Tumor Biol. (2012) 33:767–774 DOI 10.1007/s13277-011-0292-0

RESEARCH ARTICLE

Analysis of the expression of angiotensin II type 1 receptor and VEGF in endometrial adenocarcinoma with different clinicopathological characteristics Agnieszka Wanda Piastowska-Ciesielska & Elżbieta Płuciennik & Katarzyna Wójcik-Krowiranda & Andrzej Bieńkiewicz & Andrzej Bednarek & Tomasz Ochędalski

Received: 22 September 2011 / Accepted: 2 December 2011 / Published online: 15 December 2011 # International Society of Oncology and BioMarkers (ISOBM) 2011

Abstract In Poland, endometrial carcinoma takes second place after breast cancer among all cancers in women and is considered the most common genital cancer. It has been repeatedly reported that angiotensin is involved in the development and invasion of some cancers including breast, ovarian, and pancreatic ones. It is suggested that angiotensin two and its receptors are actively involved in tumour biology in endometrial adenocarcinoma. In the present study, we identify a possible relationship between the expression of AT1-R, AT2R, ERα, and VEGF and clinicopathological characteristics of primary endometrial adenocarcinoma. We determined the above components both at the mRNA (real-time RT-PCR) and protein levels (Western Blot assay). Our results indicate that in patients with grade G3 adenocarcinoma, the expression of AT1-R significantly decreased in comparison with G1 A. W. Piastowska-Ciesielska : T. Ochędalski Department of Comparative Endocrinology, Medical University of Lodz, Lodz, Poland E. Płuciennik : A. Bednarek Department of Molecular Carcinogenesis, Medical University of Lodz, Lodz, Poland K. Wójcik-Krowiranda : A. Bieńkiewicz Clinical Division of Gynecological Oncology, Medical University of Lodz, Lodz, Poland A. W. Piastowska-Ciesielska (*) Department of Comparative Endocrinology, Faculty of Biomedical Sciences and Postgraduate Training, Medical University of Lodz, Zeligowskiego 7/9, Lodz 90-752, Poland e-mail: [email protected]

patients (p00.034), but the level of ERα was the highest in G2 and the lowest in G3. Moreover, the level of VEGF mRNA significantly increased between G2 and G3 (p00.034). We also noted a significant correlation between the expression of AT1-R and AT2-R in FIGO stage 1 (Rs 00.9636; p00.0001) and that of AT2-R and VEGF (Rs 00.5377; p00.005). In grade G1 and G2 carcinoma, a significant correlation was also found between the expression of AT1-R and AT2-R (Rs 00.9924; p0 0.0001; Rs 00.8717, p00.0005, respectively), but in grade G1, a negative correlation was observed between AT1-R and VEGF (Rs 0−0.8945, p00.0005). Further studies are required to clarify the biological function of the angiotensin receptor in regulating VEGF expression in endometrial carcinoma. Keywords Endometrial adenocarcinoma . Angiotensin receptor . Oestrogen receptor . Clinicopathological characteristics

Introduction Endometrial carcinoma is the most common gynaecological cancer in women in developed countries [1]. In Poland, it comes second to breast cancer among all cancers in women and is the most common genital cancer [1]. Most endometrial carcinoma cases are detected in the early stages and therefore result in favourable clinical outcomes [2]. However, a significant number of patients with an early-stage disease develop both localised recurrence and distant metastases [2]. The mechanism of development of this tumour remains unclear. Solid tumours require angiogenesis in the process of progression. Angiogenesis is an important physiological process associated with neovascularisation and

768

also contributes to the metastatic process, carrying cancer cells into the circulation [2–4]. There is a local autocrine or paracrine renin–angiotensin system (RAS) in a number of tissues [5]. In mammalian cells, angiotensin II (Ang II) binds to two distinct high-affinity plasma membrane receptors, an angiotensin II type 1 receptor (AT1-R), and an angiotensin II type 2 receptor (AT2-R). AT1 receptor activation leads to vascular contraction, inflammatory responses, salt and water retention, and cell proliferation, whereas the AT2 receptor induces apoptosis. But in some tissues, an increased vascular endothelial growth factor (VEGF) synthesis is mediated by AT2-R [6–8]. Recently, it has been suggested that Ang II is not only a vasoconstrictive agent but also a growth factor acting similarly to cytokines [9]. VEGF is an important endothelial cell mitogen associated with increased angiogenesis and is considered a potent factor increasing vessel permeability and aggressive tumour behaviour [2]. Giatromanolaki et al. [10] have demonstrated that the standard microvessel density and VEGF are important indicators of a poor prognosis in patients with endometrial carcinoma. Some studies showed that angiotensin II stimulated VEGF expression in human smooth muscle cells [9]. Oestrogens are another important group of regulatory factors for the endometrial mucosa, stimulating its proliferation when unopposed by progesterone. This commonly results in hyperplasia and occasionally in endometrioid endometrial cancer [11]. Oestrogens exert their effect on endometrial cells through receptors which bind the ovarian hormones with high affinity and specificity [12]. Oestrogen receptors (ER) are members of the nuclear receptor superfamily. They are ligand-dependent transcription factors that, on activation, bind to distinct DNA target sites to modulate the expression of specific genes [13]. Two subtypes of ER, alpha and beta (ERα, ERβ), are known, but in the uterus ERα is predominant. During a malignant transformation, the endometrial cells may lose their oestrogen hormone complement, and this situation has been connected with partial or complete loss of hormone dependence [12]. In many studies, such tumours were shown to exhibit a more aggressive phenotype, a poorer prognosis, and an ineffective response to endocrine therapy [12]. In the present study, we sought to identify the relationship between the expression of AT1-R, AT2-R, ERα, and VEGF and the clinicopathological characteristics of primary endometrial adenocarcinoma in patients at different stages of cancer.

Tumor Biol. (2012) 33:767–774

study—79 with endometrial adenocarcinoma and 22 are control. Control samples were obtained from patients operated due to gynaecological diseases other than of endometrial origin. Clinicopathological information was obtained from patient charts. All the patients were staged according to the classification of the International Federation of Gynecology and Obstetrics (FIGO), and their tumours were graded by differentiation stage as: well (G1, ≤5% solid components), moderately (G2, 6–50% solid components) or poorly differentiated (G3, >50% solid components). Moreover, additional clinicopathological parameters, such as lymph node metastases and myometrial invasion, were assessed. Samples of hysterectomy specimens were stained with haematoxylin and eosin (H&E) for light microscopic study and evaluated to confirm the tumour stage and histological type (Fig. 1). None of the patients had received radiotherapy or chemotherapy prior to surgery. Experiments involving human subjects were conducted according to the Declaration of Helsinki: the study was approved by the Ethics Committee at Medical University of Lodz. Total RNA isolation, cDNA synthesis Tumour samples were stored at −80°C in RNAlater (Life Technology, Ambion, Poland), and RNA was isolated using the TRIzol reagent (Life Technology, Invitrogen, Poland). cDNA synthesis was performed using 10 μg of total RNA at a total volume of 100 μl with ImProm RT-II reverse transcriptase (Promega, Poland). Reverse transcriptions was performed under the following conditions: 5 min incubation at 25°C and 60 min at 42°C, and heating at 70°C for 15 min. The synthesised cDNA was diluted with sterile deionised water to 150 μl, and 2 μl of cDNA were used in the PCR reaction. Real-time RT-PCR analysis

Patients and methods

Real-time RT-PCR was performed with a Light Cycler 480 II (Roche, Poland). PCR products were detected with SYBR Green I and a qPCR Core Kit for SYBR Green I (Eurogentec, Belgium). Reactions were performed in duplicate. We analysed the relative expression of genes (ERα, AT1, AT2, VEGF). Their expression level was normalised to the mean expression of four reference genes (BMG2, RPS17, RPLPO, H3F3A) [14, 15]. The primer sequences, PCR reaction conditions and length of the products received are presented in Table 1. All primers were designed to be intron spanning in order to exclude genomic DNA amplification. The detection temperature was set above the non-specific/primer-dimer melting temperature.

Patients

Protein isolation and immunoblotting analysis

Altogether, 101 patients who had been surgically treated between 2008 and 2010 at the Clinical Division of Gynecological Oncology, Medical University of Lodz, were included in this

Total protein from frozen tissues was extracted in a RIPA protein extraction buffer supplemented with protease and phosphatase inhibitor cocktails and PMSF (Sigma-Aldrich,

Tumor Biol. (2012) 33:767–774

769

Fig. 1 Formalin-fixed paraffin-embedded sections stained of hysterectomy specimens were stained with haematoxylin and eosin (H&E) for light microscopic study and evaluated to confirm the tumour stage and histological type. a, b and c Sections of endometrial infiltrative carcinomas grade 1 (G1). d, e and f Sections of endometrial infiltrative carcinoma grade 2 (G2). g, h and i Sections of endometrial infiltrative carcinomas grade 3 (G3). Original magnification: a to f and i, ×100, and g and h, ×200

Poland). The lysate was centrifuged at 14,000×g and 4°C for 20 min, and the pellet was discarded. Protein concentrations were determined by the Bradford method (Bio-Rad

Table 1 Real-time RT-PCR primers and reaction conditions used for expression analysis of the specified genes

Laboratories, Poland) according to the manufacturer's protocol, using bovine serum albumin as a standard. Protein lysates were mixed with a fourfold concentrated Laemmli

Gene primers (5′→3′) BMG2 TGAGTGCTGTCTCCATGTTTGA TCTGCTCCCCACCTCTAAGTTG RPS17 AAGCGCGTGTGCGAGGAGATCG TCGCTTCATCAGATGCGTGACATAACCTG RPLPO ACGGATTACACCTTCCCACTTGCTAAAAGGTC AGCCACAAAGGCAGATGGATCAGCCAAG H3F3A AGGACTTTAAAAGATCTGCGCTTCCAGAG ACCAGATAGGCCTCACTTGCCTCCTGC ERα ATCTCGGTTCCGCATGATGAATCTGC TGCTGGACAGAAATGTGTACACTCCAGA VEGF ATCACGAAGTGGTGAAGTTC TGCTGTAGGAAGCTCATCTC AT1-R ATTCGACCCAGGTGATCAAA CCACCAAGCTGTTTCCAAAT AT2-R GCAGCCTGAATTTTGAAGGA ACCGCTGGTAATGTTTTTGC

PCR product size (bp)

Annealing temp. (°C)

Detection temp. (°C)

88

50

81

87

64

72

69

65

72

76

65

72

98

65

72

267

60

72

168

56

72

164

50

72

770

buffer, heated for 2–5 min at 100°C, and deposited on the gel at 30 μg of protein per track. Protein samples were subjected to 10% SDS-PAGE and electrophoretically transferred to a PVDF membrane (Sigma-Aldrich, Poland). The membrane was preincubated in 5% non-fat milk in TBST (20 mM Tris– HCl, 500 mM NaCl, 0.05%, Tween-20, pH 7.5) for 1 h at room temperature. After this time, the membranes were incubated for 12 h at 4°C with an addition of selected primary antibodies against AT1-R (sc-1173, Santa Cruz Biotechnology Inc., AMX, Poland, dilution 1:1,000 in PBS containing 5% powdered milk and 0.025% NaN3), AT2-R (sc-9040, Santa Cruz Biotechnology Inc., AMX, Poland, dilution 1:1,000 in PBS containing 5% powdered milk and 0.025% NaN3), ERα (sc8005, Santa Cruz Biotechnology Inc., AMX, Poland, dilution 1:1,000 in PBS containing 5% powdered milk and 0.025% NaN3) and VEGF (sc-152, Santa Cruz Biotechnology Inc., AMX, Poland, dilution 1:1,000 in PBS containing 5% powdered milk and 0.025% NaN3). After overnight incubation, the membrane was washed with TBST and incubated for 2 h in a solution of secondary antibodies conjugated with alkaline phosphatase (Sigma-Aldrich, Poland). After incubation with secondary antibodies, the membrane was washed three times in a TBST buffer. The colour reaction was induced using SIGMAFAST™ BCIP®/NBT (Sigma-Aldrich, Poland). Bands were visualised on membranes. A densitometric analysis of protein levels was performed with ImageJ 1.34s software (Wayne Rasband, National Institutes of Health, USA. http:// rsb.info.nih.gov/ij/), and the results were expressed as optical density. The results were normalised for glyceraldehyde-3phosphate dehydrogenase (GAPDH, sc-59540, Santa Cruz Biotechnology Inc., AMX, Poland, dilution 1:1,000 in PBS containing 5% powdered milk and 0.025% NaN3). Statistical analysis Student's t test and an analysis of variance with a Bonferroni correction were used to compare the AT1-R, AT2-R, ERα and VEGF levels, and p<0.05 was considered significant. The analysis of correlation between the expression levels of AT1-R, AT2-R, ERα and VEGF and clinical factors was performed using a non-parametric Spearman Rank Correlation test. The Roche algorithm was used to calculate the relative expression levels of the genes [16]. The Universal Human Reference RNA (composed of ten cell lines) was used as a calibrator for each reaction.

Results Clinicopathological characteristics of the patients The mean age of our patients diagnosed with endometrial adenocarcinoma was 61.9 years (with an age range of 36–

Tumor Biol. (2012) 33:767–774

83), the mean age of patients from control group was 53.3 years (with an age range of 40–68). The grade distribution among the patients was: 35.4% of cases were classified as G1, 36.7% of the patients had tumours in grade 2 and 27.9% were classified as G3. The FIGO classification was as follows: 58.2% of the samples were identified as I, 21.5% as II and 20.3% as III. In 81% of cases, lymph node metastasis was not detected, and in 49%, invasion of the myometrium exceeded the upper half.

Differences in the expression of AT1-R, AT2-R, ERα and VEGF in patients To determine whether the appearance of AT1-R, AT2-R, ERα and VEGF was shown in endometrial adenocarcinoma, we analysed the relative expression of the genes and their products. We also analysed the relation between the level of the above-mentioned genes depending on progression in the tumours. The average relative expression of AT1-R, AT2-R, ERα and VEGF fluctuated depending on the tumour grade. The expression levels of AT1-R and AT2-R decreased in the samples depending on the cancer stage from grade G1 and G3 (Fig. 2a, b). The results of real-time RT-PCR indicate that the expression of AT1-R mRNA in tissues classified as G3 was significantly decreased in comparison with G1 (42.47±4.3, 4.85±1.6, p00.034). A similar tendency, but not statistically significant, was observed in the expression of AT2-R mRNA (16.84±5.3, 11.83±8.8, p00.059). A similar relationship was noted when the three carcinoma grades (G1 to G3) were compared for the expression levels of ERα. However, in this case, the highest ERα expression was observed in G2 (34.1± 5.7), and the lowest, in G3 (11.1±6.0), similar to the AT1-R and AT2-R mRNA levels (Fig. 2c). Different results were obtained in the case of variations in the relative expression of VEGF. The level of VEGF mRNA was significantly increased between G2 and G3 (7.91±2.1, 14.15±4.4, p00.034), while in G1, it was slightly higher than in G2 (10.29±4.0, 7.91±2.1, p> 0.05) (Fig. 2d). A statistically significant difference was also observed in G2 between the relative expression of AT1-R and ERα (11.52±4.1, 34.1±10.1, p00.03). We also found a significant correlation between the expression levels of AT1-R and AT2-R in FIGO stage 1c and 1b (Rs 00.9636; p00.0001; Rs 00.5613; p00.005, respectively) and between VEGF and AT2-R in FIGO stage 1b (Rs 00.5377; p00.005). In grade G1, a significant correlation was also noted between the levels of AT1-R and AT2-R, AT2-R and ERα (Rs 00.9924; p00.0001; Rs 00.6771, p00.0001, respectively), in G2, a significant correlation between ERα and VEGF (Rs 00.8483, p00.0001) and between AT1-R and AT2-R (Rs 00.8717, p00.0005, respectively), but in G1, an inverse correlation between AT1-R and VEGF (Rs 0−0.8945, p00.0005) was also observed. The relative expression of AT1-R, AT2-R, ERα and VEGF in the control group was significantly lower than in

Tumor Biol. (2012) 33:767–774

771

Fig. 2 Expression of AT1-R, AT2-R, ERα and VEGF mRNA in representative tissue from G1 to G3 endometrial adenocarcinoma. The relative expression of genes (AT1,AT2, ERα,VEGF) was normalised to the mean expression of four reference genes (REF) (BMG2, RPS17, RPLPO, H3F3A). a Relative levels of total AT1-R mRNA in grade 1, 2, 3 (G1, G2, G3). One asterisk denotes significant difference between mRNA levels of G1 AT1 and G3 AT1. b Relative levels of total AT2-R mRNA in grades 1, 2, 3 (G1, G2, G3). c Relative levels of total ERα mRNA in grades 1, 2, 3 (G1, G2, G3). One asterisk denotes significant difference between mRNA levels of G2 ERα and G3 ERα. d Relative levels of total VEGF mRNA in grades 1, 2, 3 (G1, G2, G3). One asterisk denotes significant difference between mRNA levels of G2 VEGF and G3 VEGF

tumour samples (1.74±0.11, 1.05±0.08, 1.41±0.3, 0.93± 0.035, respectively). An analysis of protein levels gave comparable results concerning the relative expression of the genes. Immunoblotting assays showed that the total quantity of AT1-R protein was greater in tissues classified as the G1 (29.8±8.0) group than in G2 (5.0±1.5) and G3 (8.2±3.1); statistical significance was noted between G1 and G2 (p<0.002), and G3 (p<0.02) (Fig. 3a). The AT2-R protein level was similar in all the grades. Unlike the AT2-R mRNA levels, the AT2 protein concentration was slightly elevated in the G3 group (10.4± 1.1) when compared with G1 (8.8±2.7) (Fig. 3c). ERα protein was at comparable levels in the tissues classified as G1 (37.0± 9.1) and G2 (37.4±9.4), but in G3 (8.6±2.7), it was significantly lower (Fig. 3b). As in the mRNA expression, the protein level of VEGF was statistically significantly higher in G3 (27.4±7.0) when compared with G1 (8.5±2.3, p< 0.002) and G2 (10.2±2.3, <0.05) (Fig. 3d). Similar to the relative expression of the genes, a protein level in control samples was lower than in tumour probes. Total quantity of AT1-R, AT2-R, ERα and VEGF protein was 6.3±1.4, 5.7±1.3, 5.6±0.9 and 3.2±1.0, respectively.

Discussion In the present study, we examined the expression of the angiotensin II receptors: type 1 and 2 (AT1-R, AT2-R), oestrogen

receptor 1 (alpha) (ERα) and vascular endothelial growth factor (VEGF) in endometrial adenocarcinoma, and we showed that the relative expression of the investigated genes correlated with tumour differentiation and the clinical stage of the carcinoma. Angiotensin II (Ang II), which is a major effector peptide of the renin–angiotensin system (RAS), is well known to be an important factor in hypertension [5]. A local autocrine or paracrine RAS exists in a number of tissues [9, 17–19]. It has been reported that Ang II is involved in the development and invasion of some cancers, including breast, ovarian and pancreatic ones [20–22]. The existence of all RAS factors has been confirmed, and it is suggested that the most active RAS factors, Ang II and AT1-R, are actively involved in tumour biology in endometrial adenocarcinomas [2, 9]. Shibata et al. [2] in their immunohistochemical analysis reported positive correlations between Ang II and their receptors' expression with advancing surgical grade. They also determined an association between VEGF expression and metastasis to a lymph node. Our observation confirmed high positive correlations between AT1-R expression and the advancing grade at both the mRNA and protein levels. Our results showed that the expression of angiotensin receptors depended of the degree of solid components (grades G1–G3). The uppermost expression of AT1-R (at the mRNA and protein levels) was noted in G1 cases (8.7 times higher than in the G3 group). This observation could confirm the role of angiotensin in the early stages of tumour development, which could be connected with its role in tumour vascularisation.

772

Tumor Biol. (2012) 33:767–774

Fig. 3 Expression of AT1-R, AT2-R, ERα and VEGF protein in representative tissue from G1 to G3 endometrial adenocarcinoma. a Data represent mean values of AT1-R protein level± SE, in grades 1, 2, 3 (G1, G2, G3). One asterisk denotes significant difference between AT1-R protein levels of G1 versus G2, G3. b Data represent mean values of ERα protein level±SE, in grades 1, 2, 3 (G1, G2, G3). One asterisk denotes significant difference between ERα protein levels of G3 versus G1, G2. c Data represent mean values of AT2-R protein level±SE, in grades 1, 2, 3 (G1, G2, G3). d Data represent mean values of VEGF protein level± SE, in grades 1, 2, 3 (G1, G2, G3). One asterisk denotes significant difference between VEGF protein levels of G1 versus G3. a'–d' Representative immunoblots with antibodies against human AT1-R, AT2-R, ERα, VEGF and GAPDH demonstrate immunopositive bands in the human endometrial adenocarcinoma

Watanabe et al. [9] demonstrated that angiotensin affected endometrial cell migration. Moreover, they showed that Ang II enhanced VEGF expression in a dose-dependent

manner in endometrial carcinoma cells via angiotensin receptors [9]. These results could explain our observations in which the highest expression of those receptors was noted

Table 2 Relative mRNA expression of AT1-R, AT2-R, ERα and VEGF according to the clinicopathological characteristics of the patients (mean±SEM)

Grade

Stage

Myometrial invasion

No of case

AT1-R (mean±standard error)

AT2-R (mean±standard error)

ERα (mean±standard error)

VEGF (mean±standard error)

1 2 3 I II III

28 29 22 46 17 16

42.47±4.3 11.52±4.1 4.85±1.6 33.33±3.3 11.71±7.0 3.10±0.7

16.84±5.3 15.90±9.4 11.83±8.8 21.87±4.1 4.10±1.6 4.03±1.8

27.2±7.9 34.10±5.7 11.06±6.0 24.26±7.6 18.36±9.2 16.09±9.3

10.29±4.0 7.91±2.1 14.15±4.4 7.46±2.0 8.02±2.9 7.25±3.7

<50% >50%

35 39

13.58±3.7 4.13±1.0

12.77±5.7 4.6±2.1

20.67±6.5 19.77±5.3

5.82±1.26 14.65±3.8

Tumor Biol. (2012) 33:767–774

in cases where myometrial invasion was lower than a half of its thickness, which is also connected with the G1 grade. This proliferative function of angiotensin in endometrial cancer in the later stages of differentiation was probably targeted by oestrogens and VEGF. Before the cancer invasion reached a half of the myometrium, AT1-R expression was 3.2 times higher than in the later stages. This observation confirms also 7.8 times lower expression of AT1-R in control group. Simultaneously, in the first phase of the invasion, VEGF expression was inverted in comparison with AT1-R. Our results indicate that VEGF can have a predominant role in a later invasion of the myometrium. Corroborating the results presented by Shibata et al. [2], also in our study, the expression level of VEGF significantly correlated with clinicopathological features of the patients (Table 2). VEGF is regulated by several factors including Ang II. Some data indicate that VEGF plays a major role in angiogenesis in human carcinomas, and a few data suggest that Ang II might stimulate angiogenesis in endometrioid endometrial adenocarcinoma [2]. As shown by Watanabe et al. [9], angiotensin II stimulated VEGF expression in human endometrial carcinoma. The same team concluded that possible interactions among the effects of Ang II via AT1-R and VEGF might influence the angiogenesis-dependent growth in human endometrial carcinomas. These findings could explain the higher expression of VEGF in tumours of an advanced grade and showing a deep myometrial invasion. A similar observation was made by Bai and Mi [23], who noted that VEGF was positively correlated with the tumour grade. According to Day et al. [6], the relatively stable expression of the angiotensin type II receptor may be an indirect proof of its involvement in the angiotensindependent secretion of VEGF. As in Bai and Mi [23], our research showed the expression of ERα to be the lowest in patients with grade G3, in which more than 50% of tumours were composed of solid components. A reduced level of ERα indicates a marginal role of oestrogen in poorly differentiated tumours [11, 24]. In conclusion, this is the first report showing a correlation in the expression of angiotensin receptors (AT1-R, AT2-R), ERα and VEGF on mRNA as well as protein levels with the clinicopathological characteristics of endometrial adenocarcinomas. We found a significant correlation between the expression of the angiotensin receptors and the FIGO stage (p00.0001) and between AT2-R expression and VEGF (p0 0.005). Our analysis showed that in an early stage of differentiation of endometrial cancer, there is a strong correlation between both angiotensin receptors (p00.0005) and an inverse correlation between AT1-R and VEGF (p00.0005). Further studies are required to clarify the biological function of the angiotensin receptors in regulating VEGF expression in endometrial carcinomas. However, the obtained results suggest that the receptors may constitute potent prognostic

773

markers of endometrial adenocarcinoma development and differentiation. The knowledge of the exact mechanisms regulating the signalling pathways induced via AT1-R and AT2-R activation in adenocarcinoma may lead to the development of new therapeutical approaches in the treatment of endometrial cancers. Acknowledgments The authors acknowledge Medical University of Lodz Contract grant number: 503/0-078-04/502-19-581 and 503/0078-04/503-01. Conflicts of interest None

References 1. Grosman-Dziewiszek P, Dziegiel P, Zabel M. Disturbance of gene expression in endometrial cancer as therapy aim. Ginekol Pol. 2011;82:276–80. 2. Shibata K, Kikkawa F, Mizokami Y, Kajiyama H, Ino K, Nomura S, Mizutani S. Possible involvement of adipocyte-derived leucine aminopeptidase via angiotensin II in endometrial carcinoma. Tumour Biol. 2005;26:9–16. 3. Lam KY, Leung PS. Regulation and expression of a renin–angiotensin system in human pancreas and pancreatic endocrine tumours. Eur J Endocrinol. 2002;146:567–72. 4. Uemura H, Ishiguro H, Nagashima Y, Sasaki T, Nakaigawa N, Hasumi H, Kato S, Kubota Y. Antiproliferative activity of angiotensin II receptor blocker through cross-talk between stromal and epithelial prostate cancer cells. Mol Cancer Ther. 2005;4:1699–709. 5. Ager EI, Neo J, Christophi C. The renin–angiotensin system and malignancy. Carcinogenesis. 2008;29:1675–84. 6. Day RT, Cavaglieri RC, Tabatabaimir H, Mantravadi V, Lee MJ, Barnes JL, Kasinath BS, Feliers D. Acute hyperglycemia rapidly stimulates VEGF mRNA translation in the kidney. Role of angiotensin type 2 receptor (AT2). Cell Signal. 2010;22:1849–57. 7. Hsueh WA. Renin in the female reproductive system. Cardiovasc Drugs Ther. 1988;2:473–7. 8. Mitchell MD, Edwin SS, Pollard JK, Trautman MS. Renin stimulates decidual prostaglandin production via a novel mechanism that is independent of angiotensin II formation. Placenta. 1996;17:299–305. 9. Watanabe Y, Shibata K, Kikkawa F, Kajiyama H, Ino K, Hattori A, Tsujimoto M, Mizutani S. Adipocyte-derived leucine aminopeptidase suppresses angiogenesis in human endometrial carcinoma via renin–angiotensin system. Clin Cancer Res. 2003;9:6497–503. 10. Giatromanolaki A, Sivridis E, Brekken R, Thorpe PE, Anastasiadis P, Gatter KC, Harris AL, Koukourakis MI. The angiogenic “vascular endothelial growth factor/flk-1(KDR) receptor” pathway in patients with endometrial carcinoma: prognostic and therapeutic implications. Cancer. 2001;92:2569–77. 11. Taylor SE, Patel II, Singh PB, Nicholson CM, Stringfellow HF, Gopala Krishna RK, Matanhelia SS, Martin-Hirsch PL, Martin FL. Elevated oestrogen receptor splice variant ERalphaDelta5 expression in tumour-adjacent hormone-responsive tissue. Int J Environ Res Publ Health. 2010;7:3871–89. 12. Sivridis E, Giatromanolaki A, Koukourakis M, Anastasiadis P. Endometrial carcinoma: association of steroid hormone receptor expression with low angiogenesis and bcl-2 expression. Virchows Arch. 2001;438:470–7. 13. Ryan AJ, Susil B, Jobling TW, Oehler MK. Endometrial cancer. Cell Tissue Res. 2005;322:53–61. 14. Vandesompele J, De PK, Pattyn F, Poppe B, Van RN, De PA, Speleman F. Accurate normalization of real-time quantitative RT-

774

15.

16.

17.

18.

Tumor Biol. (2012) 33:767–774 PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3:RESEARCH0034. de Kok JB, Roelofs RW, Giesendorf BA, Pennings JL, Waas ET, Feuth T, Swinkels DW, Span PN. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Lab Invest. 2005;85:154–9. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30:e36. Neo JH, Ager EI, Angus PW, Zhu J, Herath CB, Christophi C. Changes in the renin angiotensin system during the development of colorectal cancer liver metastases. BMC Cancer. 2010;10:134. Schauser KH, Nielsen AH, Dantzer V, Poulsen K. Angiotensinconverting enzyme activity in the bovine uteroplacental unit changes in relation to the cycle and pregnancy. Placenta. 2001;22:852–62.

19. Ino K, Shibata K, Yamamoto E, Kajiyama H, Nawa A, Mabuchi Y, Yagi S, Minami S, Kikkawa F. 2011 Role of the renin-angiotensin system in gynecologic cancers. Curr Cancer Drug Targets 11 (4):405-11 20. Tahmasebi M, Barker S, Puddefoot JR, Vinson GP. Localisation of renin–angiotensin system (RAS) components in breast. Br J Cancer. 2006;95:67–74. 21. Lau ST, Leung PS (2011). Role of the RAS in pancreatic cancer. Curr Cancer Drug Targets 11(4):412-20 22. Koh SL, Ager EI, Christophi C. Liver regeneration and tumour stimulation: implications of the renin–angiotensin system. Liver Int. 2010;30:1414–26. 23. Bai X, Mi R. Expression of VEGF, bFGF and ER in endometrial carcinoma. Zhonghua Zhong Liu Za Zhi. 2001;23:211–3. 24. Yasue A, Hasegawa K, Udagawa Y (2011). Effects of tamoxifen on the endometrium and its mechanism of carcinogenicity. Hum Cell 24(2):65-73