent studies in our lab demonstrate that the leukocyte-type 12-LO is expressed in human glomerulosa cells [12] and human aortic smooth muscle cell (HSMC) [13]. Despite this information, there are currently no specific pharmacological inhibitors that are selective for the leukocytetype 12-LO to utilize in further studying the role of 12-LO in vascular disease. Newly discovered RNA enzymes have been termed ribozymes by T. Cech et al. [14]. Soon afterwards the first active ribozymes were described [15–18]. Sequence analyses of the catalytic core and predicted secondary structures in the vicinity of the cleavage sites characterize two motifs of ribozymes; the hammerhead ribozymes and hairpin-type ribozymes. This chapter illustrates the use of hammerhead ribozymes. Recent exciting studies support the potential combined application of gene therapy and ribozyme technologies [19–21]. As examples, studies have demonstrated that antiviral and anticancer ribozymes are active against HIV type I virus in tissue culture using both hairpin ribozymes and
Address for offprints: J.L. Nadler, Department of Diabetes, Endocrinology and Metabolism, City of Hope Medical Center, 1500 East Duarte Road, Duarte, CA 91010, USA
48 hammerhead ribozymes [22–25] and a phase I clinical trial for ex vivo T-cell gene therapy has now begun. Oncogene transcripts such as the anti-bcr/abl fusion mRNA [26] and anti-fos [27], or ras [28] have also been targeted with ribozymes. In addition to their potential therapeutic application, ribozymes may also prove to be useful tools in basic investigations into protooncogene and tumor suppressor gene functions. The advantage of ribozymes versus traditional antisense oligonucleotides is its catalytic activity to cleave target mRNAs, thus lowering the concentrations of ribozyme required for reducing gene expression [19, 29] compared to antisense oligonucleotides. The structure of the transacting hammerhead motif of the ribozyme has been discovered and well characterized [30– 32]. The basic feature as shown by Haseloff and Gerlach [33] is a single stranded ribonucleotide of approximately 42 bases long with the 13 conserved bases and the flanking sequences that confer the specificity of its substrate. The predicted secondary structure in the vicinity of the cleavage sites consists of three stems I, II and III. The cleavage site is 3′ to the GUX↓ (X is C, U or A). GUC is the most efficiently cleaved sequence. Currently there are two general strategies to delivery of ribozymes to cells. One is to produce them endogenously in the target cells by introducing the ribozyme gene in conjunction with a viral vector, such as retrovirus [34–36]. Recent data has shown the utility of adenoviral-mediated delivery of an anti-cancer ribozyme [37]. In this chapter we present an alternative approach, an exogenous delivery of the chemically synthetic ribozyme molecules using liposomes. In this case, the advantage is that ribozymes can be chemically modified with phosphorothioate [38] or other groups [39] to make them more resistant to nuclease degradation while maintaining the ribozyme catalytic activity. Another approach to stabilizing synthetic ribozymes is to substitute DNA for RNA sequences comprising stems I, II and III while maintaining the obligatory RNA catalytic center [40, 41]. The synthesis of minimal RNA containing catalysis is more economical and simple than the synthesis of all-RNA ribozymes. The most commonly used method to introduce DNA into cultured cells is use of transfection techniques such as calcium phosphate, DEAE-Dextran, electroporation and cationic liposomes. The cationic liposomes such as Lipofectin ®, Transfectam® and DOTAP have recently been successfully used in ribozyme and antisense oligonucleotide studies [26, 29, 42–45]. The advantages of liposome-mediated methods over others are that liposomes can assist ribozyme and oligonucleotide delivery to cells by increasing the penetration of the nucleic acids into cells and can protect the ribozymes from degradation by serum nucleases. We have investigated the effect of a hammerhead ribozyme targeted to porcine leukocyte-type 12-LO. The 42-mer chimeric DNA-RNA ribozyme with two phosphorothioate link-
ages at the 3′ terminus has been designed to cleave the GUC sequence at nucleotide 7 of porcine leukocyte 12-LO RNA. The catalytic activity of the ribozyme was first tested in a cellfree system. The ribozyme then was introduced into primary cultured cells, PVSMC, by cationic liposome-mediated delivery method. Finally the effects of the ribozyme on 12-LO gene and protein expression were evaluated by polymerase chain reaction (PCR) and Western immunoblotting. These results support the feasibility of using new ribozyme technology to study the specific effects of gene pathways which may be involved in vascular disease.
Materials and methods Materials This section is to provide the information on the basic equipment and supplies needed to perform liposome-mediated ribozyme transfer into PVSMC. The materials listed are used in preparation of target RNA of the ribozyme, RNA transcription in vitro, ribozyme cleavage reaction, liposome-mediated ribozyme transfer, setting up the Western immunoblot for detecting protein, RT-PCR for RNA, and detecting the PCR product.
Equipment Freezer (–20°C), Freezer (–70°C). UV spectrophotometer to measure concentration of DNA, RNA and protein. Humidified, 5% CO2 incubator for tissue culture. Eppendorf centrifuge 5414 for precipitation of DNA, RNA or cell lysis. DNA Thermal Cycler used for automated PCR (Perkin-Elmer or M.J. Research), Microcentrifuge *for concentrate reaction at bottom of the tube (Stratagene). Pipettors*: adjustable Gilson P-10, P-20, P-200, P-1000, to prepare reagent or stock solutions. Horizontal agarose gel electrophoresis apparatus (Bio-Rad or Hoefer). Acrylamide gel electrophoresis apparature and glass plates, spacers and combs (Bio-Rad) for analytical gel. Power supply 100 mA, 500V (BioRad or Hoeffer). UV Transilluminator (American Scientific Products). Computerized video densitometer (Applied Imaging; Lynx DNA vision). Marked * items are dedicated to PCR experiments only.
Supplies and reagents Items for ribozyme delivery: Liposome reagents – Transfectam ® (Promega), OPTI-MEM reduced serum medium (Gibco BRL). Polystyrene tubes (Falcon) to prepare liposome reagent. Items for in vitro transcription: In vitro transcription kit (Promega). [α-32P]UTP, [γ-32P]ATP (DUPONT/NEN) and
49 T4 polynucleotide kinase (New England Biolabs) for mRNA internal and end labeling. Items for RT-PCR: Moloney murine leukemia virus reverse transcriptase (RT) at 200 u/ µl, 5 × RT buffer (Giboc BRL), Taq DNA polymerase at 5 u/ µl, 10 × PCR buffer (Perkin Elmer), four deoxynucleotide triphosphates (dNTPs): neutralized 100 mM solutions (Pharmacia) using 10 mM Tris-HCl, pH 7.5 as diluent to make 10 mM each dNTP. Random hexamer oligonucleotides (Pharmacia) 100 pmole/µl solution in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), Microfuge tubes: use only tubes specified for use in the Thermal Cycler. Gel analysis reagents: denaturing polyacrylamide (National digestion), acrylamide, bisacrylamide, TEMED (N,N,N′,N′,-Tetramethylethylenediamine), ammonium persulfate (Bio-Rad), NuSieve agarose (FMC Co.). For cell culture: Dulbecco’s Modified Eagle Medium (DMEM) high glucose formulation 4500 mg/L Dglucose (Gibco BRL). Fetal Calf Serum (FCS), TrypsinEDTA solution (Irvine, Scientific). General molecular biology reagents.
Methods Synthesis of ribozyme and oligodeoxynucleotides (oligos) Two hammerhead ribozymes targeted to cleave porcine 12LO mRNA at the same position, 3′ end of the first GUC site, are prepared using two strategies: (A) Chimeric DNA-RNA ribozyme (Rz-1). A synthesized 42 nucleotide (nt) chimeric DNA-RNA ribozyme containing 13 ribonucleotides in the highly conserved catalytic center and 29 deoxyribonucleotides in the rest of the molecule with two phosphorothioatedeoxyribonucleotide modifications at 3′ end. As controls for the ribozyme (Rz-1), a nonfunctional ribozyme (MRz-1) as well as sense (S) and antisense (AS) oligodeoxynucleotides located in the same region are also designed. The MRz-1 was identical to Rz-1 except that it had a single guanosine nucleotide replaced with adenosine nucleotide at position 5 in the catalytic center (according to numbering system for the hammerhead [46]) resulting in no functional cleavage activity [47]; The antisense oligonucleotide sequence also contained two phosphorothioate linkages at 3′ end. The sequences of these ribozymes and oligos are listed below. (B) RNA
Preparing Rz-2-encoding cDNA Two synthetic single-stranded oligodeoxyribonucleotides, oligo 51 and oligo 34, containing the ribozyme-encoding sequence and a 10 base overlapping complimentary sequence at their 3′ terminus are made. In addition, the sequence of a T7 RNA polymerase promoter is at the 5′ end of Oligo 51 (Fig. 1). To convert the single-stranded oilgonucleotides to double-stranded DNA one uses the Taq DNA polymerase and PCR profile which includes 5 cycles of 94°C denaturing for 30 sec, 32°C annealing for 30 sec and extending 72°C for 30 sec. The reaction is set by mixing 100 pmole of each oligonucleotide with the PCR buffer, 2.5 u Taq polymerase (Perkin Elmer), 200 µM dNTP in a final vol of 50 µl. The alternative strategy of conversion to double-stranded DNA is by using the Klenow fragment of E. Coli DNA polymerase I as described [48]. The product of 75 base pairs double-stranded cDNA of Rz-2 is purified by electrophoresis on a non-denaturing 10% polyacrylamide gel as described [49]; this then used for generating ribozyme Rz-2 by in vitro transcription with T7 RNA polymerase (see Materials and methods, section 3). Construction of Rz-2-encoding plasmid In order to facilitate construction of the Rz-2-encoding cDNA in an expression vector for expressing the ribozyme sequence we introduce a Hind III restriction site between sequences of T7 RNA polymerase promoter and the 5′ end of the ribozyme at the oligo 51, and a Sal I site at 5′ end of the oligo 34 (Fig. 1). The double-stranded cDNA is then digested with restruction enzymes Hind III and Sal I to produce the suitable 5′ and 3′-ends for ligation into a plasmid such as pGFP-NI (Clontech, Co). This positive clone is verified and the sequence of the insert is confirmed by DNA sequencing. The nonfunctional all-RNA ribozyme-2 (MRz-2) is identical to Rz-2 except that a single adenosine nucleotide is replaced with a guanosine nucleotide at position 13 in the catalatic center [46] resulting in no functional cleavage activity [47]. The sequences of all these oligo DNA are as follows in 5′ to 3′ (*represent sites of phosphorothioate internucleotide linkage; ribonucleotides are identified by bold letters):
ACGCGGTAGACUGAUGAGTCCGTGAGGACGAAACCCATCT* G*G ACGCGGTAGACUAAUGAGTCCGTGAGGACGAAACCCATCT *G*G CAAGATGGGTCTCTACCGCGT ACGCGGTAGAGACCCATCT*G*G -------
T7 RNA polymerase promoter
---------------
Rz- 1: MRz-1: S: AS:
ribozyme (Rz-2). Rz-2 contains all-ribonucleotide sequence generated from transcription of the Rz-2-encoding cDNA.
Hind III
Rz-2, oligo 51: AATTGTAATACGACTCACTATAGAAGCTTCGGTAGACTGATGAGTCCGTGA sal 1
Rz-2, oligo 34: CGATGTCGACGATGGGTTTCGTCCTCACGGACTC sal 1
MRz-2, oligo 34: CGATGTCGACGATGGGTTCCGTCCTCACGGACTC
50 (Stratagene) or pGEM-Z (Promega) can also be used. The orientation of 12-LO cDNA insert should be such that an in vitro transcription can produce 12-LO sense RNA. If vector DNA is digested with a single restriction enzyme, the DNA should be treated with calf intestinal alkaline phosphatase (CIAP, Boehringer Mannheim) to remove 5′ phosphate groups and prevent recircularization of the vector during ligation. The recombinant colonies are isolated and plasmid DNA prepared by the mini-prep protocol [48]. This procedure may be scaled up when larger amounts of DNA were needed. (B) Linearize the cDNA plasmid – As template DNA for in vitro transcription, the recombinant plasmid should be cut with a suitable restriction endonuclease in order to generate a linear DNA with a 5′ protruding end. We use EcoRI digestion of pcDNAIneo-12-LO plasmid at 142 nucleotide sequence of porcine 12-LO cDNA [9]. The complete digestion is needed and the enzyme removed after the digestion by extraction with phenol/chloroform. Fig. 1. Diagram of the all-RNA ribozyme synthesis using T7 RNA polymerase and synthetic deoxyoligonucleotides. The top strand oligo 51 contained T7 RNA polymerase promoter region marked by black box. Bottom strand oligo 34 is given 3′ to 5′ in order to pairing with the top strand.
All the oligos used in the study including PCR primers and probes of the porcine leukocyte-type 12-LO and GAPDH as described [12] are made with an automated DNA synthesizer (Applied Biosystems 380B) at City of Hope DNA synthesis laboratory. The methods of synthesis and purification of chimeric DNA-RNA ribozymes have been described by N.R. Taylor et al. [40]. The purity level required depends on the proposed use. For most applications such as PCR primers and probes, desalted oligos are sufficient. The oligos for delivery to cells are purified by HPLC. However, chimeric ribozymes require a high degree of purity. Thus the products are purified by HPLC followed by a denaturing polyacrylamide gel electrophoresis as described [49]. Eluted products from the gel are then ethanol-precipitated [49], rinsed twice with 70% ethanol, dried and resuspended in DEPC-treated H2O, and aliquots stored at –70°C. Preparation of target mRNA substrate The substrate mRNA is prepared by in vitro transcription using its cDNA and RNA polymerase (T3, T7 or SP6). The DNA can be prepared by multiple approaches: synthetic DNA oligo-PCR approach [27]; and DNA oligonucleotides-cloning approach [48, 50]; the cDNA plasmid cloning approach was used in our previous study [29] and is described below. (A) Preparation of cDNA plasmid clone – The full length of 12-LO cDNA is subcloned into the Sal I restriction site of the pcDNAIneo vector (Invitrogen) which contains T7 and SP6 RNA polymerase promoter by method of recombinant DNA [48]. Other vectors such as pBluescript™-KS+/SK+
mRNA transcription in vitro RNA transcription reaction and purification. A 206-base RNA containing the 176 bases (–34 to 142) of 12-LO mRNA and a portion of the plasmid sequence is transcribed from linearized pcDNAIneo-12LO plasmid with SP6 RNA polymerase (Promega). The procedure is described by Promega: 4 µl of 5 × transcription buffer, 2 µl of 100 mM DTT, 4 µl of 2.5 mM each of rNTP (made by mixing together equal amount of rATP, rCTP, rGTP, rUTP), 0.8 µl RNasins (RNase inhibitor, 25 u/µl, Promega), 1 µg linearized DNA template, 1 µl SP6 RNA polymerase and DEPC treated water are mixed to a final volume of 20 µl. After incubation at 37°C for 1 h, 1 u of RNase-free DNase (Promega) is added to degrade the template DNA. The unincorporated nucleotides and template DNA are removed by the standard procedures [49]. Briefly, the reaction mixture is subjected to 5% (concentrations are depending on the size of RNA fragment) polyacrylamide/7 M urea gel electrophoresis at 12 V/cm for 3 h. The gel is stained in ethidium bromide solution (0.5 µg/ml). The RNA fragment then is excised under the UV light and eluted from the gel slice via diffusion in a solution of 0.3 M NaOAC, 0.1% SDS and 1 mM EDTA at 37°C incubation for over night. The incubated mixture is filtered in a Costar spin-X filter and the solution is precipitated with Ethanol and dissolved in DEPCtreated water and stored at –20°C until use. Two types of radiolabeled RNA are used in our study, internally-labeled or 5′ end labeled: (1) Internally-radiolabeled RNA is prepared during transcription. Procedures are the same as above except that the reaction contains 250 ng linear DNA plasmid and 5 µl of [α-32P] UTP (800 Ci/mmol, New England Nuclear). After incubation at 37°C for 2 h, then purification is similar to described above with a modification at the staining step which is replaced by exposure gel with X-ray film (Kodak X-Omat AR film, Kodak Co.). The transcribed RNA
51 fragment is located by autoradiography and excised, eluted as above. (2) End labeled RNA is made by dephosphorylation of the purified transcript RNA with calf intestinal alkaline phosphatase (Boehringer Mannheim) then labeling with [γ-32P] ATP (6000 Ci/mmol, New England Nuclear) and T4 polynucleotide kinase (New England Biolabs) [48]. Ribozyme cleavage reaction The standard cleavage reaction is carried out as described [51]. The 10 × fold reaction buffer is premade (500 mM TrisHCl, pH8, 20 mM MgCl2) and aliquots stored at –20°C. The ribozyme (0–400 ng) and 32P-labeled substrate RNA (5 × 104– 105 cpm) with 1 µl 10 × fold reaction buffer and DEPC-treated water are mixed in a final volume of 10 µl, and incubated at 37°C for 30 min to overnight. The antisense oligonucleotide, and non-functional ribozyme are run in parallel. Reaction is stopped by addition of an equal volume of 80% formamide loading buffer [49]. Samples are heated to 85°C for 3 min in order to denature the ribozyme-cleavage product complexes then chilled on ice and analyzed on denaturing 10% polyacrylamide/7 M urea gel electrophoresis in 1 × TBE buffer at 15 V/cm for 3 h. Then the gel is dried and exposed to the X-ray film at –70°C for about 20 h. Culture of PVSMCs PVSMCs are isolated from aortas as described [11]. Cells are maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 25 mM glucose and 10% FCS, 100 U/ml penicillin/100 µg/ml streptomycin. Cells are passaged using trypsinEDTA and used for experiments from passage 2–6. Cationic liposomes mediated ribozyme delivery We use the cationic liposome-mediated transfection procedure to deliver the ribozyme into cells. The oligo/liposome complex is added directly to medium in tissue culture plates and after the incubation period, fresh serum is added. The cells are incubated to allow oligos to pair with their target mRNA, then transfected cells are harvested and assayed for the signal phenotype of interest. Basic protocol. (1) Preparation of cells. The day before the transfection experiment exponentially growing PVSMCs are plated in 60 mm tissue culture dishes according standard protocols at 2.5–3 × 105 cells/dish and grown overnight in a humidified 5% CO2 incubator at 37°C to yield approximately 50–70% confluency on next day of transfection. (2) Preparation of oligos. As stringent controls for ribozyme specific activity in cells, DNA antisense, DNA sense, and modified inactive ribozyme are run in each experiment. All oligos are highly purified as described above and sterilized through a 0.2 µM filter and then stored as aliquots in a small volume in –70°C. (3) Preparation of the liposome/oligos mixture is performed as suggested by the manufacture of liposome
products. In this study the liposome used is Transfectam® reagent (Promega). 1–4 µM oligos were diluted in 500 µl OPTIMEM 1 reduced-serum medium (Gibco BRL) in a sterile tube and votexed. In a polystyrene sterile tube mix 37.5 µg of Transfectam® reagent with 500 µl OPTI-MEM 1 reducedserum medium. Then oligo solution is added into transfection reagent tube and mixed with a pipette. The mixture is immediately added to prepared cells. Cells are washed three times with 4 ml OPTI-MEM serum reduced medium and precultured in OPTI-MEM for 1 h, then OPTI-MEM is aspirated. To each dish 0.5 ml fresh OPTI-MEM and 1 ml oligo/liposome complex are directly added to the cells. The final volume is 1.5 ml. After a 4 h incubation in a CO2 incubator at 37°C, an additional 0.5 µM oligo and OPTI-MEM/FCS are added to make a final volume of 3 ml and 4% of FCS. Then after 22 and 40 h incubation time an additional 0.25 µM oligo is added, respectively. (4) OPTI-MEM/oligo/liposome was aspirated from a culture dish and cells are harvested at 48 h for RNA extraction and at 72 h for immunoblotting assay to evaluate whether the RNA and protein were blocked. Control cells are treated identically without oligos. Total RNA isolation The method of total RNA isolation is based on a single-step method [52]. A new and substantially improved version of the single-step method is RNA STAT-60TM (TEL-TEST‘B’, Inc.) or RNAzol (Cinnai/Biotecx Laboratories International Inc.). The RNA isolated can be directly used for PCR. These procedures are provided by the manufacturer. Briefly, for RNA STAT-60TM, culture medium is aspirated, 1 ml RNA STAT-60TM reagent is directly added into the dish and cells homogenized with repetitive pipetting. The lysis solution is transferred to a fresh eppendorf tube and stored for 5 min at room temperature, then 0.2 ml of chloroform is added and centrifuged at maximum speed (Eppendorf centrifuge 5415) at 4°C for 15 min. The aqueous phase is collected and mixed with 0.5 ml of isopropanol. The RNA is precipitated and dissolved in 10–15 µl of DEPC-treated H2O. The concentration of RNA can be determined by absorption at wavelengths of 260 nm on the spectrophotometer. The expected yield of total RNA is 3–7 µg/106 PVSMCs. Amplification of RNA The level of 12-LO mRNA in PVSMCs is very low; we are unable to detect 12-LO RNA by Northern analysis. We therefore, use reverse transcriptase (RT)-PCR technique. The details of this method were described previously [12, 29]. (a) Reverse transcriptase (RT) reaction: To eliminate DNA contamination the RNA samples are treated with RNase-free DNase (Promega) as described [48]. 1 µg of sample RNA in 10 µl DEPC-treated H2 O and 1 µl of 50 pmole random hexamer (Pharmacia) are mixed and incubated at 65°C for 5 min, then cooled down slowly to room temperature. The
52 following reagents: reverse transcriptase buffer (Gibco BRL), 10 mM DTT, 0.125 mM of each dNTP, 2 units of RNasin (Promega), and 200 units of Moloney murine leukemia virus reverse transcriptase (Giboc BRL) are added with a final volume of 20 µl. The mixture is incubated for 60 min at 37°C followed by heating at 95° for 5–10 min, then quick-chill on ice to denature the RNA-cDNA hybrid and inactivate the reverse transcriptase, and stored at –20°C. The reaction mixture without RT is taken as a negative control. (b) PCR amplification: The standard PCR reactions are prepared by mixing 4 µl of heat-treated reverse transcriptase reaction solution (equivalent to 200 ng RNA), in PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin), 2.5 u Taq polymerase, 25 pmole of each 5′ and 3′ PCR primers, 200 µM each dNTP in a final volume of 50 µl. The thermal cycle profile is 94°C for 5 min, 30 cycles of denaturing for 1 min at 94°C, annealing primers for 2 min at 50°C, extending the primers for 2 min at 72°C, then 8 min at 72°C and performed in a DNA Thermal Cycler 480 (Perkin-Elmer). PCR cycle number required depends on the abundance of the target. The annealing temperatures varied between 50–65°C that depends on the contents of G-C pairs of the PCR primers and many other parameters. To normalize the relative efficiency of cDNA synthesis and efficiency of PCR amplification from each sample the internal standard GAPDH gene is co-amplified with 12-LO gene, in the same tube, using 5 pmol each of 5′ and 3′ primers for GAPDH, 25 pmol each for 12-LO [12]. (c) Analysis of amplification products by Southern blot. 20 µl aliquots of PCR product are applied to a 1.8% agarose gel made in TAE buffer and subjected to electrophoresis. The 123-bp DNA Ladder (Gibco BRL) is used as a convenient marker for size estimates of the products. The gel is stained with ethidium bromide and a photograph is taken on UV Transilluminator and transferred onto a Zeta-Probe membrane (Bio-Rad) in 0.5 N NaOH by capillary blotting, and hybridized with 12-LO probe which is labeled at the 5′ end with [γ-32P] ATP (6000 Ci/mmole, New England Nuclea) and T4 polynucleotide kinase (New England Biolabs) overnight in 6 × SSC, 0.5% nonfat dried milk, and 7% SDS at 42°C. Membrane is then washed once in 6 × SSC at room temperature for 15 min and once at 60°C for 15 min and exposed to Kodak X-ray film with an intensifying screen at –70°C. The autoradiogram is quantified using a computerized video densitometer. Analysis of stability of the ribozyme For intracellular stability assay: 32P-labeled ribozyme is prepared by 5′-end labeling method with [γ-32P] ATP and T4 DNA polymerase as described above. A 2.5 × 106 cpm 32Pribozyme is introduced into PVSMCs by the Transfactamdelivery protocol. At 1, 6, 18, 24 and 42 h after transfection, RNA is extracted and subjected to electrophoresis on 20% polyacrylamide denaturing gel then autoradiography.
To examine the stability of the ribozyme in cell-free serum: As described [29, 53] 5 µl of 32P-labeled ribozyme (1 × 106 cpm) is preheated at 90°C for 1 min and chilled on ice, mixed with 10 µl of cell culture supernatant containing DMEM/10% FBS in the presence or absence of 0.5 µg of Transfectam® reagent and incubated at 37°C. At indicated time points samples are analyzed on denaturing polyacrylamide gel as above. Western immunoblotting assay Cells are washed with cold PBS for three times and scraped and collected in 15 ml centrifuge tube by centrifugation at 800 rpm for 10 min. The supernatant is removed thoroughly. The cell pellets are lysed in phosphate-buffered saline (pH 7.4) with 50 µM leupeptin, 0.2 mM phenylmethylsulfonyl fluoride, 5 µg/ ml aprotinin, 1% Triton X-100, and 0.1% SDS. Cell lysates were centrifuged at 5,000 × g (Eppendorf centrifuge 5414) for 10 min. Protein assay is performed by Brandford method [54] with Sigma Coomassie Brilliant Blue G-250 (Sigma). 20 µl aliquots of 25–50 µg protein with Laemmli sample buffer are heated at 95°C for 5 min, applied then to a SDS-polyacrylamide gel (8%) and electrophoresed in Tris-glycine buffer, pH 8.3 at 25 mA constant current for 1.5 h. The proteins are then transferred to polyvinylidene membrane (Bio-Rad) using a semidry blotting apparatus (Hoeffer Instruments) for 60 min. The nonspecific antibody binding is blocked by incubating the polyvinylidene membranes in a blocking buffer provided by Tropix (Bedford) for 60–90 min at room temperature. The blot is then incubated overnight at 4°C with a 1: 400 dilution polyclonal antibody to a specific porcine leukocyte-type 12LO peptide at amino acid sequence 39–55. The antibody has been characterized previously for evaluation of 12-LO expression [12]. The blot is washed in cold PBS, incubated with an alkaline phosphatase-conjugated secondary antibody at a 1:20,000 dilution, and visualized by chemiluminescence using CSPD brand substrate (Chemiluminescent substrate for alkaline phosphate) and the Western-Light Chemiluminescent detection system (Tropix Inc.).
Results The specific design of the ribozymes The hammerhead ribozymes are designed to target the porcine leukocyte 12-LO mRNA and to cleave after the nucleotide C residue in the first GUC triplet at position 5–7 (numbering according to ref. [9]) (Fig. 2). The two ribozymes contain identical base sequences, but differ in their DNA-RNA contents and the length of the flanking sequence which is complementary to the porcine leukocyte 12-LO mRNA at either site of the cleavage site GUC, position –4 to 17 [9]. The leukocyte 12LO ribozymes are unable to cleave the platelet-form of 12-LO mRNA because of different sequences in the platelet form of
53
Fig. 2. The sequence of the porcine leukocyte 12-LO DNA-RNA chimeric ribozyme (Rz-1) and the complementary sequence from nucleotide –4 to nucleotide 17 of 12-LO mRNA. The ribozyme (bottom) cleaves the GUC site of leukocyte type 12-LO mRNA (top) as indicated by arrow. Ribonucleotides of ribozyme are underlined. Phosphorothioate linkages are marked *S. (From J. Gu et al. Ref. [29]).
12-LO mRNA at the position of –4 to 17 [7]. The Rz-1 structure is a 42-nucleotide chimeric DNA-RNA with two phosphorothioate linkages at the 3′ end. The catalytic center contains 13 ribonucleotides, whereas the stem-loop II and the two flanking sequences (10 nt each) are deoxyribonucleotide (Fig. 2). This structure is demonstrated to have improved stability. The Rz-2 structure is a 36-nucleotide all-RNA ribozyme including 7 nt in each flanking sequence. It was generated by in vitro transcription from synthesized Rz-2-encoding double stranded DNA with T7 RNA polymerase.
In vitro ribozyme cleavage reactions As shown in Fig. 3 the transcribed 206-base 12-LO mRNA substrate is cleaved into two fragments of 135 bases and 71 bases by ribozymes (Rz-1 and Rz-2) at the physiological temperature of 37°C. The sizes of fragments are consistent with the predicted size. No cleavage occurs in the absence of magnesium or ribozyme as shown in Figs 3 and 4. The amount of cleavage product increases with increased ribozyme addition (Fig. 4). Neither the antisense oligonucleotide (Fig. 4B, lane 2) nor the nonfunctional ribozyme (Fig. 3) produces any cleavage products. The time course of the reaction shows that the cleavage product formation is detected after 15 min of incubation and with more product with increased time of the reaction (Fig. 5). To assess the optimum temperature of reaction, we performed reactions at temperatures from 25–65°C (Fig. 5). The optimal temperature for 12LO mRNA cleavage is at 37°C. At 42°C the amount of product is diminished; at 55°C, no cleavage products are detected.
Stability of the ribozyme The analysis of stability of the ribozyme (RZ-1) shows that it rapidly degrades in cell culture supernatant (Fig. 6A) due
Fig. 3. Autoradiograph of in vitro cleavage reactions. 32P-UTP internal labeled porcine leukocyte 12-LO mRNA substrate (206 bases) of 5 × 104 cpm is incubated at 37°C for overnight with certain amount of ribozymes: 50 ng of Rz-1, Rz-2 and MRz-2 in lanes Rz-1, Rz-2a and MRz-2 respectively; 5 ng of Rz-2 in lane Rz-2b; absence of ribozymes in lane substrate alone. The reactions are analyzed on denaturing 10% polyacrylamide gel.
to its susceptibility to serum and cytoplasmic nuclease activity. However Transfactam ® reagent markedly prolongs the time when the ribozyme remains intact in cell free media or inside the cells (Figs 6B and 6C).
The effects of ribozyme (Rz-1) on porcine leukocyte-type 12-LO expression With PCR analysis the 333 bp 12-LO PCR fragment is detected on autoradiograms while the 284 bp internal standard GAPDH PCR fragment is visible on ethidium-brodium stained agarose gel (Fig. 7). We observe that 2 µM of ribozyme almost completely inhibits 12-LO mRNA expression compared with control cells treated with the same reagents but without the ribozyme or oligos. However, at this same concentration, neither the antisense nor sense oligos inhibit 12-LO mRNA. Increasing the concentration of antisense oligo to 4 µM inhibits 12-LO mRNA by 80%. At the same concentration of 4 µM, the nonfunctional ribozyme shows less inhibition than the ribozyme (Fig. 7A). In addition, the ribozyme-induced inhibition of 12-LO mRNA is also dose dependent with definite inhibition seen at concentrations of ribozyme as low as 1 µM (Fig. 7B). In 12-LO protein immunoblot analysis, a distinct band was detected with a molecular mass of nearly 72 kD which is the same size as the purified porcine leukocyte-type 12-LO protein. We observe that 4 µM of ribozyme inhibited 50% of 12LO protein. In contrast, 12-LO protein expression is only slightly reduced by the modified ribozyme (Fig. 8).
Discussion Design of optimal ribozymes was previously discussed in
54
Fig. 4. (A): Dose-dependent cleavage of ribozyme. Reactions are performed by using 1 × 105 cpm of 32P-internal labeled substrate, 206 base porcine leukocyte 12-LO mRNA and increasing amounts of Rz-1 from 10 ng, 25, 50, 100, 200 to 400 ng (from lanes 8 to 3). Lanes 1 and 2 are in the absence of magnesium and ribozyme, respectively; (B): Specific Rz-1 cleavage reaction. Substrate porcine leukocyte 12-LO mRNA 206 base is 5′-end labeled. Reactions are performed in the absence of ribozyme (lane 1), with 100 ng of antisense oligo (lane 2) or ribozyme-1 (lane 3). The 5′ cleavage product 71 base is seen in lane 3 (From J. Gu et al. Ref. [29]).
Fig. 5. Time course and incubation temperatures of the ribozyme reaction are analyzed by autoradiograph of polyacrylamide gel electrophoresis. A 5 × 104 cpm of 32P-internal labeled substrate is incubated with 25 ng of Rz-1 either at 37°C for the given time points or at indicated temperatures for overnight. (From J. Gu et al. Ref. [29]).
several excellent reviews [55, 56]. We have used a hammerhead motif ribozyme in our study because it was a small molecule and well characterized, thus easy to manipulate. The cleavage site on the target molecule was chosen to be the first GUC sequence of porcine leukocyte 12-LO mRNA. Since a target mRNA contains more than one 5′-GUC-3′ sequence one question was which GUC sequence should be selected. A computer program may provide some structural information [57, 58] revealing whether a cleavage region is buried
in secondary or tertiary structures which will impair ribozyme activity. It may be necessary to design several ribozymes targeting different potential cleavage sites to test their relative effectiveness. In addition a potentially novel design approach was recently developed using a ribozyme anchor to overcome an obstruction caused by the secondary structure around a cleavage site [59]. The total length of two flanking nucleotides of the cleavage site was 20 nt in our first study on Rz-1. Recently we have successfully shortened the total flanking nucleotides to 14 nt (Rz-2) and shown extremely potent catalytic activity in the cell-free cleavage reaction. The length of flanking nucleotides affects the target specificity and the rate of dissociation of cleavage product from ribozyme [55]. To enhance the ribozyme stability within the cells we have used chimeric DNA-RNA ribozyme (Rz-1 ) and two phosphorothioate modifications at the 3′ end. Our results are consistent with others studies [26, 29, 41, 60]. The success of delivery by cationic liposomes is affected by a few primary parameters: the concentration of lipid and oligonucleotides (oligos) as well as incubation time of the liposome-oligo complex. In general, increasing the concentration of lipid and the length of time of exposure of the liposomeoligo complex to the cells improve transfer to cells. However, prolonged time of exposure or high concentration of either the liposome or oligo can be toxic to cells. We observed that the cells rounded up with over 5 h of exposure or with over 60 µg of transfection reagent in PVSMC. A variety types of cationic liposomes have been used in transfecting a wide range of cells. We have used Transfectam® reagent in this study. The DOTAP
55
Fig. 6. Stability of Rz-1 in cell-free (A and B) and in PVSMCs (C). Experimental details are described in Materials and methods. 32P-end labeled ribozyme is incubated as described and samples are taken at the indicated time points. (A): With supernatant of cultures PVSMCs; (B): Same media as (A) with additional Transfectam® reagent; (C): With cultured PVSMCs in the presence of medium and Transfectam® reagent. Time marked on top represents hours post transfection (From J Gu et al. Ref. [29]).
Fig. 7. Analysis of Rz-1 effect on porcine leukocyte type of 12-LO mRNA level in PVSMCs. Transfection is carried out as described in the Materials and methods section under ‘ribozyme delivery’. Porcine leukocyte type of 12-LO mRNA levels are determined by RT-PCR. Top, autoradiograms of Southern blots hybridized with the porcine leucocyte 12-LO probe. Bottom, ethidium bromide stained agarose gels which show amplified GAPDH product (284 bp). Total RNA is extracted from PVSMCs treated with ribozymes or oligos. Rz indicates intact ribozyme (Rz-1), MRz is the nonfunctional ribozyme (MRz-1), AS is antisense oligo DNA, S is sense oligo DNA. (A): Lanes 1–4; 5–9 and 10–12 are from three separate experiments. Lanes 3, 5 and 12 are control; lanes 1, 2, 4, 7, 9 are treated with 2 µM; lanes 6, 8, 10 and 11 are treated with 4 µM of oligos or ribozymes. The 12-LO bands in arbitrary units: from lanes 1–4: 1.82, 32.74, 34.63, 30.81; lanes 5–9; 40.29, 4.16, 4.99, 9.79, 40.7; lanes 10–12: 40.71, 6.98, 52.32. (B): dose-dependent effect of intact ribozyme on 12-LO mRNA level. Lanes 2 through 6, are 4, 2, 1, 0.5, 0.25 µM ribozyme, respectively; lane 1, Transfectam® reagent alone. Results are representative of two similar experiments (From J. Gu et al. Ref. [29]).
reagent has also been used for gene delivery to cultured human vascular smooth muscle cells [44] as well as antisense oligonucleotides to cultured human leukemic T-lymphoblasts cells and human colon adenocarcinoma cells [45]. The advantage of DOTAP reagent is that it is suitable for the transfer of oligos at about half the cost of Transfectam®. DC-chol/DOPE [61], a novel cationic liposome reagent, recently was developed for gene transfer to patients [62]. Since porcine 12-lipoxygenase mRNA expression level in PVSMCs is low, methods of northern blot and RNase protection assays are not useful to follow 12-LO RNA expression [10]. Therefore, sensitive methods for detection and
analysis of RNA molecules are an important aspect of the studies. We have used here an extremely small amount of template RNA which can be amplified by the use of combined complementary DNA (cDNA) and PCR methodologies. In summary we have described the synthesis and use of two hammerhead types of ribozymes to target a potentially important gene pathway linked to vascular disease. In particular a chimeric type of ribozyme was efficiently and effectively delivered to VSMC using liposomes illustrating the utility of this approach in vascular tissue. In general, any gene whose sequence is known should be amenable to targeting by ribozymes. The highly sequence specific cleavage activity of
56
Fig. 8. Western blot analysis of porcine leucocyte 12-LO inhibition by ribozyme (Rz-1). The cellular protein is extracted from PVSMCs that has been treated with 4 µM of the intact Rz-1 (lane 3) or modified ribozyme MRz-1 (lane 2). The Western blot analysis is performed as described in the Materials and methods section. The top band represents 72 kDa 12-LO. Western analysis often show a slightly lower band in PVSMCs. Both bands can be blocked by preincubating the 12-LO antibody with the porcine leucocyte 12-LO peptide against which this antibody was raised, suggesting that the lower band also derives from 12-LO. Both the upper and lower 12LO band intensities are reduced by the intact ribozyme, whereas the modified catalytic negative ribozyme is less effective. The ODs of the 12-LO bands, in arbitrary units were control, 42.58; MRz, 35.36; Rz, 22.05. The results shown are representative of 3 separate experiments. Each lane contains 50 µg of protein except the standard lane which contains 0.8 µg of partially purified authentic porcine leukocyte 12-LO (Oxford Biomedical Research Inc.) (From J. Gu et al. Reference [29]).
ribozymes suggesting that ribozymes could provide a useful approach to gene analysis using these protocols. Ribozymes also could be used for in vitro manipulation of RNAs. In the future one may utilize the introduction of a chimeric ribozyme or expression of ribozyme sequences in gene therapy in humans.
Acknowledgements This work was supported by the American Heart Association, Los Angeles Affiliate, Grant-in-Aid 1030 G1-1 (to Dr. Gu) and National Institutes of Health Grants R01-DK-39721 and P01HL 55798 (to Dr. Nadler) AI29329 and AI25959 (to Dr. Rossi) and Juvenile Diabetes Foundation International (to Dr. Nadler). The authors would like to thank the excellent technical assistance of Dr. Veerapanane D., Dr. Natarajan R., Dr. Wei B., and Thomas L. We acknowledge the excellent secretarial assistance of Almira S. Fontanilia in preparation the manuscript.
References 1. Natarajan R, Gonzales N, Lanting L, Nadler JL: Role of the lipoxygenase pathway in angiotensin II-induced vascular smooth muscle cell
hypertrophy. Hypertension 23 (suppl. I): I142–I147, 1994 2. Stern N, Golub M, Nozawa K, Berger M, Knoll E, Yanagawa N, Natarajan R, Nadler JL, Tuck M: Selective inhibition of angiotensin II-mediated vasoconstriction by lipoxygenase blockade. Am J Physiol 257: H434–H443, 1989 3. Hamberg M, Samueisson B: Prostagladin endoperoxides. Novel transformations of arachidonic acid in human platelets. Proc Natl Acad Sci USA 71: 3400–3404, 1974 4. Nugteren DH. Arachidonate lipoxygenase in blood platelets. Biochem Biophys Acta 380: 299–307, 1975 5. Izumi T, Hoshiko S, Radmark O, Samuelsson B: Cloning of the cDNA for human 12-lipoxygenase. Proc Natl Acad Sci USA 87: 7477–7481, 1990 6. Funk CD, Furci L, FitzGerald GA: Molecular cloning primary structure, and expression of the human platelet/erytholeukemia cell 12lipoxygenase. Proc Natl Acad Sci USA 87: 5638–5642, 1990 7. Yoshimoto T, Yamamoto Y, Arakawa T, Suzuki H, Yamanoto S, Yokoyama C, Tanabe T, Toh H: Molecular cloning and expression of human arachidonate 12-lipoxygenase. Biochem Biophys Res Commun 172: 1230–1235, 1990 8. Yoshimoto T, Miyamoto Y, Ochi K, Yamamopto S: Arachidonate 12lipxogyenase of porcine leukocyte with activity for 5-hydroxyeicosatetraenoic acid. Biochem Biophys Acta 713: 638–646, 1982 9. Yoshimoto T, Suzuki H. Yamamoto S, Takai T, Yokoyama C, Tanbe T: Cloning and sequence analysis of the cDNA for arachidonate lipoxygenase of porcine leukocytes. Proc Natl Acad Sci USA 87: 2142– 2146, 1990 10. Natarajan R, Gu J, Rossi J, Gonzales N, Lanting L, Xu L, Nadler JL: Elevated glucose and angiotensin II increase 12-lipoxygenase activity and expression in porcine aortic smooth muscle cells. Proc Natl Acad Sci USA 90: 4947–4951, 1993 11. Natarajan R, Gonzales N, Xu L, Nadler JL. Vascular smooth muscle cells exhibit increased growth response to elevated glucose. Biochem Biophys Res Commun 187: 552–560, 1992 12. Gu J, Natarajan R, Ben-Zzra J, Valente G, Scott S, Yoshimoto T, Yamamoto S, Rossi J, Nadler JL: Evidence that a leukocyte type of 12-lipoxygenase is expressed and regulated by angiotensin II in human adrenal glomerulosa cells. Endocrinology 134: 70–77, 1994 13. Kim J, Gu J, Natarajan R, Berliner J, Nadler JL: A leukocyte type of 12-lipoxygenase is expressed in human vascular and mononuclear cells-evidence for upregulation by angiotensin II. Thromb Vasc Biol 15: 942–948, 1995 14. Kruger K, Grabowski PJ, Zang AJ, Sands J, Gottschling DE, Cech TR: Self-splicing RNA:autoexcision and autocyclization of the ribosomal RNA intervening sequence of tetrahymena. Cell 31: 147–157, 1982 15. Guerrier-Takada C, Gardiner K, Marzch T, Pace N, Altman S: The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell 35: 849–857, 1983 16. Cech TR, Bass BL: Biological catalysis by RNA. Annu Rev Biochem 55: 599–629, 1986 17. Cech TR: The chemistry of self-splicing RNA and RNA enzymes. Sci 236: 1532–1539, 1987 18. Cech TR: Self-splicing of group 1 introns. Annu Rev Biochem 59: 543–568, 1990 19. Altman S: RNA enzyme-directed gene therapy. Proc Natl Acad Sci USA 90: 10898–10900, 1993 20. Poeschla E, Wong-Staal F: Antiviral and anticancer ribozymes. Curr Op in Onc 6: 601–606, 1994 21. Rossi JJ, Cantin EM, Sarver N, Chang PF: The potential use of catalytic RNAs in therapy of HIV injection and other disease. Pharmacol Ther 50: 245–254, 1991 22. Yu M, Ojwang J, Yamado O, Hampel A, Rappaport J, Looney D, Wong-Staal F: A hairpin ribozyme inhibits expression of diverse strains
57
23.
24.
25.
26.
27.
28.
29.
30. 31. 32. 33. 34.
35.
36. 37.
38.
39.
40.
41.
42.
of human immunodeficiency virus type 1. Proc Natl Acad Sci USA 90: 6340–6344, 1993 Yamad O, Yu M, Yee JK, Kraus G, Looney D, Wong-Staal F: Intracellular immunization of human T-cells with a hairpin ribozyme against human immunodeficiency virus type 1. Gene Therapy 1: 38–45, 1994 Sarver M, Cantin E, Chang PS, Ladne PA, Stephens DA, Zaia JA, Rossi JJ: Ribozyme as potential anti-HIV-1 therapeutic agents. Sci 247: 1222–1225, 1990 Rossi J, Elkins D, Zaia J, Sullivan S: Ribozymes as anti-HIV-A therapeutic agents: principles, applications, and problems. AIDS Res Hum Retroviruses 8: 183–189, 1992 Snyder DS, Wu Y, Wang JL, Rossi JJ, Swiderski P, Kaplan BE, Forman SJ: Ribozyme mediated inhibition of bcr-abl gene expression in a philadelphia chromosome-positive cell line. Blood 82: 600–605, 1993 Scanlon KJ, Jiao L, Funato T, Wang W, Tone T, Rossi JJ, KasahaniSabet M: Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein. Proc Natl Acad Sci USA 88: 10591–10595, 1991 Kashani-Sabet M, Funato T, Florenes VA, Fodstad O, Scanlon KJ: Suppression of the neoplastic phenotype in vitro by an anti-ras ribozyme. Cancer Res 54: 900–902, 1994 Gu J, Veerapanae D, Rossi J, Natarajan R, Thomas L, Nadler JL: Ribozyme-mediated inhibitor of expression of leukocyte-type 12lipoxygenase in porcine aortic vascular smooth muscle cells. Circ Res 77: 14–20, 1995 Uhlenbeck OC: A small catalytic deoxyribonucleotide. Nature 328: 596–600, 1987 Koizuni M, Iwai S, Ohtsuka E: Cleavage of specific sites of RNA by designed ribozymes. FEBS Lett 239: 285–288, 1988 Jeffries AC, Symons RH: A catalytic 13-mer ribozyme. NAR 17: 1371– 1377, 1989 Haseloff J, Gerlach WL: Simple RNA enzymes with new and highly specific endoribonuclease activity. Nature 334: 585–591, 1988 Weerasinghe M, Liem SE, Asad S, Read SE, Joshi S: Resistance to human immunodeficiency virus type 1 (HIV-1) infection in human CD 4+ lymphocyte-derived cell lines conferred by using retro viral vectors expressing an HIV-1 RNA-specific ribozyme. J Virol 65: 5531– 5534, 1991 Steve LO KM, Biasolo MA, Dehni G, Palu G, Haseltine WA: Inhibition of replication of HIV-1 by retro viral vectors expressing tatantisense and anti-tat ribozyme RNA. Virol 190: 176–183, 1992 Sullenger BA, Cech TR: Tethering ribozymes to a retro viral packaging signal for destruction of viral RNA. Sci 262: 1566–1569, 1993 Feng M, Cabrera G, Deshane J, Scanlon KJ, Curiel DT: Neoplastic reversion accomplished by high efficiency adenoviral mediated delivery of an anti-ras ribozyme. Cancer Res 55: 2024–2028, 1995 Shimayama T, Nishikawa F, Nishikawa S, Taira K: Nuclease resistant chimeric ribozymes containing deoxyribonucleotides and phosphorothioate linkage. NAR 21: 2605–2611, 1993 Beigelman L, McSwiggen JA, Draper KG, Gonzalez C, Jensen K, Karpeisky AM, Modak AS, Matulic-Adamic J, Direzno AB, Haeberli P, Sweedler D, Tracz D, Griman S, Wencott FE, Thackray VG, Usman N. Chemical modification of hammerhead ribozymes catalytic activity and nuclease resistance. J Biol Chem 270: 25702–25708, 1995 Taylor NR, Kaplan BE, Swiderski P, Li H, Rossi JJ. Chimeric DNARNA hammerhead ribozymes have enhanced in vitro catalytic efficiency and increased stability in vivo. NAR 20: 4559–4565, 1992 Hency P, McCall MJ, Santiago FS, Jennings PA: A ribozyme with DNA in the hybridizing arms displays enhances cleavage ability. NAR 20: 5737–5741, 1992 Kariko K, Megyeri K, Xiao Q, Barnathan ES: Lipofectin-aided cell delivery of ribozyme targeted to human urokinase receptor mRNA. FEBS Lett 352: 41–44, 1994
43. Sioud M, Natvig JB, Forre Ø: Performed ribozyme destroys tumour necrosis factor mRNA in human cells. J Mol Biol 223: 831–835, 1992 44. Pickering JG, Jekanowski J, Weir L, Takeshita S, Losordo DW, Isner JM: Liposome-Mediated gene transfer into human vascular smooth muscle cells. Circ 89: 13–21,1994 45. Capaccioli S, Pasquale GD, Mini E, Mazei T, Quattrone A: Cationic lipids improve antisense oligonucleotide uptake and prevent degradation in cultured cells and in human serum. Biochem Biophys Res Commun 197: 818–825, 1993 46. Hertel KJ, Pardi A, Uhlenbeck OC, Koizumi M, Ohtsuka E, Uesugi S, Cedergren R, Ecketein F, Gerlach WL, Hodgson R, Symons RH: Numbering system for the hammerhead. NAR 20: 3252, 1992 47. Ruffner DE, Stormo GD, Uhlenbeck OC. Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochem 29: 10695– 10702, 1990 48. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Current protocols in molecular biology. John Wiley & Sons, Inc. 1995: 1.0–1.13, 2.7.1, 2.10, 3.1–3.16, 8.2.2. 49. Ogden RC, Adams DA: Electrophoresis in agarose and acrylamide gel. In: SL Berger, AR Kimmel (eds). Method in Enzymology, Vol 152, Guide to Molecular Cloning Techniques. Academic Press, 1987, pp 61–87 50. Bertrand E, Pictet R, Grange T: Can hammerhead ribozymes be efficient tools to inactivate gene function? NAR 22: 293–300, 1994 51. Chang PS, Cantin E, Zaia JA, Ladne PA, Stephens DA, Sarver N, Rossi JJ: Ribozyme-mediated site specific cleavage of the HIV-1 genome. Clin Biotech 2: 23–31, 1990 52. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guandium thiocyante-phenol-chloroform extraction. Anal Biochem 162: 169–159, 1987 53. Heidenreich O, Eckstein F: Hammerhead ribozyme-mediated cleavage of the long terminal repeat RNA of human immunodeficiency virus type 1. J Biol Chem 267: 1904–1909, 1992 54. Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Annal Biochem 72: 284–254, 1976 55. Deshler JO, Rossi JJ: Catalytic Antisense RNAs-principles and Design. Nucleic Acid Targeted Drug Design. Prospst CI, Thomas JP, Marcel Dekker Inc. New York: 557–577, 1992 56. Castanotto D, Bertrand E, Rossi JJ: Antisense technology and ribozymes in molecular biology: current innovation and future trends. AG Hugh (ed). Horizon Scientific Press. Norfold, England part 11, 103–113, 1995 57. Zuker M, Stiegler P: Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. NAR 9: 133–148, 1981 58. Sun L, Warrilow D, Wang L, Witherington C, Macpherson J, Symonds G: Ribozyme-mediated suppression of moloney murine leukemia virus and human immunodeficiency virus type I replication in permissive cell lines. Proc Natl Acad Sci USA 91: 9715–9719, 1994 59. Pachuk CJ, Yoon K, Moelling K, Coney LR: Selective cleavage of bcr-abl chimeric RNAs by a ribozyme targeted to non-contiguous sequences. NAR 22: 301–301, 1994 60. Heindenriech O, Benseler F, Fahrenholz A, Eckstein F: High activity and stability of hammerhead ribozymes containing 2′-modified pyrimidine nucleosides and phosphorothioates. J Biol Chem 269: 2131–2138, 1994 61. Gao X, Huang L: A novel cationic liposome reagent for efficient transfection of mammalian cells. Biochem Biophys Res Commun 179: 280–285, 1991 62. Caplen NJ, Alton E, Middleton PG, Dorin JK, Stevenson BJ, Gao X, Durham SR, Jefferey PK, Hodson ME, Coutelle C, Huang L, Porteous DJ, Williamson R, Geddes DM: Liposome-mediated CFTR gene transfer to the nasal epithelium of patients with cystic fibrosis. Nature Medicine 1: 39–46, 1995