Plant Cell Rep DOI 10.1007/s00299-015-1909-3
ORIGINAL ARTICLE
Activation of anthocyanin biosynthesis by expression of the radish R2R3-MYB transcription factor gene RsMYB1 Sun-Hyung Lim1 • Ji-Hye Song1 • Da-Hye Kim1 • Jae Kwang Kim2 Jong-Yeol Lee1 • Young-Mi Kim1 • Sun-Hwa Ha3
•
Received: 14 September 2015 / Revised: 4 November 2015 / Accepted: 19 November 2015 Ó Springer-Verlag Berlin Heidelberg 2015
Abstract Key message RsMYB1, a MYB TF of red radish origin, was characterized as a positive regulator to transcriptionally activate the anthocyanin biosynthetic machinery by itself in Arabidopsis and tobacco plants. Abstract Anthocyanins, providing the bright red-orange to blue-violet colors, are flavonoid-derived pigments with strong antioxidant activity that have benefits for human health. We isolated RsMYB1, which encodes an R2R3-MYB transcription factor (TF), from red radish plants (Raphanus sativus L.) that accumulate high levels of anthocyanins. RsMYB1 shows higher expression in red radish than in common white radish, in both leaves and roots, at different growth stages. Consistent with RsMYB1 function as an anthocyanin-promoting TF, red radishes showed higher expression of all six anthocyanin biosynthetic and two
Communicated by Y.-I. Park.
Electronic supplementary material The online version of this article (doi:10.1007/s00299-015-1909-3) contains supplementary material, which is available to authorized users. & Sun-Hyung Lim
[email protected] & Sun-Hwa Ha
[email protected] 1
National Academy of Agricultural Science, Rural Development Administration, Jeonju 54874, Republic of Korea
2
Division of Life Sciences and Bio-Resource and Environmental Center, Incheon National University, Incheon 22012, Republic of Korea
3
Department of Genetic Engineering and Graduate School of Biotechnology, Kyung Hee University, Yongin 17104, Republic of Korea
anthocyanin regulatory genes. Transient expression of RsMYB1 in tobacco showed that RsMYB1 is a positive regulator of anthocyanin production with better efficiency than the basic helix-loop-helix (bHLH) TF gene B-Peru. Also, the synergistic effect of RsMYB1 with B-Peru was larger than the effect of the MYB TF gene mPAP1D with B-peru. Arabidopsis plants stably expressing RsMYB1 produced red pigmentation throughout the plant, accompanied by up-regulation of the six structural and two regulatory genes for anthocyanin production. This broad transcriptional activation of anthocyanin biosynthetic machinery in Arabidopsis included up-regulation of TRANSPARENT TESTA8, which encodes a bHLH TF. These results suggest that overexpression of RsMYB1 promotes anthocyanin production by triggering the expression of endogenous bHLH genes as potential binding partners for RsMYB1. In addition, RsMYB1-overexpressing Arabidopsis plants had a higher antioxidant capacity than did non-transgenic control plants. Taken together, RsMYB1 is an actively positive regulator for anthocyanins biosynthesis in radish plants and it might be one of the best targets for anthocyanin production by single gene manipulation being applicable in diverse plant species. Keywords Radish
Anthocyanins Antioxidant R2R3-MYB
Abbreviations 4CL 4-coumarate-CoA ligase bHLH basic helix-loop-helix ANS anthocyanidin synthase CHI chalcone isomerase CHS chalcone synthase DFR dihydroflavonol 4-reductase F3H flavanone 3-hydroxylase F30 H flavonoid 30 -hydroxylase
123
Plant Cell Rep
PAL qRT-PCR TF TT2 TT8 TTG1
phenylalanine ammonia lyase quantitative real time polymerase chain reaction transcription factor TRANSPARENT TESTA2 TRANSPARENT TESTA8 TRANSPARENT TESTA GLABRA1
Introduction Radishes are cultivated to produce seed oil and sprouts, as well as edible taproots, which contain valuable phytochemicals such as glucosinolates and flavonoids (Blazˇevic´ and Mastelic´ 2009; Park et al. 2011). Some radish varieties have red skin and/or flesh due to anthocyanin accumulation. Anthocyanins are a class of flavonoids that have received significant attention due to their potential health benefits, including inhibition of cell proliferation and antimutagenic, antimicrobial, anti-inflammatory, antioxidant, and antihypertensive properties (Akihisa et al. 2003; Butelli et al. 2008). The genetics, biochemistry, and molecular biology of the anthocyanin biosynthetic pathway have been well characterized (Koes et al. 2005; Grotewold 2006). The mechanisms controlling the anthocyanin biosynthetic pathway are highly conserved in many plant species, such as Arabidopsis, Oryza sativa (rice), and Malus domestica (apple) (Grotewold, 2006; Lepiniec et al. 2006; Lim and Ha, 2013; Lin-Wang et al. 2010). Members of three transcription factor (TF) families, R2R3-MYB, basic helixloop-helix (bHLH), and WD40 repeat DNA protein (WDR), activate anthocyanin biosynthesis as components of the MBW complex (Hichri et al. 2011). The WDR protein stabilizes the MBW complex by binding to the bHLH TF, which interacts with R2R3-MYB. The highly conserved N-terminal motif within the DNA-binding domain of R2R3-MYB binds the bHLH TF. Among the three proteins forming the MBW complex, R2R3-MYB is thought to bind directly to DNA targets related to anthocyanin biosynthesis (Hichri et al. 2011). Transcription factors from the MYB family also repress anthocyanin biosynthesis and several R3-MYBs and R2R3MYBs have been identified as components of a transcriptional inhibitory complex of anthocyanin biosynthesis. These factors have an ethylene response factor-associated amphiphilic repression domain in their C-terminal region and compete with the R2R3-MYB activator for binding to bHLH TF (Aharoni et al. 2001; Dubos et al. 2008; Matsui et al. 2008). Some MYB TFs have been targeted in metabolic engineering strategies to increase anthocyanin biosynthesis in
123
plants. Overexpression of Arabidopsis PRODUCTION OF ANTHOCYANIN PIGMENT1 (AtPAP1) caused anthocyanins to accumulate in the roots, leaves, and stems of transgenic Arabidopsis, Nicotiana tabacum (tobacco), and Taraxacum plants (Borevitz et al. 2000; Qiu et al. 2014). Overexpression of the cauliflower purple gene (Pr-D) or apple MdMYB10 caused the accumulation of high levels of anthocyanins in cauliflower and apple, respectively (Chiu et al. 2010; Espley et al. 2007). By contrast, expression of the maize MYB gene Colorless1 (C1) or Myrica rubra (Chinese bayberry) MrMYB1 failed to induce the production of anthocyanins when transformed into Solanum lycopersicum (tomato) or tobacco, respectively (Huang et al. 2013b, Lloyd et al. 1992). In other cases, anthocyanin production was only promoted when the MYB TF was coexpressed with a bHLH TF (Bovy et al. 2002; Butelli et al. 2008). Interestingly, spatial patterns of anthocyanin accumulation induced by the same MYB gene vary according to the plant species transformed. For example, overexpression of MrMYB1 led to whole-body accumulation of anthocyanins in Arabidopsis, but increased levels of anthocyanins only in the specific tissues that usually produce anthocyanins in tobacco (Huang et al. 2013b). This tissue specificity likely resulted from a requirement for co-expression of the endogenous bHLH counterpart for anthocyanin production in tobacco. For that reason, choice of MYB genes depending on crops might be important for effective metabolic engineering of anthocyanin production. In this study, we cloned RsMYB1 from a red radish cultivar that accumulates high levels of anthocyanin. Expression of RsMYB1 in tobacco and Arabidopsis induced anthocyanin production by up-regulation of anthocyanin biosynthetic and regulatory genes. This broad transcriptional activation by RsMYB1, without the additional introduction of a bHLH TF gene, suggests that RsMYB1 might be an ideal target gene for manipulating anthocyanin metabolism in diverse plant species, as well as for molecular breeding programs in radish.
Materials and methods Radish plant materials Using commercial F1 seeds of the radish cultivar ‘Bordeaux’ (Syngenta Co.), two different color types of homozygous F3 progeny were developed through budpollination. The plants were photographed at the young seedling stage (2-, 3-, and 5-day-old) and the mature stage (6-week-old). For quantitative real time PCR (qRT-PCR), leaves including of cotyledons and roots of two colored radishes were harvested at the young seedling stage (5-dayold) and mature stages (6-week-old).
Plant Cell Rep
Cloning of RsMYB1 from red radish plants Total RNA from roots of red radish was prepared using TRIzol Reagent (Invitrogen, Carlsbad, USA) and firststrand cDNA was generated using the cDNA EcoDry Kit (Clontech, Madison, USA). To clone the novel MYB gene from radish, a degenerate primer set of RsMYB-Fd (50 -TGGACTVVWGARGAAGAYWDTCT-30 )/RsMYBRd (50 -GTGTTCCAYAYTTMTTSACYMCYTTTGC-30 ) was designed in the highly conserved regions of R2R3MYB genes known to be involved in anthocyanin production from various plants. A 281-bp PCR fragment was obtained as a partial fragment of a putative radish MYB gene. On the basis of this partial sequence, 50 and 30 gene-specific primers were designed to amplify the fulllength cDNA of the radish MYB by rapid amplification of cDNA ends (RACE) in both the 50 - and 30 -directions. A 5 lg of total RNA from red radish was used for these RACE-PCRs by preparing the RACE-Ready DNA with a SMART RACE cDNA amplification kit (Clontech). PCR primers MYB-F, 50 -ATGGAGGGTTCGTCCAAA-30 / MYB-R, 50 -TTACACAGTCTCTCCATCTAACAGGC TC-30 , which were designed from the aligned DNA sequences of two PCR products, were used to amplify the full-length cDNA of the radish MYB (hereafter RsMYB1). All PCR fragments were subcloned into the pGEM-T Easy Vector (Promega, Madison, USA) for validation of DNA sequences. Transient assay of RsMYB1 function in anthocyanin production The plasmid used in tobacco transient expression assay and Arabidopsis stable transformation was constructed as followings. The open reading frame of RsMYB1 was subcloned into the pENTR/D-TOPO vector (Invitrogen) and incorporated into the Gateway destination vector pB7WG2D (VIB-Ghent University, Ghent, Belgium) harboring cauliflower mosaic virus (CaMV) 35S promoter through several Gateway cloning steps. The resultant vector (pB7WG2D-RsMYB1) was maintained in Agrobacterium strain LBA4404 for infiltration of the abaxial leaf surface of Nicotiana tabacum. After infiltration, the leaf color was monitored at 5 days post-infiltration (dpi), as described in Lim et al. (2012). Construct pB7WG2D-RsMYB1 in Agrobacterium strain GV3101 was transformed into Arabidopsis (Columbia-0 genetic background) using the floral dipping method and the transformed Arabidopsis seeds were grown in soil under a 16 h light/8 h dark regimen at 20 °C (Clough and Bent 1998). Transgenic Arabidopsis plants were selected by
spraying with 0.3 % Basta. Homozygous T3 lines were selected and used for further analysis. RNA extraction and quantitative RT-PCR Total RNAs and cDNAs for qRT-PCR were prepared from radish, tobacco, and Arabidopsis using TRIZol reagent (Invitrogen) and the cDNA EcoDry Kit (Clontech). The conditions for qRT-PCR were as reported by Lim et al. (2013). Expression of target genes was normalized using the RNA polymerase-II transcription factor (RPII) gene for radish, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene for tobacco and the elongation factor 1 alpha (EF1a) gene for Arabidopsis as an internal reference. All gene-specific primers used for qRT-PCR analysis are listed in Table 1. Three biological replicates and three technical replicates were performed for each sample. Determination of total anthocyanin contents Total anthocyanin content was determined according to the method described by Shin et al. (2007). Briefly, powdered samples were incubated in 600 lL of extraction buffer (methanol containing 1 % HCl) for 6 h at 4 °C with moderate shaking. Then, 200 lL of water and 200 lL of chloroform were added and the samples were centrifuged at 14,000 rpm for 5 min to deposit the sediment of the plant material. After centrifugation, absorbance of the sample was recorded at 530 nm (A530) and 657 nm (A657) using a microplate reader. The quantity of anthocyanin was determined using the following equation: (A530) - 0.33A657. All samples were measured as triplicates in three independent biological replicates. Antioxidant activity assay The 2,20 -azinobis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) assay, 1,1-diphenyl-2-picrylhydrazyl (DPPH), and ferric ion reducing antioxidant power (FRAP) assay were performed as described by Kim et al. (2014), with some modifications. For the ABTS assay, 7 mM ABTS was mixed with 2.45 mM potassium persulfate and the mixture was stored for 12 h in the dark at room temperature. The solution was diluted until the absorbance at 734 nm reached 1.1 ± 0.02 as measured with a microplate reader. Next, 10 lL of each leaf extract of control and transgenic Arabidopsis plants was mixed with 300 lL of diluted ABTS solution in 96-well plates, and incubated for 30 min in the dark. The absorbance was then measured at 734 nm using a microplate reader (lQuan BioTek Instruments, Winooski, USA).
123
Plant Cell Rep Table 1 qRT-PCR primers used in this study
Genes
Forward primer sequence (50 –30 )
Reverse primer sequence (50 –30 )
RsPAL
CGTCTCCTCAGTGGCTAG
CGTGAATCGCTTTGTTCCT
RsCHS
GTGACTGGAACTCCCTCT
CTCTCATCTTCTCAGCCTTG
RsCHI
TCCATCCTCTTCGCTCTC
GACACACGGTTCTTTCCAA
RsF3H
TTACAAGCCACACGAGAC
ATGGTCGCCTAGATTAACAAC
RsDFR
CGTTAGCGGAGAAAGCAG
GGCGGCATAGATGTTGTTAT
RsANS
GAAGTTGGTGGCTTAGAAGAG
ATGTTGTGTAGAATCAAGGTCAA
RsMYB1
GTGCATGGACTGCTGAAGAA
CAGTCCGACCGGGTAATCTA
RsTT8
AGTGATCGGAGCTGAGGAAA
ACTTGCTTCCTCCTCGCATA
RsTTG1
AACAGCAAGACGTCCGAGTT
GATGTCGTGGACCTCCTTGT
RsRPII
ATCACGCTAAATGGTCTCCT
GCTGCTCTCAATCAAGTCAATC
NtPAL
ATTGAGGTCATCCGTTCTGC
ACCGTGTAACGCCTTGTTTC
Nt4CL
TCATTGACGAGGATGACGAG
TGGGATGGTTGAGAAGAAGG
NtCHS
TTGTTCGAGCTTGTCTCTGC
AGCCCAGGAACATCTTTGAG
NtCHI
GTCAGGCCATTGAAAAGCTC
CTAATCGTCAATGCCCCAAC
NtF3H NtDFR
CAAGGCATGTGTGGATATGG AACCAACAGTCAGGGGAATG
TGTGTCGTTTCAGTCCAAGG TTGGACATCGACAGTTCCAG
NtANS
TGGCGTTGAAGCTCATACTG
GGAATTAGGCACACACTTTGC
NtGAPDH
GGTGTCCACAGACTTCGTGG
GACTCCTCACAGCAGCACCA
AtPAL
GCGGTTAATGAGGTTGTGA
GTTAGTGAGGCTGCTTGG
AtCHS
ATCTTGGCTATTGGCACTG
CTCCTTGAGGTCGGTCAT
AtCHI
AAGTGACGGAGAATTGTGT
GGAGAGAGCGAAGAGGAT
AtF3H
ATTTCAGAGAGGTATGCCAAG
ACCAGGTAGACCCAAACTAA
AtF30 H
GGTTAAAGCCCAAGAAGAACT
TGGTGGATGAAGCCTGAA
AtDFR
GGTCGGTCCATTCATCAC
GCACATACTGTCCTTGTCT
AtANS
GCTATTCTACGAGGGCAAAT
AATCCTAACCTTCTCCTTATTCAC
AtTT2
AGATTGGCTCCGAGACTT
GCGTTCAGACAAATACAGATATAC
AtTT8
TCTAATGGAGGAAGGTGGAA
AACGATGATTGGATGTAAGAAGA
AtTTG1
TTGTTCTGGTGGTGATGATAC
CAATCAGGCTGCGAAGAA
AtPAP1
GAAGCGACGACAACAGAA
GAAGCGACGACAACAGAA
AtEF1 alpha
GCCACACCTCTCACATTG
TACCAGCGTCACCATTCT
For the DPPH assay, 10 lL of each leaf extract of control and transgenic Arabidopsis plants was mixed with 300 lL of DPPH ethanol solution (0.2 mM) in 96-well plates, and incubated for 30 min at room temperature in the dark. The absorbance was then measured at 515 nm using a microplate reader. For the FRAP assays, the FRAP reagent was freshly prepared by mixing acetate buffer (pH 3.6), 10 mM TPTZ (in 40 mM HCl), and 20 mM FeCl36H2O (in distilled water) at a ratio of 10:1:1. Next, 10 lL of each leaf extract of control and transgenic Arabidopsis plants was mixed with 300 lL of FRAP solution in 96-well plates and incubated for 30 min at 37 °C. Then, the absorbance was measured at 593 nm using a microplate reader. All of the experiments were performed in triplicate, and all of the results are presented as the trolox equivalent antioxidant
123
capacity (TEAC), 0.05–2.5 mM.
with
concentration
ranges
of
Results Isolation of RsMYB1 from red radish To investigate the regulation of anthocyanin biosynthesis in red radish, we cloned a MYB-type TF gene via degenerate PCR and 50 - and 30 -RACE-PCR and designated this gene as RsMYB1. RsMYB1 has a 747-bp open reading frame encoding a polypeptide of 248 amino acids (GenBank accession number KR706195). Further PCR and sequence analysis of RsMYB1 revealed that it consists of three exons and two introns (Supplementary S1a). The
Plant Cell Rep
genomic structure of RsMYB1 showed the same configuration as those of AtPAP1 and BoMYB2, anthocyaninpromoting R2R3-MYB genes in the Brassicaceae family, which have the first intron that are three and six times
longer, respectively, than the second intron. The structure of RsMYB1 differed from those of other anthocyanin-promoting R2R3-MYB genes in other families, as these MYB genes have the second intron that is longer than the first intron (Borevitz et al. 2000; Chiu et al. 2010; Lin-Wang et al. 2010). These R2R3-MYB genes with exons of similar length and introns of significantly different length in different plant species showed a correlation between total length of introns and the determined chromosome size, indicating that the differences in intron length result in differences in genome size (Sena et al. 2014). In a phylogenetic tree among R2R3-MYB proteins from various plant species (Fig. 1, Supplementary S1b), RsMYB1 falls in the AN2 subgroup. Sequence alignments showed that all R2R3-MYB of the AN2 and C1 subgroups shared the conserved motif [D/E]Lx2[R/K]x3Lx6Lx3R in the R3 domain, which is functionally important for the interaction between MYB and R/B-like bHLH proteins (Yamagishi et al. 2010). However, only MYBs of the AN2 subgroup share the common KPRPR[S/T]F motif in the C-terminal region, which is conserved in all anthocyaninpromoting MYBs (Lin-Wang et al. 2010). Particularly, the MYBs of Arabidopsis, Brassica oleracea (cabbage), and radish grouped into the same cluster, consistent with their close taxonomic relationship. Sequence analysis of RsMYB1 with anthocyanin-related R2R3-MYBs showed 22–88 % identity at the amino acid level. We also observed 64–98 % identity in the R2R3 region, indicating that the conserved R2R3 region of these MYB proteins likely coevolved with its interaction counterpart for anthocyanin
Fig. 2 Comparison of color phenotypes between white and red radishes at different developmental stages. a, e shoots of 2-day-old seedlings, b, f roots of 3-day-old seedlings, c, g cotyledons of 5-day-
old seedlings, d, h cross sections of mature roots of 6-week-old plants. Left panels white radish with green leaves and white roots. Right panels red radish with red leaves and red roots. Scale bar 1 mm
Fig. 1 A neighbor-joining phylogenetic tree of plant R2R3-MYB sequences. Numbers next to the nodes are bootstrap values from 100 replications. The deduced amino acid sequences were retrieved from the DDBJ/EMBL/GenBank databases. The following sequences were included in the analysis: AmROSEA1 (ABB83826) and AmVENOSA (ABB83828) in Antirrhinum majus, AtPAP1 (NP_176057) and AtPAP2 (NP_176813) in Arabidopsis, BoMYB2 (ADP76650) in Brassica oleracea, GhMYB10 (CAD87010) in Gerbera hybrida, LeANT1 (AAQ55181) in Lycopersicon esculentum, MdMYB10 (ABB84753) in Malus 9 domestica, OsC1 (CAA75509) in Oryza sativa, PhAN2 (AAF66727) in Petunia 9 hybrida, RsMYB1 (KR706195) in Raphanus sativus, ZmPl (AAA19821), and ZmC1 (P10290) in Zea mays
123
Plant Cell Rep
To examine the difference of anthocyanin biosynthetic mechanisms between red and white radishes, their phenotypes were firstly compared during diverse development stages (Fig. 2). White radish has green leaves and white roots; by contrast, red radish has red leaves and roots in all developmental stages. To identify the relationship between color phenotype and transcript levels of anthocyanin biosynthetic genes, we measured the expression of six structural genes (one that functions upstream of anthocyanin biosynthetic pathway, phenylalanine ammonia lyase
(PAL) and three early biosynthetic genes, i.e., chalcon synthase (CHS), chalcone isomerase (CHI), and flavanone 3-hydroxylase (F3H), and two late biosynthetic genes, i.e., dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS), in the anthocyanin biosynthetic pathway) and three regulatory genes (i.e., the R2R3-MYB-type RsMYB1, the bHLH-type TRANSPARENT TESTA8 (TT8) RsTT8, and the WDR class TRANSPARENT TESTA GLABRA1(TTG1) RsTTG1) in seedlings (Fig. 3a, b) and in mature plants (Fig. 3c, d). The leaves and roots of young red radish seedlings had higher RsMYB1 transcript levels than did those of white radish and the difference was greater in the leaves than roots. The expression pattern of RsMYB1, which was detected in red but not green leaves, was similar to that of two early biosynthetic genes (RsCHS and RsF3H), two late biosynthetic genes (RsDFR and RsANS), and a TF (RsTT8). Transcript levels of RsPAL gene were somewhat highly
Fig. 3 Expression of anthocyanin structural and regulatory genes in leaves (green for white radish and red for red radish) and roots (white for white radish and red for red radish) at two different developmental stages. qRT-PCR analysis of expression in young seedlings (a, b) and mature plants (c, d). Results represent mean values ± SD from three biological replicates. The six structural genes of the anthocyanin biosynthetic pathway analyzed include one upstream pathway gene
(phenylalanine ammonia lyase, PAL), three early biosynthetic genes (chalcone synthase, CHS, chalcone isomerase, CHI, and flavanone 3-hydroxylase, F3H), and two late biosynthetic genes (dihydroflavonol 4-reductase, DFR, and anthocyanidin synthase, ANS). The three regulatory TF genes include RsMYB1 (R2R3-MYB), RsTT8 (bHLH), and RsTTG1 (WDR). The white and gray boxes indicate white and red radish, respectively
synthesis and the remaining region of MYB evolved independently in different species. Thus, RsMYB1 might function as an anthocyanin-promoting R2R3-MYB gene in radish. Expression analysis of structural and regulatory genes of anthocyanin biosynthesis in radish
123
Plant Cell Rep
Fig. 3 continued
detected in red leaves, but no significant differences of transcription level were observed for RsCHI and RsTTG1 in red leaves compared to the green leaves of white radish. Similarly, in roots also, the transcript pattern of RsDFR, RsANS, and RsTT8 was similar to that of RsMYB1, being present only in red radish. Transcript levels of RsPAL, RsCHS, and RsCHI of roots were also higher in those of leaves from the both of a white and a red radish, but the expression of RsF3H, RsDFR, RsANS, RsMYB1, and RsTT8 was rather lower in the roots than in the leaves from the both of a white and a red radish. At maturity, RsMYB1 expression was higher in both the leaves and roots of red radish compared to white radish. In contrast to the young seedling stages, the relative expression levels showed a bigger difference in roots than leaves. RsMYB1 expression was greater in red than green leaves, as was the expression of two late biosynthetic genes (RsDFR and RsANS). The transcript levels of RsPAL, RsCHS, RsCHI, RsF3H, RsTT8, and RsTTG1 were not appreciably different between red and white radish leaves. However, in the roots, the expression of all genes involved in anthocyanin biosynthesis except RsTTG1 was greater in the roots of red than white radish, as was that of RsMYB1. The strong expression
of RsMYB1 matched the expression of RsDFR, RsANS, and RsTT8 regardless of the organ and developmental stage. Transient expression of RsMYB1 in tobacco leaves To evaluate the potential function of RsMYB1 in inducing anthocyanin production in tobacco plants, we conducted transient expression assays by leaf infiltrating with Agrobacterium strains harboring diverse transcription factors including B-Peru (bHLH), RsMYB1 (MYB), and mPAP1D (MYB). Single infiltration of B-Peru (2) did not induce anthocyanin production, but co-infiltration of BPeru with RsMYB1 (5) or mPAP1D (4) did induce red pigmentation. Infiltration with RsMYB1 alone (3) or coinfiltration of RsMYB1 with B-Peru (5) also successfully induced red pigmentation (Fig. 4a). The red pigmentation appeared as early as 2 days post-infiltration and became gradually stronger up to 7 days. Consistent with the visual assessment of red coloring, leaf disks collected at 5 days after agro-infiltration had barely detectable levels of anthocyanin in leaf disks infiltrated with mock (1) and B-Peru (2) and different levels in leaf disks infiltrated with RsMYB1 (3), mPAP1D and B-
123
Plant Cell Rep
123
Plant Cell Rep b Fig. 4 Infiltration with Agrobacterium strains harboring various
combinations of anthocyanin regulatory genes in tobacco leaves. a Tobacco leaves transiently expressing (1) Empty vector, (2) B-Peru (bHLH), (3) RsMYB1 (MYB), (4) mPAP1D (MYB) with B-Peru, (5) RsMYB1 with B-Peru. Photographs were taken 5 days after agroinfiltration. b Anthocyanin contents (top-left) and relative expression levels of seven endogenous anthocyanin biosynthetic genes of tobacco, including PAL, 4CL (4-coumarate-CoA ligase), CHS, CHI, F3H, DFR, and ANS. Results represent mean values ± SD from three biological replicates
Peru (4), and RsMYB1 and B-Peru (5). Thus, RsMYB1 expression is sufficient to induce anthocyanin accumulation and its synergistic effect with B-Peru is larger than the effects of mPAP1D in tobacco plants. To examine the relationship between the transcript levels of anthocyanin biosynthetic genes and anthocyanin production, we analyzed the transcript levels of seven structural genes (i.e., NtPAL, 4-coumarate-CoA ligase (Nt4CL), NtCHS, NtCHI, NtF3H, NtDFR, and NtANS) in the infiltrated tobacco leaf disks using qRT-PCR (Fig. 4b). Expression of RsMYB1 alone increased the expression levels of all anthocyanin biosynthetic genes that were examined, compared with the mock infiltration. Moreover, these increases were dramatically greater when RsMYB1 was co-infiltrated with B-Peru. This co-expression of RsMYB1 and B-Peru resulted in higher transcript levels of all anthocyanin biosynthetic genes than in leaf disks infiltrated with mPAP1D and B-Peru, consistent with the measured anthocyanin contents. Infiltration with B-Peru alone induced the expression of NtPAL, Nt4CL, NtDFR, and NtANS, even though no red pigmentation was visible and the anthocyanin contents were similar to those in the mock-infiltrated control. The above data indicate that
RsMYB1 induces anthocyanin production via the transcriptional activation of anthocyanin biosynthetic genes in tobacco plants. Stable expression of RsMYB1 in Arabidopsis plants To test whether RsMYB1 induces anthocyanin production in Arabidopsis, we generated transgenic lines expressing RsMYB1 under the control of CaMV35S promoter. Among twenty-two RsMYB1 transgenic Arabidopsis plants that were obtained by floral dipping, we selected two lines based on their red color, representing strong anthocyanin accumulation (RsMYB1-1) and moderate anthocyanin accumulation (RsMYB1-2). At the T3 generation, the RsMYB1-1 line showed distinctly reddish flowers, stigmas, buds, stems, and seeds, compared with non-transgenic (NT) Arabidopsis plants (Fig. 5). We also performed the qRT-PCR with the leaves to examine the expression levels of endogenous structural genes for anthocyanin biosynthesis in RsMYB1-1 and RsMYB1-2 compared with NT plants (Fig. 6a). The transgenic plants showed much higher transcript levels of six anthocyanin structural genes (i.e., AtCHS, AtCHI, AtF3H, flavonoid 30 -hydroxylase (AtF30 H), AtDFR, and AtANS), but not AtPAL, compared with NT plants. Strong up-regulation of AtDFR and AtANS might affect anthocyanin accumulation in transgenic Arabidopsis plants. We next measured the expression levels of four endogenous regulatory genes, i.e., TRANSPARENT TESTA2 (AtTT2), AtTT8, AtTTG1, and AtPAP1, in the transgenic and NT plants (Fig. 6b). The transgenic expression of RsMYB1 resulted in a 46- and 3-fold increase
Fig. 5 Phenotypic changes resulting from RsMYB1 expression in Arabidopsis plants. a and e flower, b and f stigma, c and g bud and stem, d and h seeds from non-transgenic (a–d) and transgenic (e–h) Arabidopsis plants. Scale bar 1 mm
123
Plant Cell Rep
Fig. 6 Effects of RsMYB1 expression on anthocyanin contents and endogenous structural and regulatory gene expression in Arabidopsis plants. a Relative expression of seven endogenous anthocyanin biosynthetic genes, i.e., PAL, CHS, CHI, F3H, F30 H (flavonoid 30 hydroxylase), DFR, and ANS, b Relative expression of RsMYB1 and
four endogenous regulatory genes, i.e., AtTT2, AtTT8, AtTTG1, and AtPAP1. C. Anthocyanin contents. NT indicates non-transgenic plants and RsMYB1-1 and RsMYB1-2 indicate transgenic Arabidopsis plants. All results represent mean values ± SD from three biological replicates
Fig. 7 Total antioxidant activity in the aerial parts of non-transgenic (NT) and transgenic Arabidopsis plants. Total antioxidant capacity was measured using ABST, DPPH, and FRAP assays. Results
represent mean values ± SD from three biological replicates. Triple asterisks indicate values that differ significantly from WT at P \ 0.001, according to Student’s paired t test
in anthocyanin content in RsMYB1-1 and RsMYB1-2, respectively (Fig. 6c), along with a marked up-regulation of AtTT8 and AtPAP1, but little down-regulation of AtTT2 and AtTTG1 (Fig. 6b). Taken together, these data indicate that RsMYB1 significantly activates the anthocyanin biosynthetic machinery at the transcriptional level in Arabidopsis plants, as in tobacco leaves.
Antioxidant activity in RsMYB1-expressing transgenic Arabidopsis plants
123
To evaluate the influence of anthocyanins on antioxidant activity, we measured the total radical-scavenging activities of Arabidopsis leaf extracts using ABTS, DPPH, and FRAP assays (Fig. 7). Antioxidant activities were higher in
Plant Cell Rep
RsMYB1-1 and RsMYB1-2 than in the NT plants, with levels ranging from 131 to 123 % (ABTS), 122 to 115 % (DPPH), and 142 to 138 % (FRAP), respectively. This suggests that the increased levels of anthocyanin resulting from RsMYB1 expression could greatly enhance the total antioxidant capacities in Arabidopsis plants.
Discussion In this study, we isolated RsMYB1, which encodes a typical anthocyanin-promoting MYB, with the highly conserved R2R3-MYB repeat domains, a signature motif that interacts with bHLH, and a C-terminal conserved motif (Supplementary Figure 1b). The presence of these conserved structural motifs supports the idea that RsMYB1 functions in anthocyanin accumulation. Variations in pigmentation in different tissues in red and white radish likely result from transcriptional variation of genes involved in anthocyanin biosynthesis (Figs. 2, 3). Indeed, the expression of two late biosynthetic genes (RsDFR and RsANS) was higher in all red radish, as like previous result that reported the higher expression of RsDFR and RsANS genes in the skin and flesh of red radish (Park et al. 2011). Similar results have been reported in cauliflower; high levels of transgenic BoMYB2 expression throughout plant development, along with dramatic up-regulation of endogenous DFR and ANS, produced purple cauliflower (Chiu et al. 2010). Specially, RsMYB1 expression was greater in the all red radish regardless to development stage, similar to the expression of a bHLH TF (RsTT8). Looked into the organs at different growth stage, it was observed the higher expression level of most of anthocyanin biosynthetic genes and RsTT8 in the leaves at young seedling stage and roots at mature stage, in parallel with the expression of RsMYB1. The regulatory TFs complex consisting of R2R3-MYB, bHLH, and WD40 proteins have been reported to control multiple enzymatic steps in the anthocyanin biosynthetic pathway (Hichri et al. 2011). Among these, co-expression of two classes of TFs, R2R3-MYB, and bHLH, is indispensable for the activation of anthocyanin biosynthetic genes (Bovy et al. 2002; Butelli et al. 2008). Also, work in Chinese berry and Litchi chinensis reported a requirement for an endogenous bHLHtype TF as a binding partner for anthocyanin-promoting MYBs (Huang et al. 2013a; Lai et al. 2014). We assessed the ability of RsMYB1 to induce anthocyanin synthesis in tobacco and Arabidopsis plants ectopically expressing this gene. In previous reports in Zea mays (maize), tomato, apple, and Chinese bayberry, MYB genes such as C1, MdMYB10, and MrMYB1 resulted in very weak anthocyanin accumulation without bHLH-type TFs (Bovy et al. 2002; Espley et al. 2007; Huang et al.
2013b). By contrast, expression of RsMYB1 produced red pigmentation due to significant accumulation of anthocyanins in both tobacco leaves and Arabidopsis plants without expression of an exogenous bHLH as a binding partner (Figs. 4a, 5). Moreover, overexpression of RsMYB1 resulted in up-regulation of most of the structural and regulatory genes needed for anthocyanin biosynthesis (Figs. 4b, 6). Particularly in tobacco, RsMYB1 may function as a positive regulator with better efficiency than mPAP1D (other MYB) and have a synergistic effect with B-Peru (bHLH) for activation of anthocyanin production (Fig. 4). Moreover, RsMYB1-transgenic Arabidopsis displayed strongly up-regulation of six structural genes except AtPAL and two regulatory genes of AtTT8 (bHLH) and AtPAP1 (R2R3-MYB) except AtTT2 (R2R3-MYB) and AtTTG1 (WDR). Similar results reported that ectopic expression of MdMYB3 gene in tobacco led to higher expression of endogenous R2R3-MYB NtAN2 gene that can induce the gene expression of anthocyanin biosynthetic pathway (Vimolmangkang et al. 2015). As like the promoter region of NtAN2, we detected two putative MYB binding site motifs, AACTAA and AACCAA, located at -778 to -772, and -237 to -231 bp in the upstream of the start codon of AtPAP1, respectively. Through the further study for whether or not the RsMYB1 protein can bind the cis-acting element of AtPAP1, it will give more information about interconnection between endogenous R2R3-MYB and exogenous R2R3-MYB.Considering that several studies indicated that AtTT2, AtTT8, and AtTTG1 form the MBW complex to regulate the proanthocyanidins biosynthesis in plants, the consequences of down-regulation of AtTT2 and AtTTG1 remain unclear. In conclusion, strong transcriptional activation of most anthocyanin biosynthetic genes as a consequence of RsMYB1 expression was confirmed in radish (Fig. 3), tobacco (Fig. 4b), and Arabidopsis (Fig. 6). Especially, a strong relationship of RsMYB1 expression with the expression of two late biosynthetic genes and a bHLH-type TF occurred in radish (RsDFR, RsANS, and RsTT8), tobacco (NtDFR and NtANS with B-Peru) and Arabidopsis (AtDFR, AtANS and AtTT8). Considering the importance of a bHLH-type TF as a binding partner with RsMYB1, the similarity in higher expression of RsMYB1 and RsTT8 in red radish, the synergistic effect of RsMYB1 and B-Peru to trigger anthocyanin production in tobacco leaves, and the up-regulation of AtTT8 in RsMYB1-transgenic Arabidopsis suggest that higher overexpression of RsMYB1 should result in upregulation of the bHLH gene as the binding partner in radish, tobacco, and Arabidopsis. Previous work reported genes showing similar expression to RsMYB1 and similar abilities to activate anthocyanin accumulation; these genes include AtPAP1, Pr-D, and EsMYBA1 from various plants such as Arabidopsis,
123
Plant Cell Rep
cauliflower, and barrenwort (Borevitz et al. 2000; Chiu et al. 2010; Huang et al. 2013a). Several studies also reported that anthocyanins have high antioxidant activities in human health (Butelli et al. 2008). However, most reports have included limited results on examination of the abilities of those TFs to induce anthocyanin accumulation in one or two plant systems. In this study, we suggest that introduction of RsMYB1 alone, without co-expression of other genes, might be a useful tool for significant enrichment of anthocyanin as a valuable antioxidant pigment to increase radical-scavenging activity (Fig. 7). We also find that RsMYB1 may act via broad transcriptional activation of endogenous anthocyanin biosynthetic genes in diverse plants, as confirmed by ectopic expression in tobacco and Arabidopsis, as well as its strong effect on gene expression in red radish plants. Author contribution statement S-H Lim designed the experiments, prepared the figures, and wrote the manuscript. S-J Song participated in qRT-PCR of radish. D-H Kim performed the anthocyanin analysis and qRT-PCR of Arabidopsis and tobacco. JK Kim participated in the anthocyanin analysis in Arabidopsis and tobacco. Y-J Lee performed the microscopy experiments. Y-M Kim carried out the experiment related in antioxidant activity. S-H Ha designed this study with S-H Lim and wrote the manuscript together. All authors read and approved the final manuscript. Acknowledgments This work was supported by a fund from the National Academy of Agricultural Science (PJ01002701) and a grant from the Next-Generation BioGreen 21 Program (PJ01109402), Rural Development Administration, Republic of Korea. Compliance with ethical standards Conflict of interest of interest.
The authors declare that they have no conflict
References Aharoni A, De Vos CHR, Wein M, Sun Z, Greco R, Kroon A, Mol JNM, O’Connell AP (2001) The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. Plant J 28:319–332 Akihisa T, Tokuda H, Ukiya M, Iizuka M, Schneider S, Ogasawara K, Mukainaka T, Iwatsuki K, Suzuki T, Nishino H (2003) Chalcones, coumarins, and flavanones from the exudate of Angelica keiskei and their chemopreventive effects. Cancer Lett 25:133–137 Blazˇevic´ I, Mastelic´ J (2009) Glucosinolate degradation products and other bound and free volatiles in the leaves and roots of radish (Raphanus sativus L.). Food Chem 113:96–102 Borevitz JO, Xia Y, Blount J, Dixon RA, Lamb C (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12:2383–2394 Bovy A, de Vos R, Kemper M, Schijlen E, Almenar Pertejo M, Muir S, Collins G, Robinson S, Verhoeyen M, Hughes S, Santos-
123
Buelga C, van Tuinen A (2002) High-flavonol tomatoes resulting from the heterologous expression of the maize transcription factor genes LC and C1. Plant Cell 14:2509–2526 Butelli E, Titta L, Giorgio M, Mock HP, Matros A, Peterek S, Schijlen EG, Hall RD, Bovy AG, Luo J, Martin C (2008) Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nat Biotechnol 26:1301–1308 Chiu LW, Zhou X, Burke S, Wu X, Prior RL, Li L (2010) The purple cauliflower arises from activation of a MYB transcription factor. Plant Physiol 154:1470–1480 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743 Dubos C, Le Gourrierec J, Baudry A, Huep G, Lanet E, Debeaujon I, Routaboul J-M, Alboresi A, Weisshaar B, Lepiniec L (2008) MYBL2 is a new regulator of flavonoid biosynthesis in Arabidopsis thaliana. Plant J 55:940–953 Espley RV, Hellens RP, Putterill J, Stevenson DE, Kutty-Amma S, Allan AC (2007) Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J 49:414–427 Grotewold E (2006) The genetics and biochemistry of floral pigments. Annu Rev Plant Biol 57:761–780 Hichri I, Barrieu F, Bogs J, Kappel C, Delrot S, Lauvergeat V (2011) Recent advances in the transcriptional regulation of the flavonoid biosynthetic pathway. J Exp Bot 62:2465–2483 Huang W, Sun W, Lv H, Luo M, Zeng S, Pattanaik S, Yuan L, Wang Y (2013a) A R2R3-MYB transcription factor from Epimedium sagittatum regulates the flavonoid biosynthetic pathway. PLoS One 8:e70778 Huang YJ, Song S, Allan AC, Liu XF, Yin XR, Xu CJ, Chen KS (2013b) Differential activation of anthocyanin biosynthesis in Arabidopsis and tobacco over-expressing an R2R3 MYB from Chinese bayberry. Plant Cell Tissue Organ Cult 113:491–499 Kim GR, Jung ES, Lee S, Lim SH, Ha SH, Lee CH (2014) Combined mass spectrometry-based metabolite profiling of different pigmented rice (Oryza sativa L.) seeds and correlation with antioxidant activities. Molecules 19:15673–15686 Koes R, Verweij W, Quattrocchio F (2005) Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci 10:236–242 Lai B, Li XJ, Hu B, Qin YH, Huang XM, Wang HC, Hu GB (2014) LcMYB1 is a key determinant of differential anthocyanin accumulation among genotypes, tissues, developmental phases and ABA and light stimuli in Litchi chinensis. PLoS One 9:e86293 Lepiniec L, Debeaujon I, Routaboul JM, Baudry A, Pourcel L, Nesi N, Caboche M (2006) Genetics and biochemistry of seed flavonoids. Annu Rev Plant Biol 57:405–430 Lim SH, Ha SH (2013) Marker development for identification of rice seed coat color. Plant Biotechnol Rep 7:391–398 Lim SH, Kim DH, Kim JK, Lee JY, Kim YM, Sohn SH, Kim DH, Ha SH (2013) Petal-specific activity of the promoter of an anthocyanin synthase gene of tobacco (Nicotiana tabacum L.). Plant Cell Tiss Organ Cult 114:373–383 Lim SH, Sohn SH, Kim DH, Kim JK, Lee JY, Kim YM, Ha SH (2012) Use of an anthocyanin production phenotype as a visible selection marker system in transgenic tobacco plant. Plant Biotechnol Rep 6:203–211 Lin-Wang K, Bolitho K, Grafton K, Kortstee A, Karunairetnam A, McGhie TK, Espley RV, Hellens RP, Allan AC (2010) An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae. BMC Plant Biol 10:50 Lloyd AM, Walbot V, Davis RW (1992) Arabidopsis and Nicotiana anthocyanin production activated by maize regulators R and C1. Science 258:1773–1775
Plant Cell Rep Matsui K, Umemura Y, Ohme-Takagi M (2008) AtMYBL2, a protein with a single MYB domain, acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis. Plant J 55:954–967 Park NI, Xu H, Li X, Jang IH, Park S, Ahn GH, Lim YP, Kim SJ, Park SU (2011) Anthocyanin accumulation and expression of anthocyanin biosynthetic genes in radish (Raphanus sativus). J Agri Food Chem 59:6034–6039 Qiu J, Sun S, Luo S, Zhang J, Xiao X, Zhang L, Wang F, Liu S (2014) Arabidopsis AtPAP1 transcription factor induces anthocyanin production in transgenic Taraxacum brevicorniculatum. Plant Cell Rep 33:669–680 Shin J, Park E, Choi G (2007) PIF3 regulates anthocyanin biosynthesis in an HY5-dependent manner with both factors directly
binding anthocyanin biosynthetic gene promoters in Arabidopsis. Plant J 49:981–994 Vimolmangkang S, Han Y, Wei G, Korban SS (2015) An apple MYB transcription factor, MdMYB3, is involved in regulation of anthocyanin biosynthesis and flower development. BMC Plant Biol 13:176 Yamagishi M, Shimoyamada Y, Nakatsuka T, Masuda K (2010) Two R2R3-MYB genes, homologs of petunia AN2, regulate anthocyanin biosynthesis in flower tepals, tepal spots and leaves of Asiatic hybrid lily. Plant Cell Physiol 51:463–474
123